Starting /dee2/code/volunteer_pipeline.sh SRR12951320 current disk space = 1542920658944 free memory = 1597587328 SRR12951320 SRAfilesize dba2b1cea38b9b03e161cd53d08687f4 SRR12951320.sra SRR12951320.sra file validated SRR12951320 is paired end SRR12951320 is conventional basespace SRR12951320 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951320_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.542 37.0 37.0 37.0 37.0 37.0 2 36.2905 37.0 37.0 37.0 37.0 37.0 3 36.526 37.0 37.0 37.0 37.0 37.0 4 36.582 37.0 37.0 37.0 37.0 37.0 5 36.652 37.0 37.0 37.0 37.0 37.0 6 36.6375 37.0 37.0 37.0 37.0 37.0 7 36.483 37.0 37.0 37.0 37.0 37.0 8 36.559 37.0 37.0 37.0 37.0 37.0 9 36.6725 37.0 37.0 37.0 37.0 37.0 10-14 36.6071 37.0 37.0 37.0 37.0 37.0 15-19 36.6005 37.0 37.0 37.0 37.0 37.0 20-24 36.5462 37.0 37.0 37.0 37.0 37.0 25-29 36.514 37.0 37.0 37.0 37.0 37.0 30-34 36.467200000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.5027 37.0 37.0 37.0 37.0 37.0 40-44 36.418499999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.44180000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.3886 37.0 37.0 37.0 37.0 37.0 55-59 36.337 37.0 37.0 37.0 37.0 37.0 60-64 36.368199999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.2966 37.0 37.0 37.0 37.0 37.0 70-74 36.2963 37.0 37.0 37.0 37.0 37.0 75-79 36.321400000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3317 37.0 37.0 37.0 37.0 37.0 85-89 36.2448 37.0 37.0 37.0 37.0 37.0 90-94 36.224000000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2012 37.0 37.0 37.0 37.0 37.0 100-104 36.2155 37.0 37.0 37.0 37.0 37.0 105-109 36.24159999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.0988 37.0 37.0 37.0 37.0 37.0 115-119 36.1837 37.0 37.0 37.0 37.0 37.0 120-124 36.05069999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.0255 37.0 37.0 37.0 37.0 37.0 130-134 35.9772 37.0 37.0 37.0 37.0 37.0 135-139 35.9819 37.0 37.0 37.0 37.0 37.0 140-144 35.8728 37.0 37.0 37.0 37.0 37.0 145-149 35.841699999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.67525 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 4.0 26 4.0 27 7.0 28 10.0 29 28.0 30 27.0 31 32.0 32 58.0 33 71.0 34 120.0 35 267.0 36 2854.0 37 516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.75 10.85 4.175 35.225 2 20.632530120481928 11.169678714859439 37.34939759036144 30.84839357429719 3 19.975 17.125 26.5 36.4 4 25.924999999999997 22.525000000000002 21.725 29.825000000000003 5 25.825 30.275000000000002 22.15 21.75 6 26.174999999999997 29.349999999999998 22.775000000000002 21.7 7 19.400000000000002 25.575 36.275 18.75 8 20.75 24.05 29.799999999999997 25.4 9 21.55 21.55 33.575 23.325000000000003 10-14 23.45 26.705000000000002 24.41 25.435000000000002 15-19 23.285 25.405 24.23 27.08 20-24 23.48 25.365 25.014999999999997 26.14 25-29 23.205000000000002 25.259999999999998 24.685000000000002 26.85 30-34 23.56 24.95 25.28 26.21 35-39 23.880000000000003 24.695 24.925 26.5 40-44 24.099999999999998 25.155 25.135 25.61 45-49 24.22 25.169999999999998 24.035 26.575 50-54 23.7 25.374999999999996 24.91 26.015 55-59 24.215 25.805 24.21 25.77 60-64 23.945 24.675 25.515 25.865 65-69 24.445 24.82 25.045 25.69 70-74 24.735 25.314999999999998 24.395 25.555 75-79 24.29 25.745 23.830000000000002 26.135 80-84 24.795 24.52 24.775 25.91 85-89 24.77 24.565 24.79 25.874999999999996 90-94 24.925 25.36 23.685000000000002 26.029999999999998 95-99 24.465 25.319999999999997 24.224999999999998 25.990000000000002 100-104 25.990000000000002 24.81 23.830000000000002 25.369999999999997 105-109 25.169999999999998 25.424999999999997 23.375 26.029999999999998 110-114 24.98 24.555 24.154999999999998 26.31 115-119 24.895 24.935 24.445 25.724999999999998 120-124 24.75 24.77 23.91 26.57 125-129 25.36 24.990000000000002 23.13 26.52 130-134 25.21 25.39 23.375 26.025 135-139 24.77 25.46 23.745 26.025 140-144 24.46 24.615000000000002 24.455 26.47 145-149 24.88 24.62 24.095 26.405 150-151 25.2125 24.099999999999998 24.375 26.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 2.5 28 1.5 29 4.0 30 10.5 31 14.0 32 11.0 33 14.0 34 25.0 35 34.0 36 47.5 37 57.0 38 71.0 39 100.0 40 118.5 41 143.5 42 161.5 43 162.0 44 184.5 45 189.0 46 200.0 47 192.0 48 167.0 49 181.0 50 166.5 51 143.5 52 137.0 53 134.0 54 112.5 55 87.0 56 77.0 57 72.5 58 68.5 59 63.5 60 68.0 61 66.0 62 64.0 63 68.0 64 60.0 65 58.5 66 51.5 67 55.5 68 63.0 69 50.0 70 45.0 71 35.5 72 32.0 73 32.5 74 24.5 75 18.5 76 15.0 77 11.5 78 10.0 79 7.5 80 4.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.075 #Duplication Level Percentage of deduplicated Percentage of total 1 81.54854823602872 65.3 2 14.018108023727754 22.45 3 3.0908523259444274 7.425 4 0.9054011863877615 2.9000000000000004 5 0.3122073056509522 1.25 6 0.06244146113019045 0.3 7 0.031220730565095226 0.17500000000000002 8 0.031220730565095226 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGAACTCTAAGCCCATTTCTCCAGTTCCTTTCGTCATTGAGCTCCAGAC 8 0.2 No Hit GCGACGAGCGCCACGGCGGCGCTCTCCATCTCCACGGGGGTGCACCCGAA 7 0.17500000000000002 No Hit CCCCAGGGTAATAGTCTCGACACCCTCGTCATCAGATTCACCATCCTCGC 6 0.15 No Hit GCAGCCCAAATACGAAAATGGGAACATGATGGACGACCCAATACACTGCA 6 0.15 No Hit GAGGACGATGGTGTATGTCCCGGCGTCGCAGGCTTCGCGCAGGGAGCCTT 5 0.125 No Hit ACTCGTTGTAGCTGTCACAGACGGTTGATGGTGGGGCAGGGGATGGCGGA 5 0.125 No Hit GTCGGTTTCAGAGTGGACATCAACGAGCCAAGCAATGACGTAATATTTAA 5 0.125 No Hit GCTAATTTCCCAGCTCAACAACCTTCTCTTACATTCTCAGATTTAGAGCA 5 0.125 No Hit CCTTGATGCAACAGATCCACCGCAAAAGATTATTAGGAAGAAGAAAGGGC 5 0.125 No Hit TTTTTTTTTATTATGAGCCAAGTGTTGATTTTTTTTCCTTCCTTCGTATT 5 0.125 No Hit CCTTATGATCTTGAAGTACCCATCATCGCCCCAGCCTCTGTTCCACTGAT 5 0.125 No Hit GTACGGTTCACCAGTAAATCAAACCAGCAACCTCGTGCTGAGTTACACAT 5 0.125 No Hit GTCGGTGATCAGCTGCAGATCTTCCTTGTAGCGATGGTAGAAGTCGTTCG 5 0.125 No Hit GCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.7250000000000001 0.0 0.0 0.0 0.0 88-89 0.9 0.0 0.0 0.0 0.0 90-91 0.9874999999999999 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.6124999999999998 0.0 0.0 0.0 0.0 96-97 2.0125 0.0 0.0 0.0 0.0 98-99 2.1500000000000004 0.0 0.0 0.0 0.0 100-101 2.6625 0.0 0.0 0.0 0.0 102-103 3.0375 0.0 0.0 0.0 0.0 104-105 3.375 0.0 0.0 0.0 0.0 106-107 3.8375 0.0 0.0 0.0 0.0 108-109 4.275 0.0 0.0 0.0 0.0 110-111 4.8375 0.0 0.0 0.0 0.0 112-113 5.375 0.0 0.0 0.0 0.0 114-115 5.875 0.0 0.0 0.0 0.0 116-117 6.762499999999999 0.0 0.0 0.0 0.0 118-119 7.425000000000001 0.0 0.0 0.0 0.0 120-121 8.0375 0.0 0.0 0.0 0.0 122-123 8.9 0.0 0.0 0.0 0.0 124-125 9.675 0.0 0.0 0.0 0.0 126-127 10.35 0.0 0.0 0.0 0.0 128-129 11.075 0.0 0.0 0.0 0.0 130-131 12.274999999999999 0.0 0.0 0.0 0.0 132-133 13.0625 0.0 0.0 0.0 0.0 134-135 13.725 0.0 0.0 0.0 0.0 136-137 14.5 0.0 0.0 0.0 0.0 138-139 15.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGAGTA 10 0.006830828 145.0 4 AGTAGGC 10 0.006830828 145.0 7 GAGTAGG 10 0.006830828 145.0 6 ACCTCCA 10 0.006830828 145.0 7 GGAGTAG 10 0.006830828 145.0 5 TAGGCCC 10 0.006830828 145.0 9 >>END_MODULE SRR12951320 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951320_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2795 37.0 37.0 37.0 37.0 37.0 2 36.157 37.0 37.0 37.0 37.0 37.0 3 36.1105 37.0 37.0 37.0 37.0 37.0 4 36.2605 37.0 37.0 37.0 37.0 37.0 5 36.3075 37.0 37.0 37.0 37.0 37.0 6 36.2515 37.0 37.0 37.0 37.0 37.0 7 36.2645 37.0 37.0 37.0 37.0 37.0 8 36.3385 37.0 37.0 37.0 37.0 37.0 9 36.202 37.0 37.0 37.0 37.0 37.0 10-14 36.2699 37.0 37.0 37.0 37.0 37.0 15-19 36.2792 37.0 37.0 37.0 37.0 37.0 20-24 36.2633 37.0 37.0 37.0 37.0 37.0 25-29 36.220600000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1754 37.0 37.0 37.0 37.0 37.0 35-39 36.1616 37.0 37.0 37.0 37.0 37.0 40-44 36.1677 37.0 37.0 37.0 37.0 37.0 45-49 36.142900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0981 37.0 37.0 37.0 37.0 37.0 55-59 36.0729 37.0 37.0 37.0 37.0 37.0 60-64 36.05 37.0 37.0 37.0 37.0 37.0 65-69 36.053 37.0 37.0 37.0 37.0 37.0 70-74 35.9753 37.0 37.0 37.0 37.0 37.0 75-79 35.9871 37.0 37.0 37.0 37.0 37.0 80-84 35.977500000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.927800000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.925799999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.806599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8615 37.0 37.0 37.0 37.0 37.0 105-109 35.76539999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.719800000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.7685 37.0 37.0 37.0 37.0 37.0 120-124 35.6377 37.0 37.0 37.0 37.0 37.0 125-129 35.5588 37.0 37.0 37.0 37.0 37.0 130-134 35.3335 37.0 37.0 37.0 34.6 37.0 135-139 35.253299999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.085899999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.8771 37.0 37.0 37.0 25.0 37.0 150-151 34.445750000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 3.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 3.0 21 3.0 22 8.0 23 5.0 24 4.0 25 12.0 26 9.0 27 13.0 28 13.0 29 18.0 30 26.0 31 32.0 32 56.0 33 106.0 34 200.0 35 563.0 36 2610.0 37 308.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.574999999999996 20.925 7.025 27.474999999999998 2 28.575 23.575 26.474999999999998 21.375 3 22.2 25.4 29.225 23.175 4 26.275 30.4 21.3 22.025 5 26.950000000000003 33.625 18.625 20.8 6 23.95 34.9 20.5 20.65 7 23.775 20.75 33.125 22.35 8 24.5 23.849999999999998 22.650000000000002 28.999999999999996 9 23.925 23.75 27.3 25.025 10-14 26.900000000000002 24.445 23.43 25.224999999999998 15-19 26.325 24.865000000000002 23.54 25.27 20-24 26.415 24.81 23.98 24.795 25-29 26.345000000000002 24.365000000000002 23.825 25.465 30-34 25.935000000000002 24.605 24.43 25.03 35-39 26.56 24.555 23.674999999999997 25.21 40-44 26.355 24.88 23.915 24.85 45-49 26.215 24.635 24.515 24.635 50-54 27.08 24.605 23.97 24.345 55-59 26.6 24.45 24.11 24.84 60-64 26.955000000000002 24.18 24.11 24.755 65-69 26.91 25.045 23.205000000000002 24.84 70-74 26.619999999999997 24.345 23.915 25.119999999999997 75-79 26.735 24.11 24.59 24.565 80-84 26.715 24.635 23.66 24.990000000000002 85-89 27.145000000000003 23.445 24.279999999999998 25.130000000000003 90-94 26.529999999999998 24.759999999999998 23.64 25.069999999999997 95-99 26.340000000000003 24.98 24.215 24.465 100-104 27.395000000000003 24.52 24.08 24.005000000000003 105-109 27.495000000000005 24.455 23.855 24.195 110-114 27.425 24.104999999999997 24.895 23.575 115-119 27.939999999999998 24.595 24.165 23.3 120-124 28.215 24.884999999999998 23.96 22.939999999999998 125-129 28.665000000000003 25.0 23.72 22.615 130-134 29.609999999999996 24.325 23.294999999999998 22.770000000000003 135-139 30.0 24.335 23.77 21.895 140-144 30.34 24.285 23.205000000000002 22.17 145-149 30.925000000000004 24.51 23.095 21.47 150-151 31.6 24.65 22.162499999999998 21.587500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.0 28 1.5 29 3.0 30 6.5 31 6.0 32 7.5 33 20.5 34 24.0 35 27.0 36 40.5 37 63.0 38 90.0 39 92.5 40 93.5 41 119.0 42 160.0 43 166.0 44 149.5 45 172.0 46 190.0 47 172.5 48 159.5 49 160.5 50 152.5 51 132.0 52 127.0 53 129.5 54 112.0 55 109.0 56 106.0 57 80.0 58 71.0 59 80.5 60 76.5 61 76.5 62 85.0 63 74.0 64 63.0 65 58.5 66 54.5 67 58.5 68 54.0 69 49.5 70 49.5 71 46.0 72 37.5 73 30.0 74 29.5 75 27.5 76 19.5 77 15.5 78 15.5 79 9.0 80 8.0 81 8.0 82 4.5 83 2.5 84 1.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 2.0 95 2.0 96 1.5 97 1.5 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.85 #Duplication Level Percentage of deduplicated Percentage of total 1 81.74702567313713 65.275 2 13.462742642454604 21.5 3 3.3187226048841576 7.95 4 1.0331872260488417 3.3000000000000003 5 0.25046963055729493 1.0 6 0.12523481527864747 0.6 7 0.031308703819661866 0.17500000000000002 8 0.031308703819661866 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGATGGAAAGAGAATAAAACGTCGGCAGCCATTTACCGAATCTGATATGC 8 0.2 No Hit CCGTCGGCCAAGCAGCCACAAACCCGGAGCTCTCCGCCAACAAGCTCAAC 7 0.17500000000000002 No Hit ATAGAGGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTT 6 0.15 No Hit GAGTGTCGTTATGCCCCCTCTGCTACAGTCTGCTCAGCTTAAACCAGATG 6 0.15 No Hit GGTGTTTGCTTGAACAACATGAGCACCCTTGCCACACACAAATGTATTGT 6 0.15 No Hit GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 6 0.15 No Hit CGGTTTGATGCTTCGCATGCAGAGGAGCTCGATAACAGTCTTCCCAGTCA 5 0.125 No Hit AGGAACAGAAGCATTTCAGCGTTGATGCATACAGAGTACATTCTAATCCA 5 0.125 No Hit CTAAACAGTAGACAACGCACACTGAAGGTCAGAGAGATCAATGACCGATT 5 0.125 No Hit CAGCAAAACAAAGCAAATTAGTAACAAAAGAAACCTCCTCCACATCCATC 5 0.125 No Hit GCCATGGCGACCAAGCAGAGCCTGAGCCTCCTCGCCCTCCTCGCCGTCGC 5 0.125 No Hit AGGACAGGTTCATAAGCAAGATGTTTCTCCGTGGGGACTCCGTCATCATT 5 0.125 No Hit TGTTCGACTAAGTATTTCGTATCTTCACTATCAGTTTTTGGCCAGGAAAC 5 0.125 No Hit CGAGCGTCGGCGTCGGCGGCGAGGCTCCTGCGGCGGAGACGATGGCGTCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6499999999999999 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.0375 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.625 0.0 0.0 0.0 0.0 96-97 2.0125 0.0 0.0 0.0 0.0 98-99 2.1500000000000004 0.0 0.0 0.0 0.0 100-101 2.6625 0.0 0.0 0.0 0.0 102-103 3.05 0.0 0.0 0.0 0.0 104-105 3.4124999999999996 0.0 0.0 0.0 0.0 106-107 3.8875 0.0 0.0 0.0 0.0 108-109 4.325 0.0 0.0 0.0 0.0 110-111 4.9 0.0 0.0 0.0 0.0 112-113 5.4375 0.0 0.0 0.0 0.0 114-115 5.95 0.0 0.0 0.0 0.0 116-117 6.8375 0.0 0.0 0.0 0.0 118-119 7.512499999999999 0.0 0.0 0.0 0.0 120-121 8.1125 0.0 0.0 0.0 0.0 122-123 8.975 0.0 0.0 0.0 0.0 124-125 9.75 0.0 0.0 0.0 0.0 126-127 10.425 0.0 0.0 0.0 0.0 128-129 11.149999999999999 0.0 0.0 0.0 0.0 130-131 12.2625 0.0 0.0 0.0 0.0 132-133 13.0875 0.0 0.0 0.0 0.0 134-135 13.7375 0.0 0.0 0.0 0.0 136-137 14.5125 0.0 0.0 0.0 0.0 138-139 15.350000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGACTA 10 0.006830828 145.0 5 CTACCCG 10 0.006830828 145.0 9 CGCAAGG 10 0.006830828 145.0 1 GACTACC 10 0.006830828 145.0 7 >>END_MODULE Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722755 spots for SRR12951320.sra Written 1722755 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra Read 1722747 spots for SRR12951320.sra Written 1722747 spots for SRR12951320.sra SRR ids: ['SRR12951320.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dp4r72l2 SRR12951320.sra spots: 34454948 blocks: [[1, 1722747], [1722748, 3445494], [3445495, 5168241], [5168242, 6890988], [6890989, 8613735], [8613736, 10336482], [10336483, 12059229], [12059230, 13781976], [13781977, 15504723], [15504724, 17227470], [17227471, 18950217], [18950218, 20672964], [20672965, 22395711], [22395712, 24118458], [24118459, 25841205], [25841206, 27563952], [27563953, 29286699], [29286700, 31009446], [31009447, 32732193], [32732194, 34454948]] SRR12951320 file size 11687598 SRR12951320 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951320 SRR12951320_1.fastq SRR12951320_2.fastq Input file: SRR12951320_1.fastq Paired file: SRR12951320_2.fastq trimmed: SRR12951320-trimmed-pair1.fastq, SRR12951320-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:44:35 2024 >> started Sat Dec 7 11:45:14 2024 >> done (39.093s) 34454948 read pairs processed; of these: 278 ( 0.00%) short read pairs filtered out after trimming by size control 53525 ( 0.16%) empty read pairs filtered out after trimming by size control 34401145 (99.84%) read pairs available; of these: 6072759 (17.65%) trimmed read pairs available after processing 28328386 (82.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 35 0.00% 20 32 0.00% 21 41 0.00% 22 51 0.00% 23 56 0.00% 24 67 0.00% 25 88 0.00% 26 73 0.00% 27 76 0.00% 28 127 0.00% 29 76 0.00% 30 91 0.00% 31 113 0.00% 32 111 0.00% 33 104 0.00% 34 116 0.00% 35 110 0.00% 36 133 0.00% 37 135 0.00% 38 143 0.00% 39 144 0.00% 40 142 0.00% 41 178 0.00% 42 166 0.00% 43 168 0.00% 44 208 0.00% 45 199 0.00% 46 219 0.00% 47 253 0.00% 48 282 0.00% 49 296 0.00% 50 336 0.00% 51 427 0.00% 52 405 0.00% 53 462 0.00% 54 544 0.00% 55 567 0.00% 56 684 0.00% 57 689 0.00% 58 836 0.00% 59 973 0.00% 60 1077 0.00% 61 1374 0.00% 62 1462 0.00% 63 1712 0.00% 64 1781 0.01% 65 1897 0.01% 66 2099 0.01% 67 2293 0.01% 68 2701 0.01% 69 3264 0.01% 70 3600 0.01% 71 4191 0.01% 72 4999 0.01% 73 5486 0.02% 74 5948 0.02% 75 6615 0.02% 76 7214 0.02% 77 7871 0.02% 78 8786 0.03% 79 9860 0.03% 80 11354 0.03% 81 12764 0.04% 82 14422 0.04% 83 16111 0.05% 84 17464 0.05% 85 19632 0.06% 86 20586 0.06% 87 22030 0.06% 88 23168 0.07% 89 25032 0.07% 90 27177 0.08% 91 29645 0.09% 92 32426 0.09% 93 34974 0.10% 94 37939 0.11% 95 40411 0.12% 96 42207 0.12% 97 43977 0.13% 98 45291 0.13% 99 47152 0.14% 100 49396 0.14% 101 52028 0.15% 102 55566 0.16% 103 59599 0.17% 104 61960 0.18% 105 65474 0.19% 106 67301 0.20% 107 68379 0.20% 108 69230 0.20% 109 71655 0.21% 110 73456 0.21% 111 77007 0.22% 112 79699 0.23% 113 82347 0.24% 114 87638 0.25% 115 89871 0.26% 116 92201 0.27% 117 93848 0.27% 118 94809 0.28% 119 96116 0.28% 120 96837 0.28% 121 99411 0.29% 122 101801 0.30% 123 104789 0.30% 124 110551 0.32% 125 111964 0.33% 126 114082 0.33% 127 116126 0.34% 128 116550 0.34% 129 118083 0.34% 130 118231 0.34% 131 119832 0.35% 132 122638 0.36% 133 125421 0.36% 134 128788 0.37% 135 131820 0.38% 136 132724 0.39% 137 133423 0.39% 138 133636 0.39% 139 134871 0.39% 140 135718 0.39% 141 135613 0.39% 142 137479 0.40% 143 139038 0.40% 144 141273 0.41% 145 144874 0.42% 146 142653 0.41% 147 144671 0.42% 148 144156 0.42% 149 144966 0.42% 150 145191 0.42% 151 28328386 82.35% 34401145 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=33 prefix-density=0.37 prefix-fanout=2.8 sequence=GAACCGGAACCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=361.30 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=21.9 sequence=CCGCCGCCGCGTAGCTTCTGGTGGACGGGGCCAGCAGCTGGGCCAGCGCGCGGGCAGCAGCCGAGGAACCGGAGAGAGCGAGAGCCATCGATTGATCTGTGTGTTTTGATCGGATGGCTGGTGGCGCTCCGGCTCTCTGCTGCTGCT criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=37 prefix-density=1.05 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=190.97 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=22.5 sequence=CGCCGCCGCCGC SRR12951320 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:45:53 Started mapping on | Dec 07 11:45:53 Finished on | Dec 07 11:49:16 Mapping speed, Million of reads per hour | 610.07 Number of input reads | 34401145 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 32614020 Uniquely mapped reads % | 94.81% Average mapped length | 291.57 Number of splices: Total | 31321343 Number of splices: Annotated (sjdb) | 29105881 Number of splices: GT/AG | 30858076 Number of splices: GC/AG | 383923 Number of splices: AT/AC | 19408 Number of splices: Non-canonical | 59936 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382596 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 37599 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1404529 1404529 1404529 N_multimapping 382596 382596 382596 N_noFeature 1417190 31724945 1722896 N_ambiguous 686066 4223 103417 UnstrandedReadsAssigned:30510764 PositiveStrandReadsAssigned:884852 NegativeStrandReadsAssigned:30787707 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951320 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951320-trimmed-pair1.fastq SRR12951320-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,401,145 reads, 31,280,421 reads pseudoaligned [quant] estimated average fragment length: 240.782 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,289 rounds 52973 SRR12951320.ke.tsv 35125 SRR12951320.se.tsv 88098 total ==> SRR12951320.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 696.759 0 0 PNS24247 1044 804.218 162.887 9.35702 PNS24249 1928 1688.22 432.917 11.8468 PNS24246 1044 804.218 162.887 9.35702 PNS24248 1044 804.218 162.887 9.35702 PNS24244 1471 1231.22 234.423 8.7961 PNS24243 293 108.265 0 0 KQK14069 1603 1363.22 64090.6 2171.97 KQK14071 474 254.559 1173.51 212.973 ==> SRR12951320.se.tsv <== BRADI_1g14170v3 68537 BRADI_1g53295v3 306 BRADI_1g59795v3 1139 BRADI_1g07683v3 0 BRADI_1g00485v3 33 BRADI_1g20270v3 1203 BRADI_1g74790v3 3023 BRADI_1g09890v3 0 BRADI_1g77505v3 528 BRADI_1g48960v3 0 SRR12951320 completed mapping pipeline successfully