Starting /dee2/code/volunteer_pipeline.sh SRR12951321 current disk space = 1542971633664 free memory = 1602375116 SRR12951321 SRAfilesize 4154383c2bdf52803c590c45dedabf7e SRR12951321.sra SRR12951321.sra file validated SRR12951321 is paired end SRR12951321 is conventional basespace SRR12951321 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951321_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.52 37.0 37.0 37.0 37.0 37.0 2 36.24175 37.0 37.0 37.0 37.0 37.0 3 36.5615 37.0 37.0 37.0 37.0 37.0 4 36.6345 37.0 37.0 37.0 37.0 37.0 5 36.708 37.0 37.0 37.0 37.0 37.0 6 36.617 37.0 37.0 37.0 37.0 37.0 7 36.514 37.0 37.0 37.0 37.0 37.0 8 36.635 37.0 37.0 37.0 37.0 37.0 9 36.6135 37.0 37.0 37.0 37.0 37.0 10-14 36.6431 37.0 37.0 37.0 37.0 37.0 15-19 36.6467 37.0 37.0 37.0 37.0 37.0 20-24 36.5862 37.0 37.0 37.0 37.0 37.0 25-29 36.5863 37.0 37.0 37.0 37.0 37.0 30-34 36.532599999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.5312 37.0 37.0 37.0 37.0 37.0 40-44 36.487 37.0 37.0 37.0 37.0 37.0 45-49 36.449600000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.449400000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.37 37.0 37.0 37.0 37.0 37.0 60-64 36.38119999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3144 37.0 37.0 37.0 37.0 37.0 70-74 36.3415 37.0 37.0 37.0 37.0 37.0 75-79 36.378099999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.4017 37.0 37.0 37.0 37.0 37.0 85-89 36.384100000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.330499999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.3372 37.0 37.0 37.0 37.0 37.0 100-104 36.3519 37.0 37.0 37.0 37.0 37.0 105-109 36.3 37.0 37.0 37.0 37.0 37.0 110-114 36.28190000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.2755 37.0 37.0 37.0 37.0 37.0 120-124 36.1833 37.0 37.0 37.0 37.0 37.0 125-129 36.1337 37.0 37.0 37.0 37.0 37.0 130-134 36.122299999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.0991 37.0 37.0 37.0 37.0 37.0 140-144 35.9719 37.0 37.0 37.0 37.0 37.0 145-149 35.914 37.0 37.0 37.0 37.0 37.0 150-151 35.79325 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 4.0 25 3.0 26 1.0 27 5.0 28 6.0 29 9.0 30 13.0 31 28.0 32 45.0 33 62.0 34 120.0 35 319.0 36 2928.0 37 457.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.949999999999996 10.8 6.25 36.0 2 22.14124151796934 11.711485297813521 33.023372706710234 33.123900477506915 3 20.200000000000003 13.900000000000002 25.85 40.050000000000004 4 24.975 23.7 21.0 30.325000000000003 5 26.0 25.95 23.425 24.625 6 26.075 29.075 19.8 25.05 7 18.15 26.674999999999997 37.45 17.724999999999998 8 21.125 24.45 28.025 26.400000000000002 9 22.325 20.625 31.324999999999996 25.724999999999998 10-14 24.310000000000002 25.445 24.610000000000003 25.635 15-19 23.395 25.15 24.529999999999998 26.924999999999997 20-24 22.745 25.385 24.97 26.900000000000002 25-29 24.044999999999998 23.990000000000002 24.865000000000002 27.1 30-34 23.544999999999998 25.035 24.965 26.455000000000002 35-39 23.805 24.135 24.57 27.49 40-44 24.025 24.81 25.305 25.86 45-49 24.58 24.990000000000002 24.585 25.845000000000002 50-54 24.755 24.595 24.89 25.759999999999998 55-59 24.165 24.64 25.2 25.995 60-64 24.975 24.85 23.95 26.224999999999998 65-69 24.535 24.535 24.385 26.545 70-74 25.11 23.76 24.34 26.790000000000003 75-79 24.825 24.044999999999998 24.545 26.584999999999997 80-84 24.965 23.615 25.119999999999997 26.3 85-89 25.195 23.880000000000003 24.415 26.51 90-94 25.080000000000002 24.22 24.135 26.565 95-99 25.605 24.19 24.03 26.174999999999997 100-104 25.295 24.5 23.69 26.515 105-109 25.295 24.935 23.875 25.895000000000003 110-114 26.0 24.349999999999998 23.91 25.740000000000002 115-119 25.03 24.345 23.35 27.275 120-124 25.96 24.055 23.51 26.474999999999998 125-129 25.724999999999998 24.845 23.39 26.040000000000003 130-134 25.490000000000002 24.68 23.315 26.515 135-139 25.21 24.5 24.165 26.125 140-144 25.165 24.615000000000002 23.505000000000003 26.715 145-149 24.785 25.230000000000004 23.525 26.46 150-151 25.25 23.962500000000002 23.4125 27.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.0 29 6.5 30 8.5 31 5.0 32 10.0 33 15.0 34 20.5 35 29.5 36 34.0 37 55.5 38 83.0 39 91.0 40 106.0 41 130.5 42 154.0 43 161.5 44 153.0 45 169.0 46 200.0 47 185.5 48 165.0 49 171.5 50 156.5 51 138.0 52 144.0 53 142.5 54 120.5 55 100.5 56 102.0 57 89.5 58 74.5 59 76.5 60 70.0 61 65.5 62 62.5 63 61.5 64 55.5 65 63.5 66 68.5 67 61.5 68 61.5 69 57.5 70 48.5 71 45.5 72 42.5 73 33.5 74 24.0 75 20.0 76 19.0 77 12.5 78 8.5 79 5.5 80 4.5 81 3.0 82 1.5 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 77.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 79.3523565245271 61.875 2 15.549855722988138 24.25 3 3.655017633857006 8.55 4 1.0259698621352997 3.2 5 0.25649246553382493 1.0 6 0.09618467457518436 0.44999999999999996 7 0.032061558191728116 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.032061558191728116 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTACGCCTTATCTCGTAT 20 0.5 TruSeq Adapter, Index 7 (97% over 35bp) CCTTCAGGTACGAAATGAGATCAGCACGGTCCTGTGGCTTCTTCAGCCCA 7 0.17500000000000002 No Hit CTCTTCTTTTTCGCCGTTGTTCCATGCATGTGTTTTTCTGAATTCAGAGT 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTACGCCTTATCGCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) TTCCAGACTCCCGGTTGAATTCGAAAAAGGTCTCTAGGCCTCGTCGGCGT 6 0.15 No Hit TACACAGAAAATAGGCAGCACGAGGAATTCCAATAACGGCACACAGACTG 5 0.125 No Hit GCTTATTTATCCACTTAAGTAAACGTTCTGCTGTTCTTCCATCATCAATC 5 0.125 No Hit GGCTGGTTGGTGCCCCACTTGCTCACCTCGGCACGGTGTCAGTCGCTGGC 5 0.125 No Hit GCTTCCTCTTCTTGGAGTAACTTTTTGACGCGGATTCATTGGTCACTTTT 5 0.125 No Hit CAGTTTCTGACCATGGCCTTCTCCGTAAGAAAACTCTCCATCTTTAGCAA 5 0.125 No Hit GTGATGACCCCCTCGGTGTCGCCCTTGTCATCAACCACATAAATCCTGTG 5 0.125 No Hit GGGCACTACATACGGATAGCTAGCCTTATTTCTTCCCACTCTTCTTCAGA 5 0.125 No Hit GTTTCTCCTCGTTTCAGATCTACAGACATCTGATGCATAGTGTAGGTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 1.0125000000000002 0.0 0.0 0.0 0.0 92-93 1.225 0.0 0.0 0.0 0.0 94-95 1.5625 0.0 0.0 0.0 0.0 96-97 1.7875 0.0 0.0 0.0 0.0 98-99 2.0374999999999996 0.0 0.0 0.0 0.0 100-101 2.25 0.0 0.0 0.0 0.0 102-103 2.575 0.0 0.0 0.0 0.0 104-105 3.3375 0.0 0.025 0.0 0.0 106-107 3.8875 0.0 0.025 0.0 0.0 108-109 4.3 0.0 0.025 0.0 0.0 110-111 4.675 0.0 0.025 0.0 0.0 112-113 5.3125 0.0 0.025 0.0 0.0 114-115 5.975 0.0 0.025 0.0 0.0 116-117 6.75 0.0 0.025 0.0 0.0 118-119 7.4 0.0 0.025 0.0 0.0 120-121 8.0625 0.0 0.025 0.0 0.0 122-123 8.9125 0.0 0.025 0.0 0.0 124-125 9.7375 0.0 0.025 0.0 0.0 126-127 10.5625 0.0 0.025 0.0 0.0 128-129 11.4125 0.0 0.025 0.0 0.0 130-131 12.1 0.0 0.025 0.0 0.0 132-133 12.825 0.0 0.025 0.0 0.0 134-135 13.675 0.0 0.025 0.0 0.0 136-137 14.3625 0.0 0.025 0.0 0.0 138-139 15.0625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 20 0.00593511 29.0 100-104 >>END_MODULE SRR12951321 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951321_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2295 37.0 37.0 37.0 37.0 37.0 2 36.2585 37.0 37.0 37.0 37.0 37.0 3 36.1685 37.0 37.0 37.0 37.0 37.0 4 36.2365 37.0 37.0 37.0 37.0 37.0 5 36.2 37.0 37.0 37.0 37.0 37.0 6 36.175 37.0 37.0 37.0 37.0 37.0 7 36.211 37.0 37.0 37.0 37.0 37.0 8 36.237 37.0 37.0 37.0 37.0 37.0 9 36.178 37.0 37.0 37.0 37.0 37.0 10-14 36.1225 37.0 37.0 37.0 37.0 37.0 15-19 36.14450000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.0432 37.0 37.0 37.0 37.0 37.0 25-29 36.01990000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.9794 37.0 37.0 37.0 37.0 37.0 35-39 35.8754 37.0 37.0 37.0 37.0 37.0 40-44 35.9139 37.0 37.0 37.0 37.0 37.0 45-49 35.8794 37.0 37.0 37.0 37.0 37.0 50-54 35.831 37.0 37.0 37.0 37.0 37.0 55-59 35.8249 37.0 37.0 37.0 37.0 37.0 60-64 35.8104 37.0 37.0 37.0 37.0 37.0 65-69 35.7745 37.0 37.0 37.0 37.0 37.0 70-74 35.7632 37.0 37.0 37.0 37.0 37.0 75-79 35.712199999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.7776 37.0 37.0 37.0 37.0 37.0 85-89 35.735 37.0 37.0 37.0 37.0 37.0 90-94 35.833600000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.7429 37.0 37.0 37.0 37.0 37.0 100-104 35.72240000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.6524 37.0 37.0 37.0 37.0 37.0 110-114 35.707800000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.736000000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6351 37.0 37.0 37.0 37.0 37.0 125-129 35.588499999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.4645 37.0 37.0 37.0 34.6 37.0 135-139 35.4781 37.0 37.0 37.0 37.0 37.0 140-144 35.3007 37.0 37.0 37.0 34.6 37.0 145-149 35.148799999999994 37.0 37.0 37.0 32.2 37.0 150-151 34.64075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 11.0 15 5.0 16 2.0 17 2.0 18 2.0 19 8.0 20 5.0 21 5.0 22 7.0 23 17.0 24 15.0 25 15.0 26 15.0 27 10.0 28 10.0 29 17.0 30 18.0 31 29.0 32 42.0 33 90.0 34 149.0 35 489.0 36 2686.0 37 345.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.349999999999994 21.6 8.9 28.15 2 31.974999999999998 22.275 22.55 23.200000000000003 3 24.4 25.3 28.075 22.225 4 27.875 31.724999999999998 19.375 21.025 5 28.725 31.900000000000002 17.275 22.1 6 25.174999999999997 33.575 19.275000000000002 21.975 7 24.15 19.825 32.800000000000004 23.225 8 23.925 24.525 22.7 28.849999999999998 9 26.0 20.05 25.474999999999998 28.475 10-14 26.384999999999998 25.230000000000004 22.58 25.805 15-19 26.815 25.185000000000002 23.189999999999998 24.81 20-24 26.965 24.349999999999998 22.945 25.740000000000002 25-29 26.605 24.82 23.385 25.19 30-34 26.590000000000003 24.89 23.685000000000002 24.834999999999997 35-39 26.375 24.58 23.505000000000003 25.540000000000003 40-44 26.72 24.615000000000002 22.725 25.94 45-49 26.905 24.104999999999997 23.13 25.86 50-54 26.715 25.465 23.05 24.77 55-59 26.900000000000002 24.445 23.47 25.185000000000002 60-64 27.115000000000002 24.47 23.549999999999997 24.865000000000002 65-69 26.61 25.074999999999996 23.885 24.43 70-74 27.169999999999998 23.86 24.39 24.58 75-79 26.715 25.130000000000003 23.09 25.064999999999998 80-84 27.16 23.974999999999998 22.935 25.929999999999996 85-89 27.025 25.15 23.61 24.215 90-94 27.07 24.025 23.435 25.47 95-99 26.924999999999997 25.380000000000003 22.939999999999998 24.755 100-104 27.85 24.2 23.1 24.85 105-109 27.79 24.490000000000002 23.724999999999998 23.995 110-114 28.084999999999997 25.445 23.119999999999997 23.35 115-119 28.18 25.974999999999998 22.62 23.225 120-124 28.1 24.310000000000002 23.705000000000002 23.885 125-129 28.694999999999997 24.68 23.25 23.375 130-134 28.865000000000002 25.259999999999998 22.615 23.26 135-139 29.535 25.040000000000003 22.705000000000002 22.720000000000002 140-144 29.885 24.59 23.165 22.36 145-149 29.744999999999997 24.565 23.04 22.650000000000002 150-151 29.212500000000002 24.962500000000002 23.2625 22.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.5 8 1.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 1.5 15 2.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 2.0 27 2.0 28 1.5 29 3.0 30 5.0 31 6.5 32 12.0 33 16.0 34 18.0 35 26.5 36 52.5 37 77.0 38 72.0 39 74.0 40 103.0 41 119.0 42 126.5 43 149.5 44 168.5 45 161.5 46 143.5 47 153.0 48 168.0 49 156.5 50 138.5 51 139.5 52 140.0 53 114.5 54 104.0 55 111.5 56 101.5 57 89.5 58 77.0 59 76.5 60 88.0 61 84.5 62 77.5 63 69.0 64 70.5 65 74.5 66 75.0 67 80.5 68 74.0 69 60.5 70 51.0 71 45.0 72 40.0 73 35.5 74 29.5 75 23.5 76 21.5 77 19.5 78 10.5 79 4.5 80 2.5 81 0.5 82 0.5 83 0.5 84 1.5 85 2.0 86 1.5 87 0.5 88 0.0 89 1.0 90 1.0 91 1.5 92 2.5 93 3.0 94 5.0 95 3.5 96 0.5 97 1.0 98 4.0 99 3.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.0 #Duplication Level Percentage of deduplicated Percentage of total 1 80.12658227848102 63.3 2 15.031645569620252 23.75 3 3.5126582278481013 8.325000000000001 4 0.949367088607595 3.0 5 0.22151898734177217 0.8750000000000001 6 0.15822784810126583 0.75 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGATGGGTCAACAATCGAGGACAAGGAGACCGCTATTGTCTGGTGCTACG 6 0.15 No Hit GGAAGACCGAGAAGGAGGTGCAAGAGGCTGAGGCCGCCATCCTCGAGCCA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CCGAAGGCCGGCGAGAAGATCTTCAAGACCAAGTGCGCGCAGTGCCACAC 6 0.15 No Hit GTTCGGATAATGATGAATAACATGAGTAGACAGAGGTTAGTTAAGCTAGT 6 0.15 No Hit TGTTAGTTGATGGATCATTGCACAAAAAGTTGTTCCCTTCAACTACTTCC 5 0.125 No Hit ACAAACAATACAGGACGATCGCAGCAAAGGATTTCCTTACCGCAGTGCGC 5 0.125 No Hit GGTGATACTTATGCAAAAGCTTATGCAAAGCTTACAGCACTTCTTGAAAA 5 0.125 No Hit ATTACGAGAAGGTTGCGAAACTTTTTAATGGTCCGGATGCTGCACACCCT 5 0.125 No Hit GAGTTCCACAAGGAAACCTGCCGCAAGGTGAAAGCGCTCCATCAGTATGA 5 0.125 No Hit ACTCCTCCTGCTCCGTCTCCGGCCTCGGCGTGGTGTTCAAGGCGACCACG 5 0.125 No Hit CTTTAGGTGGGTCTGCACTGGTGGAGTACTACGATCATCAGTCAGGGTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 1.0125000000000002 0.0 0.0 0.0 0.0 92-93 1.225 0.0 0.0 0.0 0.0 94-95 1.5625 0.0 0.0 0.0 0.0 96-97 1.7875 0.0 0.0 0.0 0.0 98-99 2.05 0.0 0.0 0.0 0.0 100-101 2.25 0.0 0.0 0.0 0.0 102-103 2.55 0.0 0.0 0.0 0.0 104-105 3.325 0.0 0.0 0.0 0.0 106-107 3.8875 0.0 0.0 0.0 0.0 108-109 4.25 0.0 0.0 0.0 0.0 110-111 4.625 0.0 0.0 0.0 0.0 112-113 5.2625 0.0 0.0 0.0 0.0 114-115 5.925000000000001 0.0 0.0 0.0 0.0 116-117 6.699999999999999 0.0 0.0 0.0 0.0 118-119 7.325 0.0 0.0 0.0 0.0 120-121 7.9624999999999995 0.0 0.0 0.0 0.0 122-123 8.8125 0.0 0.0 0.0 0.0 124-125 9.6125 0.0 0.0 0.0 0.0 126-127 10.45 0.0 0.0 0.0 0.0 128-129 11.3125 0.0 0.0 0.0 0.0 130-131 12.05 0.0 0.0 0.0 0.0 132-133 12.8 0.0 0.0 0.0 0.0 134-135 13.65 0.0 0.0 0.0 0.0 136-137 14.3375 0.0 0.0 0.0 0.0 138-139 15.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1992005 spots for SRR12951321.sra Written 1992005 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra Read 1991994 spots for SRR12951321.sra Written 1991994 spots for SRR12951321.sra SRR ids: ['SRR12951321.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3a7gk74a SRR12951321.sra spots: 39839891 blocks: [[1, 1991994], [1991995, 3983988], [3983989, 5975982], [5975983, 7967976], [7967977, 9959970], [9959971, 11951964], [11951965, 13943958], [13943959, 15935952], [15935953, 17927946], [17927947, 19919940], [19919941, 21911934], [21911935, 23903928], [23903929, 25895922], [25895923, 27887916], [27887917, 29879910], [29879911, 31871904], [31871905, 33863898], [33863899, 35855892], [35855893, 37847886], [37847887, 39839891]] SRR12951321 file size 13517637 SRR12951321 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951321 SRR12951321_1.fastq SRR12951321_2.fastq Input file: SRR12951321_1.fastq Paired file: SRR12951321_2.fastq trimmed: SRR12951321-trimmed-pair1.fastq, SRR12951321-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:46:46 2024 >> started Sat Dec 7 11:47:30 2024 >> done (43.958s) 39839891 read pairs processed; of these: 266 ( 0.00%) short read pairs filtered out after trimming by size control 141871 ( 0.36%) empty read pairs filtered out after trimming by size control 39697754 (99.64%) read pairs available; of these: 7389800 (18.62%) trimmed read pairs available after processing 32307954 (81.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 25 0.00% 20 28 0.00% 21 32 0.00% 22 47 0.00% 23 52 0.00% 24 73 0.00% 25 53 0.00% 26 59 0.00% 27 80 0.00% 28 102 0.00% 29 91 0.00% 30 99 0.00% 31 88 0.00% 32 122 0.00% 33 121 0.00% 34 136 0.00% 35 124 0.00% 36 139 0.00% 37 144 0.00% 38 164 0.00% 39 184 0.00% 40 185 0.00% 41 195 0.00% 42 222 0.00% 43 219 0.00% 44 227 0.00% 45 297 0.00% 46 322 0.00% 47 355 0.00% 48 350 0.00% 49 490 0.00% 50 578 0.00% 51 617 0.00% 52 630 0.00% 53 665 0.00% 54 739 0.00% 55 847 0.00% 56 920 0.00% 57 1036 0.00% 58 1243 0.00% 59 1448 0.00% 60 1731 0.00% 61 2030 0.01% 62 2417 0.01% 63 2606 0.01% 64 2765 0.01% 65 2817 0.01% 66 3256 0.01% 67 3790 0.01% 68 4361 0.01% 69 4952 0.01% 70 5734 0.01% 71 6726 0.02% 72 7727 0.02% 73 8915 0.02% 74 9437 0.02% 75 10668 0.03% 76 11794 0.03% 77 12534 0.03% 78 13731 0.03% 79 15695 0.04% 80 17058 0.04% 81 19202 0.05% 82 21843 0.06% 83 23943 0.06% 84 26892 0.07% 85 28631 0.07% 86 30560 0.08% 87 32762 0.08% 88 34819 0.09% 89 36641 0.09% 90 39615 0.10% 91 43403 0.11% 92 46571 0.12% 93 50063 0.13% 94 53760 0.14% 95 56206 0.14% 96 59019 0.15% 97 61192 0.15% 98 63653 0.16% 99 65522 0.17% 100 68064 0.17% 101 71074 0.18% 102 74564 0.19% 103 79017 0.20% 104 82237 0.21% 105 86016 0.22% 106 88490 0.22% 107 90603 0.23% 108 91012 0.23% 109 94146 0.24% 110 96493 0.24% 111 99157 0.25% 112 102497 0.26% 113 105520 0.27% 114 109955 0.28% 115 111870 0.28% 116 113557 0.29% 117 117170 0.30% 118 117220 0.30% 119 118397 0.30% 120 120853 0.30% 121 122423 0.31% 122 124020 0.31% 123 127718 0.32% 124 132432 0.33% 125 132525 0.33% 126 134685 0.34% 127 137246 0.35% 128 137687 0.35% 129 139583 0.35% 130 140201 0.35% 131 138503 0.35% 132 143336 0.36% 133 145466 0.37% 134 147595 0.37% 135 149932 0.38% 136 152122 0.38% 137 151855 0.38% 138 152300 0.38% 139 152296 0.38% 140 153233 0.39% 141 153498 0.39% 142 154701 0.39% 143 154706 0.39% 144 157468 0.40% 145 159018 0.40% 146 159769 0.40% 147 159604 0.40% 148 160381 0.40% 149 159272 0.40% 150 159712 0.40% 151 32307954 81.38% 39697754 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=12.23 fanout-score-rank=17 prefix-density=0.09 prefix-fanout=12.2 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTACGCCTTATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=308.74 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=20.4 sequence=CCGCCGCCGCGTAGCTTCTGGTGGACGGGGCCAGCAGCTGGGCCAGCGCGCGGGCAGCAGCCGAGGAACCGGAGAGAGCGAGAGCCATCGATTGATCTGTGTGTTTTGATCGGATGGCTGGTGGCGCTCCGGCTCTCTGCTGCTGCTCCAACGTGGGTTGCTGGT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=35 prefix-density=0.62 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=233.17 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=23.0 sequence=CGCCGCCGCCGG SRR12951321 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:48:23 Started mapping on | Dec 07 11:48:23 Finished on | Dec 07 11:52:13 Mapping speed, Million of reads per hour | 621.36 Number of input reads | 39697754 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 37547006 Uniquely mapped reads % | 94.58% Average mapped length | 290.41 Number of splices: Total | 34280333 Number of splices: Annotated (sjdb) | 31927688 Number of splices: GT/AG | 33781591 Number of splices: GC/AG | 415199 Number of splices: AT/AC | 21199 Number of splices: Non-canonical | 62344 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424875 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 41921 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1725873 1725873 1725873 N_multimapping 424875 424875 424875 N_noFeature 1473302 36550545 1817384 N_ambiguous 769168 4813 117073 UnstrandedReadsAssigned:35304536 PositiveStrandReadsAssigned:991648 NegativeStrandReadsAssigned:35612549 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951321 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951321-trimmed-pair1.fastq SRR12951321-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,697,754 reads, 36,258,714 reads pseudoaligned [quant] estimated average fragment length: 243.054 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,187 rounds 52973 SRR12951321.ke.tsv 35125 SRR12951321.se.tsv 88098 total ==> SRR12951321.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.39 0 0 PNS24247 1044 801.946 194.488 9.77568 PNS24249 1928 1685.95 689.717 16.4902 PNS24246 1044 801.946 194.488 9.77568 PNS24248 1044 801.946 194.488 9.77568 PNS24244 1471 1228.95 174.819 5.73398 PNS24243 293 111.076 0 0 KQK14069 1603 1360.95 56881.7 1684.73 KQK14071 474 253.382 190.474 30.3012 ==> SRR12951321.se.tsv <== BRADI_1g14170v3 56922 BRADI_1g53295v3 452 BRADI_1g59795v3 728 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 1841 BRADI_1g74790v3 2515 BRADI_1g09890v3 0 BRADI_1g77505v3 390 BRADI_1g48960v3 0 SRR12951321 completed mapping pipeline successfully