Starting /dee2/code/volunteer_pipeline.sh SRR12951322 current disk space = 1543035371520 free memory = 1600298040 SRR12951322 SRAfilesize ddecc0e2954ff006acb49384ec7bd878 SRR12951322.sra SRR12951322.sra file validated SRR12951322 is paired end SRR12951322 is conventional basespace SRR12951322 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951322_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5095 37.0 37.0 37.0 37.0 37.0 2 36.2805 37.0 37.0 37.0 37.0 37.0 3 36.4745 37.0 37.0 37.0 37.0 37.0 4 36.5535 37.0 37.0 37.0 37.0 37.0 5 36.6435 37.0 37.0 37.0 37.0 37.0 6 36.644 37.0 37.0 37.0 37.0 37.0 7 36.5285 37.0 37.0 37.0 37.0 37.0 8 36.5165 37.0 37.0 37.0 37.0 37.0 9 36.62 37.0 37.0 37.0 37.0 37.0 10-14 36.541199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5095 37.0 37.0 37.0 37.0 37.0 20-24 36.5269 37.0 37.0 37.0 37.0 37.0 25-29 36.5077 37.0 37.0 37.0 37.0 37.0 30-34 36.4465 37.0 37.0 37.0 37.0 37.0 35-39 36.4172 37.0 37.0 37.0 37.0 37.0 40-44 36.3889 37.0 37.0 37.0 37.0 37.0 45-49 36.405899999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.361 37.0 37.0 37.0 37.0 37.0 55-59 36.35039999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.3069 37.0 37.0 37.0 37.0 37.0 65-69 36.3408 37.0 37.0 37.0 37.0 37.0 70-74 36.2727 37.0 37.0 37.0 37.0 37.0 75-79 36.2515 37.0 37.0 37.0 37.0 37.0 80-84 36.227599999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.1896 37.0 37.0 37.0 37.0 37.0 90-94 36.19520000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.186899999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.1634 37.0 37.0 37.0 37.0 37.0 105-109 36.1605 37.0 37.0 37.0 37.0 37.0 110-114 36.0523 37.0 37.0 37.0 37.0 37.0 115-119 36.123799999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.0334 37.0 37.0 37.0 37.0 37.0 125-129 35.964 37.0 37.0 37.0 37.0 37.0 130-134 35.9517 37.0 37.0 37.0 37.0 37.0 135-139 35.9017 37.0 37.0 37.0 37.0 37.0 140-144 35.786199999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.8098 37.0 37.0 37.0 37.0 37.0 150-151 35.56275 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 4.0 25 4.0 26 3.0 27 12.0 28 10.0 29 21.0 30 28.0 31 39.0 32 40.0 33 87.0 34 129.0 35 300.0 36 2824.0 37 495.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.6 11.075 4.6 32.725 2 22.277972905168088 9.934771700953336 33.74310085298545 34.044154540893125 3 20.95 14.575 25.900000000000002 38.574999999999996 4 26.875 20.4 23.375 29.349999999999998 5 25.974999999999998 28.000000000000004 22.325 23.7 6 25.5 31.474999999999998 19.15 23.875 7 20.05 25.900000000000002 35.699999999999996 18.35 8 20.65 24.875 28.725 25.75 9 20.674999999999997 21.425 32.9 25.0 10-14 23.61 26.695 24.495 25.2 15-19 24.125 24.865000000000002 24.654999999999998 26.355 20-24 23.16 24.8 25.755 26.284999999999997 25-29 24.025 25.040000000000003 23.985 26.950000000000003 30-34 23.79 24.84 25.535000000000004 25.835 35-39 23.895 24.595 24.925 26.584999999999997 40-44 23.98 24.55 25.430000000000003 26.040000000000003 45-49 23.74 25.480000000000004 24.015 26.765 50-54 24.15 24.91 24.895 26.045 55-59 24.625 25.695 24.055 25.624999999999996 60-64 24.245 24.69 24.279999999999998 26.784999999999997 65-69 23.68 25.085 24.355 26.88 70-74 23.715 25.135 25.124999999999996 26.025 75-79 24.355 24.805 24.375 26.465 80-84 23.815 24.585 24.26 27.339999999999996 85-89 24.21 24.435000000000002 24.57 26.784999999999997 90-94 24.805 24.9 24.57 25.724999999999998 95-99 24.32 24.654999999999998 25.0 26.025 100-104 25.05 25.035 24.315 25.6 105-109 25.195 24.03 24.865000000000002 25.91 110-114 24.775 24.695 24.095 26.435 115-119 24.525 24.13 24.18 27.165 120-124 24.735 24.415 24.895 25.955000000000002 125-129 24.635 24.65 24.38 26.334999999999997 130-134 24.495 25.505 23.955000000000002 26.045 135-139 25.365 25.115 23.015 26.505000000000003 140-144 24.805 25.05 23.385 26.76 145-149 24.4 25.509999999999998 23.78 26.31 150-151 24.3 25.2625 23.599999999999998 26.8375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 1.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 1.5 27 2.5 28 2.5 29 3.0 30 6.0 31 7.0 32 12.0 33 18.5 34 22.5 35 26.5 36 38.0 37 46.5 38 66.0 39 93.5 40 122.0 41 145.0 42 149.0 43 160.0 44 172.0 45 191.0 46 211.5 47 207.5 48 194.5 49 181.0 50 165.5 51 150.5 52 122.5 53 105.0 54 100.0 55 94.0 56 85.0 57 74.5 58 77.5 59 79.0 60 72.5 61 69.0 62 56.0 63 50.5 64 56.0 65 64.0 66 69.5 67 62.5 68 57.5 69 49.5 70 39.0 71 33.5 72 35.5 73 34.0 74 24.5 75 18.5 76 18.0 77 13.5 78 10.5 79 9.0 80 6.0 81 3.0 82 1.5 83 1.5 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.675 #Duplication Level Percentage of deduplicated Percentage of total 1 84.49357633701823 70.7 2 12.100388407529131 20.25 3 2.957872721840454 7.425 4 0.32865252464893935 1.0999999999999999 5 0.089632506722438 0.375 6 0.029877502240812665 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATAGGAATATGAACAGTCAGCTAAAACAGGCCGCAGTATCTGCTGCACTG 6 0.15 No Hit GCCTGCCGGTCCCGGCGCCTCCTTCTCTTGCATCTTCTCGGTCAACGTTA 5 0.125 No Hit ATTTGATGAGAGAGGTTGCTTCGGATGCATCCCTTCCAGCTCAGACCAAA 5 0.125 No Hit GTCCCGATTCCATAAGTAGCATCCAAAACTTTAAGCTTTTTCCTAAGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.2375 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.275 0.0 0.0 0.0 0.0 110-111 2.7 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 3.825 0.0 0.0 0.0 0.0 120-121 4.275 0.0 0.0 0.0 0.0 122-123 4.737500000000001 0.0 0.0 0.0 0.0 124-125 5.2625 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.300000000000001 0.0 0.0 0.0 0.0 130-131 6.925 0.0 0.0 0.0 0.0 132-133 7.475 0.0 0.0 0.0 0.0 134-135 7.7875 0.0 0.0 0.0 0.0 136-137 8.2625 0.0 0.0 0.0 0.0 138-139 9.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12951322 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951322_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1565 37.0 37.0 37.0 37.0 37.0 2 36.0665 37.0 37.0 37.0 37.0 37.0 3 36.126 37.0 37.0 37.0 37.0 37.0 4 36.124 37.0 37.0 37.0 37.0 37.0 5 36.18 37.0 37.0 37.0 37.0 37.0 6 36.127 37.0 37.0 37.0 37.0 37.0 7 36.2325 37.0 37.0 37.0 37.0 37.0 8 36.2605 37.0 37.0 37.0 37.0 37.0 9 36.2485 37.0 37.0 37.0 37.0 37.0 10-14 36.2668 37.0 37.0 37.0 37.0 37.0 15-19 36.2167 37.0 37.0 37.0 37.0 37.0 20-24 36.1345 37.0 37.0 37.0 37.0 37.0 25-29 36.1271 37.0 37.0 37.0 37.0 37.0 30-34 36.1434 37.0 37.0 37.0 37.0 37.0 35-39 36.068799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.0297 37.0 37.0 37.0 37.0 37.0 45-49 36.0625 37.0 37.0 37.0 37.0 37.0 50-54 35.9748 37.0 37.0 37.0 37.0 37.0 55-59 35.9664 37.0 37.0 37.0 37.0 37.0 60-64 35.9627 37.0 37.0 37.0 37.0 37.0 65-69 35.972699999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.9293 37.0 37.0 37.0 37.0 37.0 75-79 35.8842 37.0 37.0 37.0 37.0 37.0 80-84 35.8435 37.0 37.0 37.0 37.0 37.0 85-89 35.832 37.0 37.0 37.0 37.0 37.0 90-94 35.790000000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.8043 37.0 37.0 37.0 37.0 37.0 100-104 35.7358 37.0 37.0 37.0 37.0 37.0 105-109 35.758300000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.723400000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.769600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6477 37.0 37.0 37.0 37.0 37.0 125-129 35.6041 37.0 37.0 37.0 37.0 37.0 130-134 35.464999999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.55030000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.426 37.0 37.0 37.0 37.0 37.0 145-149 35.27610000000001 37.0 37.0 37.0 34.6 37.0 150-151 34.944 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 5.0 21 10.0 22 4.0 23 5.0 24 7.0 25 6.0 26 12.0 27 11.0 28 9.0 29 21.0 30 30.0 31 37.0 32 58.0 33 108.0 34 197.0 35 540.0 36 2634.0 37 296.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.25 21.65 6.550000000000001 26.55 2 28.1 23.200000000000003 24.95 23.75 3 23.35 25.05 27.0 24.6 4 27.425 30.925000000000004 20.349999999999998 21.3 5 27.975 31.85 18.075 22.1 6 23.849999999999998 34.575 19.05 22.525000000000002 7 22.95 19.775000000000002 33.324999999999996 23.95 8 23.0 23.0 24.3 29.7 9 24.349999999999998 21.175 26.75 27.725 10-14 25.790000000000003 25.27 23.075000000000003 25.865 15-19 25.424999999999997 24.94 23.674999999999997 25.96 20-24 25.264999999999997 25.455 23.72 25.56 25-29 26.240000000000002 24.975 23.3 25.485000000000003 30-34 25.650000000000002 25.385 23.61 25.355 35-39 26.229999999999997 24.755 23.0 26.015 40-44 27.034999999999997 24.9 23.385 24.68 45-49 26.27 24.27 23.7 25.759999999999998 50-54 26.419999999999998 24.775 23.810000000000002 24.995 55-59 26.939999999999998 24.505 23.075000000000003 25.480000000000004 60-64 27.355 24.285 23.56 24.8 65-69 26.55 24.985 23.845 24.62 70-74 27.24 24.515 23.14 25.105 75-79 26.02 24.779999999999998 24.505 24.695 80-84 26.705000000000002 25.064999999999998 23.68 24.55 85-89 27.675 24.015 23.62 24.69 90-94 26.1 24.565 24.240000000000002 25.095 95-99 26.735 24.63 23.799999999999997 24.834999999999997 100-104 27.425 24.955 23.645 23.974999999999998 105-109 26.724999999999998 24.495 23.9 24.88 110-114 27.355 25.005 23.515 24.125 115-119 27.389999999999997 24.805 23.294999999999998 24.51 120-124 27.339999999999996 25.0 23.580000000000002 24.08 125-129 26.834999999999997 25.174999999999997 23.415 24.575 130-134 28.035 24.965 23.585 23.415 135-139 27.755000000000003 25.130000000000003 22.845 24.27 140-144 27.73 25.330000000000002 23.055 23.885 145-149 28.925 25.21 22.915 22.95 150-151 29.4 24.7875 22.5875 23.225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.5 17 3.0 18 0.5 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 2.0 28 2.0 29 1.5 30 2.5 31 4.5 32 12.0 33 18.5 34 27.0 35 28.0 36 37.0 37 55.0 38 70.0 39 85.0 40 102.5 41 130.0 42 140.0 43 150.5 44 169.0 45 182.5 46 190.5 47 183.0 48 164.0 49 154.5 50 140.0 51 133.5 52 142.0 53 119.0 54 99.0 55 92.0 56 81.0 57 79.5 58 85.5 59 81.5 60 73.0 61 66.0 62 68.5 63 80.5 64 75.5 65 71.5 66 66.0 67 66.5 68 69.0 69 64.5 70 66.5 71 59.5 72 40.5 73 33.5 74 30.5 75 19.5 76 18.0 77 16.0 78 9.0 79 6.0 80 6.5 81 4.5 82 2.0 83 1.5 84 1.0 85 1.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.7 #Duplication Level Percentage of deduplicated Percentage of total 1 84.76702508960572 70.95 2 11.738351254480287 19.650000000000002 3 2.956989247311828 7.425 4 0.32855436081242534 1.0999999999999999 5 0.2090800477897252 0.8750000000000001 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAACTTCTCGCCTCAAGCAAGAAGAGTATTTTGGGGGAGCAAAGTTTA 5 0.125 No Hit GGTGGGTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGT 5 0.125 No Hit GGCATCATTGTAGTCTATGATGTGACTGACCAGGAGAGCTTCAACAACGT 5 0.125 No Hit TTCGACCGCCTCAAGGCCTCCTTCGACGCCCTCCGCGCCGACCACGACGC 5 0.125 No Hit GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GAAGCTCCTTTCCGCCCACTTTCTGAACTCATGCCGTACCTTGGACATAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.2625 0.0 0.0 0.0 0.0 102-103 1.5499999999999998 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.725 0.0 0.0 0.0 0.0 112-113 2.9000000000000004 0.0 0.0 0.0 0.0 114-115 3.075 0.0 0.0 0.0 0.0 116-117 3.5250000000000004 0.0 0.0 0.0 0.0 118-119 3.8499999999999996 0.0 0.0 0.0 0.0 120-121 4.262499999999999 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 5.2625 0.0 0.0 0.0 0.0 126-127 5.725 0.0 0.0 0.0 0.0 128-129 6.35 0.0 0.0 0.0 0.0 130-131 7.012499999999999 0.0 0.0 0.0 0.0 132-133 7.574999999999999 0.0 0.0 0.0 0.0 134-135 7.9125 0.0 0.0 0.0 0.0 136-137 8.3875 0.0 0.0 0.0 0.0 138-139 9.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTGTT 10 0.006830828 145.0 1 GGAGACG 10 0.006830828 145.0 6 GGTTGGC 10 0.006830828 145.0 6 TGAGTTC 10 0.006830828 145.0 6 >>END_MODULE Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542037 spots for SRR12951322.sra Written 1542037 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra Read 1542020 spots for SRR12951322.sra Written 1542020 spots for SRR12951322.sra SRR ids: ['SRR12951322.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_av9nx9ve SRR12951322.sra spots: 30840417 blocks: [[1, 1542020], [1542021, 3084040], [3084041, 4626060], [4626061, 6168080], [6168081, 7710100], [7710101, 9252120], [9252121, 10794140], [10794141, 12336160], [12336161, 13878180], [13878181, 15420200], [15420201, 16962220], [16962221, 18504240], [18504241, 20046260], [20046261, 21588280], [21588281, 23130300], [23130301, 24672320], [24672321, 26214340], [26214341, 27756360], [27756361, 29298380], [29298381, 30840417]] SRR12951322 file size 10459222 SRR12951322 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951322 SRR12951322_1.fastq SRR12951322_2.fastq Input file: SRR12951322_1.fastq Paired file: SRR12951322_2.fastq trimmed: SRR12951322-trimmed-pair1.fastq, SRR12951322-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:53:57 2024 >> started Sat Dec 7 11:54:35 2024 >> done (38.717s) 30840417 read pairs processed; of these: 286 ( 0.00%) short read pairs filtered out after trimming by size control 38888 ( 0.13%) empty read pairs filtered out after trimming by size control 30801243 (99.87%) read pairs available; of these: 4034665 (13.10%) trimmed read pairs available after processing 26766578 (86.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 20 0.00% 20 24 0.00% 21 41 0.00% 22 54 0.00% 23 48 0.00% 24 48 0.00% 25 62 0.00% 26 70 0.00% 27 82 0.00% 28 93 0.00% 29 83 0.00% 30 86 0.00% 31 75 0.00% 32 113 0.00% 33 84 0.00% 34 97 0.00% 35 84 0.00% 36 88 0.00% 37 99 0.00% 38 90 0.00% 39 111 0.00% 40 128 0.00% 41 103 0.00% 42 125 0.00% 43 117 0.00% 44 128 0.00% 45 112 0.00% 46 129 0.00% 47 180 0.00% 48 190 0.00% 49 217 0.00% 50 211 0.00% 51 220 0.00% 52 280 0.00% 53 275 0.00% 54 308 0.00% 55 355 0.00% 56 403 0.00% 57 428 0.00% 58 459 0.00% 59 568 0.00% 60 639 0.00% 61 710 0.00% 62 819 0.00% 63 891 0.00% 64 983 0.00% 65 1009 0.00% 66 1174 0.00% 67 1475 0.00% 68 1572 0.01% 69 1888 0.01% 70 2080 0.01% 71 2444 0.01% 72 2762 0.01% 73 3303 0.01% 74 3446 0.01% 75 3776 0.01% 76 4364 0.01% 77 4876 0.02% 78 5350 0.02% 79 5838 0.02% 80 6770 0.02% 81 7436 0.02% 82 8714 0.03% 83 9585 0.03% 84 10370 0.03% 85 11691 0.04% 86 12478 0.04% 87 13563 0.04% 88 14416 0.05% 89 15434 0.05% 90 17156 0.06% 91 18207 0.06% 92 19648 0.06% 93 21602 0.07% 94 23439 0.08% 95 24621 0.08% 96 26170 0.08% 97 27823 0.09% 98 28748 0.09% 99 29793 0.10% 100 31609 0.10% 101 32622 0.11% 102 34779 0.11% 103 37224 0.12% 104 39035 0.13% 105 40695 0.13% 106 42278 0.14% 107 43713 0.14% 108 44994 0.15% 109 46671 0.15% 110 47989 0.16% 111 49960 0.16% 112 52015 0.17% 113 53454 0.17% 114 56014 0.18% 115 58332 0.19% 116 59839 0.19% 117 61938 0.20% 118 62733 0.20% 119 63885 0.21% 120 65234 0.21% 121 66214 0.21% 122 67780 0.22% 123 69480 0.23% 124 72724 0.24% 125 73723 0.24% 126 75891 0.25% 127 76767 0.25% 128 78413 0.25% 129 79828 0.26% 130 79654 0.26% 131 80915 0.26% 132 82533 0.27% 133 84172 0.27% 134 86498 0.28% 135 88352 0.29% 136 89435 0.29% 137 90520 0.29% 138 91450 0.30% 139 92171 0.30% 140 92443 0.30% 141 94352 0.31% 142 95823 0.31% 143 95747 0.31% 144 98260 0.32% 145 98725 0.32% 146 98620 0.32% 147 100482 0.33% 148 101422 0.33% 149 101759 0.33% 150 101927 0.33% 151 26766578 86.90% 30801243 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.25 fanout-score-rank=19 prefix-density=0.35 prefix-fanout=4.0 sequence=TGCAGTTGTCGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=136.31 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=22.9 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=30 prefix-density=0.88 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=10 fanout-score=175.34 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=21.5 sequence=CGCCGCCGCCGC SRR12951322 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:55:17 Started mapping on | Dec 07 11:55:17 Finished on | Dec 07 12:00:13 Mapping speed, Million of reads per hour | 374.61 Number of input reads | 30801243 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 28465246 Uniquely mapped reads % | 92.42% Average mapped length | 294.26 Number of splices: Total | 28450056 Number of splices: Annotated (sjdb) | 26463570 Number of splices: GT/AG | 28033980 Number of splices: GC/AG | 347609 Number of splices: AT/AC | 18666 Number of splices: Non-canonical | 49801 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323992 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 47039 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.61% % of reads unmapped: other | 1.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2012005 2012005 2012005 N_multimapping 323992 323992 323992 N_noFeature 1031463 27728063 1260675 N_ambiguous 598105 4054 90547 UnstrandedReadsAssigned:26835678 PositiveStrandReadsAssigned:733129 NegativeStrandReadsAssigned:27114024 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951322 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951322-trimmed-pair1.fastq SRR12951322-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,801,243 reads, 27,533,212 reads pseudoaligned [quant] estimated average fragment length: 266.588 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,423 rounds 52973 SRR12951322.ke.tsv 35125 SRR12951322.se.tsv 88098 total ==> SRR12951322.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.198 0 0 PNS24247 1044 778.412 114.063 7.54345 PNS24249 1928 1662.41 344.607 10.6714 PNS24246 1044 778.412 114.063 7.54345 PNS24248 1044 778.412 114.063 7.54345 PNS24244 1471 1205.41 128.204 5.47523 PNS24243 293 101.767 0 0 KQK14069 1603 1337.41 60457.7 2327.13 KQK14071 474 237.261 614.228 133.272 ==> SRR12951322.se.tsv <== BRADI_1g14170v3 63274 BRADI_1g53295v3 293 BRADI_1g59795v3 822 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 933 BRADI_1g74790v3 2755 BRADI_1g09890v3 1 BRADI_1g77505v3 410 BRADI_1g48960v3 0 SRR12951322 completed mapping pipeline successfully