Starting /dee2/code/volunteer_pipeline.sh SRR12951323 current disk space = 1543035371520 free memory = 1598570120 SRR12951323 SRAfilesize 32f30f58c438482d2b120404d43fe0b2 SRR12951323.sra SRR12951323.sra file validated SRR12951323 is paired end SRR12951323 is conventional basespace SRR12951323 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951323_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.523 37.0 37.0 37.0 37.0 37.0 2 36.24425 37.0 37.0 37.0 37.0 37.0 3 36.4905 37.0 37.0 37.0 37.0 37.0 4 36.604 37.0 37.0 37.0 37.0 37.0 5 36.553 37.0 37.0 37.0 37.0 37.0 6 36.6265 37.0 37.0 37.0 37.0 37.0 7 36.6135 37.0 37.0 37.0 37.0 37.0 8 36.671 37.0 37.0 37.0 37.0 37.0 9 36.571 37.0 37.0 37.0 37.0 37.0 10-14 36.596199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.58390000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5375 37.0 37.0 37.0 37.0 37.0 25-29 36.4887 37.0 37.0 37.0 37.0 37.0 30-34 36.4893 37.0 37.0 37.0 37.0 37.0 35-39 36.480000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4303 37.0 37.0 37.0 37.0 37.0 45-49 36.2036 37.0 37.0 37.0 37.0 37.0 50-54 36.2105 37.0 37.0 37.0 37.0 37.0 55-59 36.001 37.0 37.0 37.0 37.0 37.0 60-64 36.0595 37.0 37.0 37.0 37.0 37.0 65-69 36.053000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.0376 37.0 37.0 37.0 37.0 37.0 75-79 36.2959 37.0 37.0 37.0 37.0 37.0 80-84 36.237100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2629 37.0 37.0 37.0 37.0 37.0 90-94 36.2947 37.0 37.0 37.0 37.0 37.0 95-99 36.1881 37.0 37.0 37.0 37.0 37.0 100-104 36.255399999999995 37.0 37.0 37.0 37.0 37.0 105-109 36.207800000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.1349 37.0 37.0 37.0 37.0 37.0 115-119 36.1623 37.0 37.0 37.0 37.0 37.0 120-124 36.1065 37.0 37.0 37.0 37.0 37.0 125-129 36.078500000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.9605 37.0 37.0 37.0 37.0 37.0 135-139 35.9328 37.0 37.0 37.0 37.0 37.0 140-144 35.8291 37.0 37.0 37.0 37.0 37.0 145-149 35.695299999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.50775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 2.0 24 1.0 25 2.0 26 4.0 27 8.0 28 11.0 29 10.0 30 31.0 31 40.0 32 70.0 33 115.0 34 126.0 35 300.0 36 2814.0 37 464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.525 10.8 5.525 32.15 2 22.119005774541804 11.498870198342956 33.59276926939493 32.78935475772031 3 21.075 15.85 26.424999999999997 36.65 4 24.7 21.5 21.025 32.775 5 24.675 28.95 22.85 23.525 6 26.400000000000002 28.9 21.325 23.375 7 18.35 25.324999999999996 35.525 20.8 8 19.900000000000002 25.624999999999996 27.875 26.6 9 22.8 21.3 30.8 25.1 10-14 24.025 26.529999999999998 24.605 24.84 15-19 23.82 24.64 25.169999999999998 26.369999999999997 20-24 23.225 25.679999999999996 25.395 25.7 25-29 23.305 25.55 25.019999999999996 26.125 30-34 23.315 24.335 25.290000000000003 27.060000000000002 35-39 23.494999999999997 24.315 25.6 26.590000000000003 40-44 23.395 24.86 25.085 26.66 45-49 23.849999999999998 25.145 25.2 25.805 50-54 24.095 23.880000000000003 25.355 26.669999999999998 55-59 23.955000000000002 24.395 25.695 25.955000000000002 60-64 24.154999999999998 24.485 25.235000000000003 26.125 65-69 23.549999999999997 25.509999999999998 24.235 26.705000000000002 70-74 24.995 24.295 25.025 25.685000000000002 75-79 24.85 24.665 24.709999999999997 25.775 80-84 25.305 24.959999999999997 24.060000000000002 25.674999999999997 85-89 24.855 23.880000000000003 24.875 26.39 90-94 25.435000000000002 24.6 23.95 26.015 95-99 25.330000000000002 24.385 24.39 25.895000000000003 100-104 25.5 24.845 24.224999999999998 25.430000000000003 105-109 25.590000000000003 24.610000000000003 24.04 25.759999999999998 110-114 25.635 24.97 23.805 25.590000000000003 115-119 25.915 24.555 24.099999999999998 25.430000000000003 120-124 25.71 24.490000000000002 23.735 26.064999999999998 125-129 25.355 24.73 23.68 26.235000000000003 130-134 25.195 24.48 23.47 26.855 135-139 25.919999999999998 24.02 24.325 25.735000000000003 140-144 25.365 23.855 24.205 26.575 145-149 25.009999999999998 24.58 23.57 26.840000000000003 150-151 26.325 23.962500000000002 23.35 26.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 1.0 28 1.5 29 1.5 30 5.0 31 7.0 32 7.5 33 24.5 34 33.5 35 27.5 36 46.0 37 64.5 38 65.5 39 72.5 40 97.0 41 136.0 42 157.0 43 159.5 44 191.5 45 209.0 46 187.5 47 193.5 48 193.5 49 168.0 50 166.0 51 154.0 52 129.5 53 126.0 54 117.0 55 104.5 56 101.5 57 89.0 58 78.5 59 72.0 60 66.0 61 70.5 62 61.5 63 48.0 64 51.0 65 59.5 66 58.5 67 57.5 68 56.0 69 40.0 70 36.0 71 38.5 72 34.0 73 30.5 74 27.0 75 22.0 76 15.0 77 11.5 78 10.0 79 8.5 80 4.0 81 1.0 82 1.5 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.925 #Duplication Level Percentage of deduplicated Percentage of total 1 82.70003089280198 66.925 2 13.531047265987025 21.9 3 2.842137781896818 6.9 4 0.5560704355885079 1.7999999999999998 5 0.1235712079085573 0.5 6 0.06178560395427865 0.3 7 0.06178560395427865 0.35000000000000003 8 0.06178560395427865 0.4 9 0.030892801977139325 0.22499999999999998 >10 0.030892801977139325 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCTCGTAT 28 0.7000000000000001 TruSeq Adapter, Index 3 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCTCGTTT 9 0.22499999999999998 TruSeq Adapter, Index 3 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCGCGTAT 8 0.2 TruSeq Adapter, Index 3 (97% over 37bp) CTGGACCTGGAGATGAGGCCTGAGATGACGACGAGCTGCATCAACCAAGT 8 0.2 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCTCGGAT 7 0.17500000000000002 TruSeq Adapter, Index 3 (97% over 37bp) GTTTATTCTTATTACAACCACATCCACATTCCACATTCATAACTGCAAAC 7 0.17500000000000002 No Hit ACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGC 6 0.15 No Hit GCAGGCATTGTCGTATTATTATCTTGACCCGTGGCATCTGTACTTGCGTG 6 0.15 No Hit GCCTAACATTGAAACTCAGGTATTCTGTATTAGATAAAGCCGAAAACCTG 5 0.125 No Hit CTGGAGTTTTTAGACATCGAGGTACTTGCTGGCTGTGTGGACATCCTTGT 5 0.125 No Hit GCTTCATCAGAACCCGAGCTCCCGCAATCCGACTTCTGCTCATGGAGCCG 5 0.125 No Hit GGGGAACAATGACAGCGAGAACGGATCCATTCTTCAATTACGTGCTGAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 90-91 1.1 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.4 0.0 0.0 0.0 0.0 96-97 1.5875 0.0 0.0 0.0 0.0 98-99 1.8875 0.0 0.0 0.0 0.0 100-101 2.1375 0.0 0.0 0.0 0.0 102-103 2.55 0.0 0.0 0.0 0.0 104-105 3.075 0.0 0.0 0.0 0.0 106-107 3.5625 0.0 0.0 0.0 0.0 108-109 3.9375 0.0 0.0 0.0 0.0 110-111 4.3125 0.0 0.0 0.0 0.0 112-113 4.65 0.0 0.0 0.0 0.0 114-115 4.975 0.0 0.0 0.0 0.0 116-117 5.449999999999999 0.0 0.0 0.0 0.0 118-119 6.2125 0.0 0.0 0.0 0.0 120-121 6.725 0.0 0.0 0.0 0.0 122-123 7.362500000000001 0.0 0.0 0.0 0.0 124-125 8.0 0.0 0.0 0.0 0.0 126-127 8.575 0.0 0.0 0.0 0.0 128-129 9.175 0.0 0.0 0.0 0.0 130-131 9.7875 0.0 0.0 0.0 0.0 132-133 10.5875 0.0 0.0 0.0 0.0 134-135 11.25 0.0 0.0 0.0 0.0 136-137 11.7875 0.0 0.0 0.0 0.0 138-139 12.399999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACCGA 10 0.006830828 145.0 4 ATCTTGG 35 0.0033124194 62.14286 8 GATCTTG 35 0.0033124194 62.14286 7 >>END_MODULE SRR12951323 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951323_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.246 37.0 37.0 37.0 37.0 37.0 2 36.1125 37.0 37.0 37.0 37.0 37.0 3 36.0855 37.0 37.0 37.0 37.0 37.0 4 36.173 37.0 37.0 37.0 37.0 37.0 5 36.2095 37.0 37.0 37.0 37.0 37.0 6 36.1245 37.0 37.0 37.0 37.0 37.0 7 36.1455 37.0 37.0 37.0 37.0 37.0 8 36.091 37.0 37.0 37.0 37.0 37.0 9 36.0875 37.0 37.0 37.0 37.0 37.0 10-14 35.9385 37.0 37.0 37.0 37.0 37.0 15-19 35.895599999999995 37.0 37.0 37.0 37.0 37.0 20-24 35.82469999999999 37.0 37.0 37.0 37.0 37.0 25-29 35.68769999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.69330000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.5707 37.0 37.0 37.0 37.0 37.0 40-44 35.5526 37.0 37.0 37.0 37.0 37.0 45-49 35.5426 37.0 37.0 37.0 37.0 37.0 50-54 35.5222 37.0 37.0 37.0 37.0 37.0 55-59 35.4993 37.0 37.0 37.0 37.0 37.0 60-64 35.5476 37.0 37.0 37.0 37.0 37.0 65-69 35.5577 37.0 37.0 37.0 37.0 37.0 70-74 35.4438 37.0 37.0 37.0 37.0 37.0 75-79 35.412800000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.4279 37.0 37.0 37.0 37.0 37.0 85-89 35.50449999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.6257 37.0 37.0 37.0 37.0 37.0 95-99 35.597500000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.633799999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.5988 37.0 37.0 37.0 37.0 37.0 110-114 35.519999999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.526599999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.522200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.4858 37.0 37.0 37.0 37.0 37.0 130-134 35.4066 37.0 37.0 37.0 37.0 37.0 135-139 35.3085 37.0 37.0 37.0 37.0 37.0 140-144 35.2197 37.0 37.0 37.0 34.6 37.0 145-149 34.975 37.0 37.0 37.0 25.0 37.0 150-151 34.66 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 11.0 14 8.0 15 8.0 16 7.0 17 3.0 18 4.0 19 2.0 20 3.0 21 9.0 22 14.0 23 9.0 24 14.0 25 21.0 26 24.0 27 14.0 28 17.0 29 19.0 30 19.0 31 39.0 32 63.0 33 98.0 34 173.0 35 517.0 36 2608.0 37 293.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.05 21.0 7.025 24.925 2 30.225 23.125 24.375 22.275 3 26.674999999999997 23.5 27.825 22.0 4 29.099999999999998 28.65 19.15 23.1 5 28.999999999999996 31.624999999999996 18.75 20.625 6 25.924999999999997 32.45 19.650000000000002 21.975 7 26.85 18.8 31.025000000000002 23.325000000000003 8 25.8 22.625 22.175 29.4 9 26.700000000000003 22.325 25.474999999999998 25.5 10-14 28.075 24.8 22.035 25.09 15-19 27.62 24.605 23.044999999999998 24.73 20-24 27.29 24.575 23.175 24.959999999999997 25-29 27.76 24.349999999999998 23.41 24.48 30-34 27.755000000000003 24.375 23.72 24.15 35-39 27.650000000000002 23.74 23.925 24.685000000000002 40-44 27.365000000000002 24.959999999999997 23.235 24.44 45-49 26.950000000000003 24.46 23.669999999999998 24.92 50-54 27.075 25.835 23.5 23.59 55-59 27.48 24.735 23.990000000000002 23.794999999999998 60-64 28.01 23.86 23.935000000000002 24.195 65-69 27.700000000000003 24.605 23.835 23.86 70-74 27.12 24.740000000000002 23.965 24.175 75-79 27.834999999999997 25.15 23.695 23.32 80-84 27.72 24.595 23.71 23.974999999999998 85-89 27.685 24.89 23.48 23.945 90-94 27.985 25.025 22.81 24.18 95-99 27.855 25.705 23.01 23.43 100-104 28.33 25.040000000000003 22.95 23.68 105-109 28.785 24.69 23.200000000000003 23.325000000000003 110-114 28.18 25.174999999999997 23.325000000000003 23.32 115-119 28.89 24.46 23.57 23.080000000000002 120-124 28.71 24.95 23.45 22.89 125-129 29.955 24.9 22.770000000000003 22.375 130-134 29.659999999999997 25.874999999999996 22.18 22.285 135-139 29.294999999999998 25.005 23.48 22.220000000000002 140-144 30.259999999999998 24.474999999999998 22.835 22.43 145-149 29.715000000000003 25.39 22.720000000000002 22.175 150-151 30.9875 24.224999999999998 22.3625 22.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.0 24 2.5 25 1.5 26 2.5 27 3.0 28 1.0 29 4.0 30 5.0 31 6.0 32 10.5 33 11.5 34 18.5 35 30.0 36 46.5 37 57.5 38 61.5 39 92.5 40 114.0 41 122.0 42 135.0 43 157.0 44 173.5 45 167.5 46 165.0 47 172.5 48 189.0 49 167.0 50 133.5 51 135.5 52 128.5 53 115.5 54 116.5 55 106.0 56 90.5 57 80.5 58 86.0 59 97.5 60 78.5 61 62.5 62 73.0 63 63.0 64 56.5 65 67.5 66 59.5 67 56.5 68 63.0 69 58.5 70 46.0 71 37.0 72 34.0 73 33.0 74 29.0 75 25.5 76 19.0 77 12.0 78 8.5 79 6.0 80 5.5 81 4.0 82 5.0 83 5.5 84 3.5 85 3.0 86 2.5 87 3.0 88 3.5 89 3.0 90 3.0 91 2.5 92 2.0 93 4.0 94 5.0 95 4.0 96 6.0 97 5.5 98 2.5 99 6.0 100 9.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.15 #Duplication Level Percentage of deduplicated Percentage of total 1 83.38405356055996 68.5 2 12.994522215459526 21.349999999999998 3 2.799756542909312 6.9 4 0.5782105903834449 1.9 5 0.12172854534388314 0.5 6 0.030432136335970784 0.15 7 0.06086427267194157 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.030432136335970784 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit GGCGGGGCACCCGGAGGCGCAGATATATGTCGGGCTGCCGGCGTCGGAGC 7 0.17500000000000002 No Hit GGCCAGCACCGGCACATCTCAAGATGAAGGCAAGTACTTTTGCTCTCTTC 7 0.17500000000000002 No Hit ATCGCCCCAAATGTCAAATTTGGAGGTTCCGGATCATATCCTGATCTTCC 6 0.15 No Hit GCAAGTTTTTGCAGATAACCTACCATTGAGCGTTGACTTTGGTCTCCACG 5 0.125 No Hit ATTTTGCTTCCCCATCACTGACAAACAGCAACTTCGGTGCAAAACCAATG 5 0.125 No Hit AGGGCATCATCCCTGCCCTGGAGACGTCCCATGCGCTCGCCTACCTCGAG 5 0.125 No Hit CCGGTCTGTGAGTGGCGGGGCGTCGGAAGGTTCAGCTGTCGTTGACGCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 90-91 1.1 0.0 0.0 0.0 0.0 92-93 1.3125 0.0 0.0 0.0 0.0 94-95 1.4 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.8625 0.0 0.0 0.0 0.0 100-101 2.1125 0.0 0.0 0.0 0.0 102-103 2.525 0.0 0.0 0.0 0.0 104-105 3.05 0.0 0.0 0.0 0.0 106-107 3.525 0.0 0.0 0.0 0.0 108-109 3.8875 0.0 0.0 0.0 0.0 110-111 4.262499999999999 0.0 0.0 0.0 0.0 112-113 4.6 0.0 0.0 0.0 0.0 114-115 4.925000000000001 0.0 0.0 0.0 0.0 116-117 5.4 0.0 0.0 0.0 0.0 118-119 6.1625 0.0 0.0 0.0 0.0 120-121 6.6625 0.0 0.0 0.0 0.0 122-123 7.3125 0.0 0.0 0.0 0.0 124-125 7.949999999999999 0.0 0.0 0.0 0.0 126-127 8.5125 0.0 0.0 0.0 0.0 128-129 9.1 0.0 0.0 0.0 0.0 130-131 9.7125 0.0 0.0 0.0 0.0 132-133 10.5 0.0 0.0 0.0 0.0 134-135 11.149999999999999 0.0 0.0 0.0 0.0 136-137 11.675 0.0 0.0 0.0 0.0 138-139 12.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481761 spots for SRR12951323.sra Written 1481761 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra Read 1481752 spots for SRR12951323.sra Written 1481752 spots for SRR12951323.sra SRR ids: ['SRR12951323.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_35ln9v_3 SRR12951323.sra spots: 29635049 blocks: [[1, 1481752], [1481753, 2963504], [2963505, 4445256], [4445257, 5927008], [5927009, 7408760], [7408761, 8890512], [8890513, 10372264], [10372265, 11854016], [11854017, 13335768], [13335769, 14817520], [14817521, 16299272], [16299273, 17781024], [17781025, 19262776], [19262777, 20744528], [20744529, 22226280], [22226281, 23708032], [23708033, 25189784], [25189785, 26671536], [26671537, 28153288], [28153289, 29635049]] SRR12951323 file size 10049585 SRR12951323 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951323 SRR12951323_1.fastq SRR12951323_2.fastq Input file: SRR12951323_1.fastq Paired file: SRR12951323_2.fastq trimmed: SRR12951323-trimmed-pair1.fastq, SRR12951323-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:52:41 2024 >> started Sat Dec 7 11:53:11 2024 >> done (30.721s) 29635049 read pairs processed; of these: 186 ( 0.00%) short read pairs filtered out after trimming by size control 338997 ( 1.14%) empty read pairs filtered out after trimming by size control 29295866 (98.86%) read pairs available; of these: 4456617 (15.21%) trimmed read pairs available after processing 24839249 (84.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 15 0.00% 20 24 0.00% 21 22 0.00% 22 35 0.00% 23 42 0.00% 24 47 0.00% 25 47 0.00% 26 53 0.00% 27 72 0.00% 28 80 0.00% 29 72 0.00% 30 68 0.00% 31 77 0.00% 32 74 0.00% 33 93 0.00% 34 100 0.00% 35 108 0.00% 36 103 0.00% 37 96 0.00% 38 115 0.00% 39 112 0.00% 40 100 0.00% 41 129 0.00% 42 138 0.00% 43 135 0.00% 44 143 0.00% 45 139 0.00% 46 168 0.00% 47 167 0.00% 48 213 0.00% 49 231 0.00% 50 255 0.00% 51 290 0.00% 52 318 0.00% 53 345 0.00% 54 390 0.00% 55 460 0.00% 56 447 0.00% 57 540 0.00% 58 602 0.00% 59 730 0.00% 60 869 0.00% 61 990 0.00% 62 1074 0.00% 63 1266 0.00% 64 1282 0.00% 65 1427 0.00% 66 1567 0.01% 67 1667 0.01% 68 1961 0.01% 69 2239 0.01% 70 2730 0.01% 71 3130 0.01% 72 3604 0.01% 73 4031 0.01% 74 4552 0.02% 75 4951 0.02% 76 5360 0.02% 77 5963 0.02% 78 6469 0.02% 79 7278 0.02% 80 8367 0.03% 81 9453 0.03% 82 10782 0.04% 83 12152 0.04% 84 13142 0.04% 85 14456 0.05% 86 15267 0.05% 87 16465 0.06% 88 17562 0.06% 89 18636 0.06% 90 20186 0.07% 91 22079 0.08% 92 24217 0.08% 93 25979 0.09% 94 27807 0.09% 95 29718 0.10% 96 31294 0.11% 97 32673 0.11% 98 33836 0.12% 99 35180 0.12% 100 36911 0.13% 101 38939 0.13% 102 41294 0.14% 103 44283 0.15% 104 46055 0.16% 105 48258 0.16% 106 49715 0.17% 107 50249 0.17% 108 52302 0.18% 109 54004 0.18% 110 54978 0.19% 111 56993 0.19% 112 59143 0.20% 113 61744 0.21% 114 64380 0.22% 115 67067 0.23% 116 68211 0.23% 117 68975 0.24% 118 71028 0.24% 119 70706 0.24% 120 71431 0.24% 121 73868 0.25% 122 75799 0.26% 123 77164 0.26% 124 80353 0.27% 125 82372 0.28% 126 83706 0.29% 127 84285 0.29% 128 85264 0.29% 129 86427 0.30% 130 86917 0.30% 131 86706 0.30% 132 88642 0.30% 133 90596 0.31% 134 93439 0.32% 135 94642 0.32% 136 97530 0.33% 137 96596 0.33% 138 97382 0.33% 139 97841 0.33% 140 97869 0.33% 141 98979 0.34% 142 99463 0.34% 143 100044 0.34% 144 102467 0.35% 145 103552 0.35% 146 104841 0.36% 147 105484 0.36% 148 106299 0.36% 149 105550 0.36% 150 106801 0.36% 151 24839249 84.79% 29295866 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=13.03 fanout-score-rank=14 prefix-density=0.10 prefix-fanout=13.0 sequence=GGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCGTACCATCTCGTATGCCGTCTTCTGCTTGAAAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=29 fanout-score=283.85 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=22.3 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=31 prefix-density=0.62 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=245.25 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=21.7 sequence=CGCCGCCGCCGG SRR12951323 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:53:59 Started mapping on | Dec 07 11:54:00 Finished on | Dec 07 11:57:06 Mapping speed, Million of reads per hour | 567.02 Number of input reads | 29295866 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 27404167 Uniquely mapped reads % | 93.54% Average mapped length | 293.00 Number of splices: Total | 25374230 Number of splices: Annotated (sjdb) | 23432274 Number of splices: GT/AG | 25004530 Number of splices: GC/AG | 323520 Number of splices: AT/AC | 16468 Number of splices: Non-canonical | 29712 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256023 % of reads mapped to multiple loci | 0.87% Number of reads mapped to too many loci | 34459 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.72% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1635676 1635676 1635676 N_multimapping 256023 256023 256023 N_noFeature 1293925 26608023 1579722 N_ambiguous 593997 3907 83827 UnstrandedReadsAssigned:25516245 PositiveStrandReadsAssigned:792237 NegativeStrandReadsAssigned:25740618 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951323 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951323-trimmed-pair1.fastq SRR12951323-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,295,866 reads, 26,312,943 reads pseudoaligned [quant] estimated average fragment length: 255.152 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52973 SRR12951323.ke.tsv 35125 SRR12951323.se.tsv 88098 total ==> SRR12951323.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.571 0 0 PNS24247 1044 789.848 158.579 11.4091 PNS24249 1928 1673.85 423.196 14.3672 PNS24246 1044 789.848 158.579 11.4091 PNS24248 1044 789.848 158.579 11.4091 PNS24244 1471 1216.85 211.065 9.85662 PNS24243 293 106.046 0 0 KQK14069 1603 1348.85 57746.2 2432.81 KQK14071 474 244.91 184.869 42.895 ==> SRR12951323.se.tsv <== BRADI_1g14170v3 57740 BRADI_1g53295v3 336 BRADI_1g59795v3 925 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 1037 BRADI_1g74790v3 2306 BRADI_1g09890v3 0 BRADI_1g77505v3 335 BRADI_1g48960v3 0 SRR12951323 completed mapping pipeline successfully