Starting /dee2/code/volunteer_pipeline.sh SRR12951325 current disk space = 1543102803968 free memory = 1604848468 SRR12951325 SRAfilesize a060f66708debdb824f81e8ed204bb3b SRR12951325.sra SRR12951325.sra file validated SRR12951325 is paired end SRR12951325 is conventional basespace SRR12951325 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951325_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.545 37.0 37.0 37.0 37.0 37.0 2 36.35225 37.0 37.0 37.0 37.0 37.0 3 36.526 37.0 37.0 37.0 37.0 37.0 4 36.514 37.0 37.0 37.0 37.0 37.0 5 36.57 37.0 37.0 37.0 37.0 37.0 6 36.631 37.0 37.0 37.0 37.0 37.0 7 36.5325 37.0 37.0 37.0 37.0 37.0 8 36.536 37.0 37.0 37.0 37.0 37.0 9 36.5635 37.0 37.0 37.0 37.0 37.0 10-14 36.567 37.0 37.0 37.0 37.0 37.0 15-19 36.5515 37.0 37.0 37.0 37.0 37.0 20-24 36.4858 37.0 37.0 37.0 37.0 37.0 25-29 36.5077 37.0 37.0 37.0 37.0 37.0 30-34 36.462900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.4651 37.0 37.0 37.0 37.0 37.0 40-44 36.40840000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3512 37.0 37.0 37.0 37.0 37.0 50-54 36.38960000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.322 37.0 37.0 37.0 37.0 37.0 60-64 36.3135 37.0 37.0 37.0 37.0 37.0 65-69 36.288599999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2491 37.0 37.0 37.0 37.0 37.0 75-79 36.307300000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2675 37.0 37.0 37.0 37.0 37.0 85-89 36.2792 37.0 37.0 37.0 37.0 37.0 90-94 36.2684 37.0 37.0 37.0 37.0 37.0 95-99 36.2808 37.0 37.0 37.0 37.0 37.0 100-104 36.260200000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.186400000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.1595 37.0 37.0 37.0 37.0 37.0 115-119 36.1984 37.0 37.0 37.0 37.0 37.0 120-124 36.1437 37.0 37.0 37.0 37.0 37.0 125-129 36.0372 37.0 37.0 37.0 37.0 37.0 130-134 35.9908 37.0 37.0 37.0 37.0 37.0 135-139 35.9079 37.0 37.0 37.0 37.0 37.0 140-144 35.691500000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.6105 37.0 37.0 37.0 37.0 37.0 150-151 35.41575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 0.0 23 1.0 24 1.0 25 3.0 26 5.0 27 4.0 28 17.0 29 23.0 30 32.0 31 36.0 32 47.0 33 82.0 34 126.0 35 279.0 36 2828.0 37 514.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.1 11.450000000000001 4.175 35.275 2 21.83504637753823 10.002506893958385 33.91827525695663 34.24417147154675 3 20.025000000000002 15.65 27.0 37.325 4 24.725 23.1 22.675 29.5 5 26.650000000000002 27.275 23.45 22.625 6 24.375 30.375000000000004 21.125 24.125 7 18.975 24.5 37.625 18.9 8 20.474999999999998 24.9 28.749999999999996 25.874999999999996 9 20.1 22.55 31.900000000000002 25.45 10-14 23.880000000000003 26.395000000000003 24.47 25.255 15-19 24.255 24.8 24.14 26.805 20-24 24.095 25.75 24.779999999999998 25.374999999999996 25-29 24.125 25.71 24.005000000000003 26.16 30-34 23.919999999999998 25.45 24.775 25.855 35-39 24.095 24.995 24.474999999999998 26.435 40-44 24.22 24.765 24.89 26.125 45-49 23.955000000000002 24.709999999999997 25.05 26.284999999999997 50-54 24.11 24.665 25.169999999999998 26.055 55-59 23.765 24.95 24.490000000000002 26.795 60-64 24.585 24.990000000000002 24.279999999999998 26.145000000000003 65-69 24.145 24.895 24.235 26.724999999999998 70-74 24.23 25.055 24.465 26.25 75-79 24.395 24.68 24.845 26.08 80-84 24.755 24.03 24.735 26.479999999999997 85-89 24.705 25.115 24.695 25.485000000000003 90-94 24.455 24.57 24.64 26.334999999999997 95-99 24.65 25.080000000000002 24.099999999999998 26.169999999999998 100-104 25.025 25.47 23.59 25.915 105-109 25.185000000000002 24.705 23.685000000000002 26.424999999999997 110-114 24.93 25.224999999999998 23.615 26.229999999999997 115-119 24.85 24.77 23.965 26.415 120-124 24.535 24.855 24.235 26.375 125-129 24.905 24.83 23.595 26.669999999999998 130-134 24.295 25.415 24.02 26.27 135-139 24.965 24.815 23.425 26.795 140-144 24.725 25.019999999999996 23.26 26.995 145-149 25.305 25.52 22.665 26.51 150-151 25.025 25.174999999999997 23.1 26.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 3.5 27 3.5 28 1.5 29 2.5 30 4.0 31 6.0 32 10.5 33 19.5 34 26.0 35 26.5 36 49.0 37 65.0 38 68.0 39 91.0 40 109.5 41 131.5 42 154.0 43 166.5 44 183.5 45 195.5 46 200.0 47 194.5 48 180.5 49 168.0 50 155.0 51 151.5 52 128.0 53 115.5 54 124.0 55 106.5 56 95.5 57 82.5 58 63.0 59 63.5 60 71.0 61 64.5 62 63.0 63 59.0 64 51.5 65 66.5 66 64.5 67 54.5 68 51.0 69 48.5 70 53.0 71 44.0 72 35.0 73 34.0 74 24.5 75 18.0 76 17.0 77 11.0 78 8.0 79 6.0 80 3.5 81 3.5 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.55 #Duplication Level Percentage of deduplicated Percentage of total 1 83.40399757722592 68.85 2 12.961841308298 21.4 3 2.9376135675348274 7.2749999999999995 4 0.514839491217444 1.7000000000000002 5 0.15142337976983647 0.625 6 0.03028467595396729 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGGGACGGCGATCAGGTAGATGGCCTTCATGCTCTGGCCGGCCAGAAG 6 0.15 No Hit GCCATATCAAACTTTCACTTCATATATCCCAAGAATAATAACTGAAGCCT 5 0.125 No Hit CCTGGATCTTGGCCTTCACATTGTCAATAGTGTCAGATGACTCAACTTCA 5 0.125 No Hit GTTGTGTCTGAGTTAAACGACCCTAGTTTTATTTTCTATTGGGATAAAAA 5 0.125 No Hit GTCGTCTGCAAAGGATTCAGCCCGCCGCCCGTGGGGAAGGGAGCTTCGAG 5 0.125 No Hit GGGCATCGGGGCACCAGGCCTCATCCCAGGCATGAGAGGTTGCTGGAAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 90-91 1.025 0.0 0.0 0.0 0.0 92-93 1.3250000000000002 0.0 0.0 0.0 0.0 94-95 1.5125000000000002 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 2.0625 0.0 0.0 0.0 0.0 100-101 2.3625 0.0 0.0 0.0 0.0 102-103 2.55 0.0 0.0 0.0 0.0 104-105 2.8875 0.0 0.0 0.0 0.0 106-107 3.2375 0.0 0.0 0.0 0.0 108-109 3.575 0.0 0.0 0.0 0.0 110-111 4.0625 0.0 0.0 0.0 0.0 112-113 4.5625 0.0 0.0 0.0 0.0 114-115 5.125 0.0 0.0 0.0 0.0 116-117 5.8 0.0 0.0 0.0 0.0 118-119 6.425000000000001 0.0 0.0 0.0 0.0 120-121 7.225 0.0 0.0 0.0 0.0 122-123 7.699999999999999 0.0 0.0 0.0 0.0 124-125 8.3875 0.0 0.0 0.0 0.0 126-127 9.1 0.0 0.0 0.0 0.0 128-129 9.7125 0.0 0.0 0.0 0.0 130-131 10.600000000000001 0.0 0.0 0.0 0.0 132-133 11.375 0.0 0.0 0.0 0.0 134-135 12.1125 0.0 0.0 0.0 0.0 136-137 12.75 0.0 0.0 0.0 0.0 138-139 13.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATGTT 10 0.006830828 145.0 2 AGATTTA 10 0.006830828 145.0 9 AGAGCAC 65 0.0076375785 13.384615 135-139 >>END_MODULE SRR12951325 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951325_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.138 37.0 37.0 37.0 37.0 37.0 2 36.147 37.0 37.0 37.0 37.0 37.0 3 36.0865 37.0 37.0 37.0 37.0 37.0 4 36.044 37.0 37.0 37.0 37.0 37.0 5 36.217 37.0 37.0 37.0 37.0 37.0 6 36.1845 37.0 37.0 37.0 37.0 37.0 7 36.169 37.0 37.0 37.0 37.0 37.0 8 36.3015 37.0 37.0 37.0 37.0 37.0 9 36.14 37.0 37.0 37.0 37.0 37.0 10-14 36.1625 37.0 37.0 37.0 37.0 37.0 15-19 36.1553 37.0 37.0 37.0 37.0 37.0 20-24 36.0881 37.0 37.0 37.0 37.0 37.0 25-29 36.0452 37.0 37.0 37.0 37.0 37.0 30-34 35.9662 37.0 37.0 37.0 37.0 37.0 35-39 35.9433 37.0 37.0 37.0 37.0 37.0 40-44 35.9316 37.0 37.0 37.0 37.0 37.0 45-49 35.938599999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.9491 37.0 37.0 37.0 37.0 37.0 55-59 35.876999999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.9085 37.0 37.0 37.0 37.0 37.0 65-69 35.8744 37.0 37.0 37.0 37.0 37.0 70-74 35.847699999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.8112 37.0 37.0 37.0 37.0 37.0 80-84 35.815400000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.720299999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.8012 37.0 37.0 37.0 37.0 37.0 95-99 35.7646 37.0 37.0 37.0 37.0 37.0 100-104 35.666999999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.67190000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.6391 37.0 37.0 37.0 37.0 37.0 115-119 35.68339999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.5948 37.0 37.0 37.0 37.0 37.0 125-129 35.5278 37.0 37.0 37.0 37.0 37.0 130-134 35.41680000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.429100000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.2752 37.0 37.0 37.0 34.6 37.0 145-149 35.0776 37.0 37.0 37.0 27.4 37.0 150-151 34.817499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 9.0 14 8.0 15 6.0 16 5.0 17 1.0 18 0.0 19 4.0 20 4.0 21 6.0 22 7.0 23 8.0 24 4.0 25 17.0 26 9.0 27 9.0 28 12.0 29 18.0 30 24.0 31 34.0 32 48.0 33 94.0 34 206.0 35 497.0 36 2619.0 37 350.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.1 23.825 6.0249999999999995 26.05 2 29.725 22.675 26.150000000000002 21.45 3 22.650000000000002 25.1 30.0 22.25 4 26.125 31.4 21.224999999999998 21.25 5 30.175 31.7 17.575 20.549999999999997 6 26.650000000000002 33.425 18.95 20.974999999999998 7 23.925 21.825 30.95 23.3 8 23.474999999999998 23.525 22.725 30.275000000000002 9 24.099999999999998 21.975 26.275 27.650000000000002 10-14 26.715 25.09 22.555 25.64 15-19 27.089999999999996 24.7 22.845 25.365 20-24 26.33 24.79 23.525 25.355 25-29 26.740000000000002 24.47 23.375 25.415 30-34 26.325 24.759999999999998 23.515 25.4 35-39 27.13 24.925 23.365 24.58 40-44 26.69 24.575 23.48 25.255 45-49 26.66 24.884999999999998 23.895 24.560000000000002 50-54 26.845000000000002 24.09 24.335 24.73 55-59 26.58 24.855 23.75 24.815 60-64 26.8 24.845 23.48 24.875 65-69 26.795 24.595 23.595 25.014999999999997 70-74 27.029999999999998 24.275 23.455000000000002 25.240000000000002 75-79 26.915 25.14 23.555 24.39 80-84 26.605 25.064999999999998 23.880000000000003 24.45 85-89 26.805 24.215 23.935000000000002 25.045 90-94 27.0 24.990000000000002 23.155 24.855 95-99 27.985 24.895 23.125 23.995 100-104 27.150000000000002 24.865000000000002 23.599999999999998 24.385 105-109 27.79 24.245 23.794999999999998 24.169999999999998 110-114 27.275 25.415 23.115 24.195 115-119 27.875 25.55 23.255 23.32 120-124 27.900000000000002 25.27 23.315 23.515 125-129 28.77 25.935000000000002 22.17 23.125 130-134 28.939999999999998 25.014999999999997 22.895 23.150000000000002 135-139 29.335 25.130000000000003 22.8 22.735 140-144 30.415 25.185000000000002 22.365 22.035 145-149 30.84 25.3 21.995 21.865000000000002 150-151 30.625000000000004 25.0 21.5625 22.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 1.5 24 2.0 25 0.5 26 1.0 27 2.0 28 2.5 29 2.5 30 3.5 31 8.0 32 10.5 33 14.0 34 17.0 35 24.5 36 33.0 37 44.0 38 61.0 39 88.0 40 108.5 41 116.0 42 154.0 43 164.5 44 159.5 45 178.5 46 182.5 47 181.0 48 160.5 49 157.5 50 172.5 51 156.0 52 137.0 53 117.5 54 109.5 55 101.0 56 86.5 57 81.5 58 73.0 59 74.5 60 72.0 61 72.5 62 71.0 63 65.0 64 67.0 65 70.5 66 72.5 67 72.0 68 65.0 69 61.0 70 54.5 71 45.0 72 41.5 73 34.5 74 33.0 75 27.0 76 20.0 77 14.0 78 7.0 79 5.5 80 3.5 81 2.5 82 2.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 1.0 90 1.5 91 0.5 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 1.5 99 4.0 100 6.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.75 #Duplication Level Percentage of deduplicated Percentage of total 1 83.77643504531721 69.325 2 12.870090634441086 21.3 3 2.56797583081571 6.375 4 0.6042296072507553 2.0 5 0.09063444108761329 0.375 6 0.060422960725075525 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.030211480362537763 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 6 0.15 No Hit AGCTAGACGACATGGGAGCTCCGGGCCGGGATGAGGAGGAGGCGAAGAAG 6 0.15 No Hit AAAAACAGGAACAGGAACACATCAATAACGTGTATGGAAACTATTTACAG 5 0.125 No Hit GGTTGAGTCTTCGGACACAATTGACAATGTCAAGGCGAAGATCCAGGACA 5 0.125 No Hit ACCGCTTTATGTTGCACTCGCACAGCGTAAAGAAGACAGGAAAGCAAGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.8375 0.0 0.0 0.0 0.0 90-91 1.05 0.0 0.0 0.0 0.0 92-93 1.35 0.0 0.0 0.0 0.0 94-95 1.525 0.0 0.0 0.0 0.0 96-97 1.7125 0.0 0.0 0.0 0.0 98-99 2.0875 0.0 0.0 0.0 0.0 100-101 2.3875 0.0 0.0 0.0 0.0 102-103 2.575 0.0 0.0 0.0 0.0 104-105 2.925 0.0 0.0 0.0 0.0 106-107 3.2875 0.0 0.0 0.0 0.0 108-109 3.625 0.0 0.0 0.0 0.0 110-111 4.112500000000001 0.0 0.0 0.0 0.0 112-113 4.6375 0.0 0.0 0.0 0.0 114-115 5.2 0.0 0.0 0.0 0.0 116-117 5.875 0.0 0.0 0.0 0.0 118-119 6.5 0.0 0.0 0.0 0.0 120-121 7.3125 0.0 0.0 0.0 0.0 122-123 7.85 0.0 0.0 0.0 0.0 124-125 8.5375 0.0 0.0 0.0 0.0 126-127 9.25 0.0 0.0 0.0 0.0 128-129 9.8375 0.0 0.0 0.0 0.0 130-131 10.649999999999999 0.0 0.0 0.0 0.0 132-133 11.45 0.0 0.0 0.0 0.0 134-135 12.1875 0.0 0.0 0.0 0.0 136-137 12.825 0.0 0.0 0.0 0.0 138-139 13.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCGTG 55 0.0025160722 15.818182 140-144 AAGAGCG 60 0.004491891 14.500001 135-139 AGAGCGT 60 0.004491891 14.500001 135-139 TCGGAAG 65 0.0076375785 13.384615 130-134 ATCGGAA 65 0.0076375785 13.384615 130-134 >>END_MODULE Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590263 spots for SRR12951325.sra Written 1590263 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra Read 1590251 spots for SRR12951325.sra Written 1590251 spots for SRR12951325.sra SRR ids: ['SRR12951325.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hsf4221y SRR12951325.sra spots: 31805032 blocks: [[1, 1590251], [1590252, 3180502], [3180503, 4770753], [4770754, 6361004], [6361005, 7951255], [7951256, 9541506], [9541507, 11131757], [11131758, 12722008], [12722009, 14312259], [14312260, 15902510], [15902511, 17492761], [17492762, 19083012], [19083013, 20673263], [20673264, 22263514], [22263515, 23853765], [23853766, 25444016], [25444017, 27034267], [27034268, 28624518], [28624519, 30214769], [30214770, 31805032]] SRR12951325 file size 10787040 SRR12951325 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951325 SRR12951325_1.fastq SRR12951325_2.fastq Input file: SRR12951325_1.fastq Paired file: SRR12951325_2.fastq trimmed: SRR12951325-trimmed-pair1.fastq, SRR12951325-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:55:57 2024 >> started Sat Dec 7 11:56:36 2024 >> done (38.415s) 31805032 read pairs processed; of these: 296 ( 0.00%) short read pairs filtered out after trimming by size control 46555 ( 0.15%) empty read pairs filtered out after trimming by size control 31758181 (99.85%) read pairs available; of these: 5467375 (17.22%) trimmed read pairs available after processing 26290806 (82.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 22 0.00% 20 43 0.00% 21 39 0.00% 22 51 0.00% 23 82 0.00% 24 81 0.00% 25 97 0.00% 26 84 0.00% 27 100 0.00% 28 110 0.00% 29 112 0.00% 30 124 0.00% 31 109 0.00% 32 103 0.00% 33 112 0.00% 34 139 0.00% 35 124 0.00% 36 112 0.00% 37 143 0.00% 38 169 0.00% 39 162 0.00% 40 133 0.00% 41 154 0.00% 42 158 0.00% 43 199 0.00% 44 177 0.00% 45 198 0.00% 46 223 0.00% 47 258 0.00% 48 260 0.00% 49 288 0.00% 50 324 0.00% 51 382 0.00% 52 394 0.00% 53 382 0.00% 54 467 0.00% 55 526 0.00% 56 610 0.00% 57 658 0.00% 58 730 0.00% 59 835 0.00% 60 987 0.00% 61 1223 0.00% 62 1413 0.00% 63 1474 0.00% 64 1651 0.01% 65 1823 0.01% 66 1945 0.01% 67 2210 0.01% 68 2645 0.01% 69 3087 0.01% 70 3544 0.01% 71 4082 0.01% 72 4852 0.02% 73 5515 0.02% 74 6110 0.02% 75 6836 0.02% 76 7377 0.02% 77 8296 0.03% 78 8899 0.03% 79 10242 0.03% 80 11090 0.03% 81 12557 0.04% 82 14378 0.05% 83 16167 0.05% 84 17366 0.05% 85 19203 0.06% 86 20408 0.06% 87 21905 0.07% 88 23048 0.07% 89 25072 0.08% 90 27327 0.09% 91 28818 0.09% 92 31585 0.10% 93 33785 0.11% 94 36653 0.12% 95 38449 0.12% 96 40632 0.13% 97 42059 0.13% 98 43720 0.14% 99 45242 0.14% 100 47994 0.15% 101 49660 0.16% 102 52854 0.17% 103 56116 0.18% 104 58540 0.18% 105 60812 0.19% 106 62888 0.20% 107 64234 0.20% 108 65682 0.21% 109 68110 0.21% 110 68984 0.22% 111 71031 0.22% 112 73988 0.23% 113 77094 0.24% 114 79764 0.25% 115 82336 0.26% 116 83629 0.26% 117 85395 0.27% 118 86610 0.27% 119 87126 0.27% 120 88535 0.28% 121 90896 0.29% 122 93005 0.29% 123 94937 0.30% 124 98874 0.31% 125 100070 0.32% 126 102796 0.32% 127 103194 0.32% 128 103541 0.33% 129 104789 0.33% 130 105742 0.33% 131 105095 0.33% 132 108417 0.34% 133 110143 0.35% 134 111781 0.35% 135 114326 0.36% 136 114977 0.36% 137 115681 0.36% 138 116791 0.37% 139 118668 0.37% 140 115945 0.37% 141 118441 0.37% 142 119145 0.38% 143 119436 0.38% 144 121740 0.38% 145 123277 0.39% 146 123390 0.39% 147 123675 0.39% 148 124908 0.39% 149 123917 0.39% 150 125223 0.39% 151 26290806 82.78% 31758181 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.09 fanout-score-rank=39 prefix-density=0.24 prefix-fanout=3.0 sequence=GAACCGGAACCG criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=430.80 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=32.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=33 prefix-density=0.70 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=1130.26 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=21.2 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR12951325 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:57:23 Started mapping on | Dec 07 11:57:23 Finished on | Dec 07 12:00:52 Mapping speed, Million of reads per hour | 547.03 Number of input reads | 31758181 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 29858165 Uniquely mapped reads % | 94.02% Average mapped length | 291.48 Number of splices: Total | 29817535 Number of splices: Annotated (sjdb) | 27928183 Number of splices: GT/AG | 29398370 Number of splices: GC/AG | 350333 Number of splices: AT/AC | 20986 Number of splices: Non-canonical | 47846 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.50 Insertion rate per base | 0.01% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 365027 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 38219 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.17% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1534989 1534989 1534989 N_multimapping 365027 365027 365027 N_noFeature 970471 29099834 1209399 N_ambiguous 600921 4097 82697 UnstrandedReadsAssigned:28286773 PositiveStrandReadsAssigned:754234 NegativeStrandReadsAssigned:28566069 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951325 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951325-trimmed-pair1.fastq SRR12951325-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,758,181 reads, 29,071,195 reads pseudoaligned [quant] estimated average fragment length: 250.719 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,280 rounds 52973 SRR12951325.ke.tsv 35125 SRR12951325.se.tsv 88098 total ==> SRR12951325.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 686.935 0 0 PNS24247 1044 794.281 121.211 7.42618 PNS24249 1928 1678.28 409.132 11.8631 PNS24246 1044 794.281 121.211 7.42618 PNS24248 1044 794.281 121.211 7.42618 PNS24244 1471 1221.28 143.236 5.70735 PNS24243 293 109.819 1 0.443118 KQK14069 1603 1353.28 28836.9 1036.95 KQK14071 474 250.276 416.281 80.9405 ==> SRR12951325.se.tsv <== BRADI_1g14170v3 30681 BRADI_1g53295v3 183 BRADI_1g59795v3 728 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 1673 BRADI_1g74790v3 2046 BRADI_1g09890v3 0 BRADI_1g77505v3 353 BRADI_1g48960v3 0 SRR12951325 completed mapping pipeline successfully