Starting /dee2/code/volunteer_pipeline.sh SRR12951326 current disk space = 1543066951680 free memory = 1604803644 SRR12951326 SRAfilesize d9c20c9682de5750552910341c0a230e SRR12951326.sra SRR12951326.sra file validated SRR12951326 is paired end SRR12951326 is conventional basespace SRR12951326 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951326_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.587 37.0 37.0 37.0 37.0 37.0 2 36.08375 37.0 37.0 37.0 37.0 37.0 3 36.49 37.0 37.0 37.0 37.0 37.0 4 36.5625 37.0 37.0 37.0 37.0 37.0 5 36.61 37.0 37.0 37.0 37.0 37.0 6 36.621 37.0 37.0 37.0 37.0 37.0 7 36.5405 37.0 37.0 37.0 37.0 37.0 8 36.582 37.0 37.0 37.0 37.0 37.0 9 36.571 37.0 37.0 37.0 37.0 37.0 10-14 36.6001 37.0 37.0 37.0 37.0 37.0 15-19 36.5308 37.0 37.0 37.0 37.0 37.0 20-24 36.519600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5419 37.0 37.0 37.0 37.0 37.0 30-34 36.4687 37.0 37.0 37.0 37.0 37.0 35-39 36.4715 37.0 37.0 37.0 37.0 37.0 40-44 36.389599999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.2029 37.0 37.0 37.0 37.0 37.0 50-54 36.342299999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.0872 37.0 37.0 37.0 37.0 37.0 60-64 36.065599999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.934900000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.0833 37.0 37.0 37.0 37.0 37.0 75-79 36.276399999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.2986 37.0 37.0 37.0 37.0 37.0 85-89 36.2712 37.0 37.0 37.0 37.0 37.0 90-94 36.2916 37.0 37.0 37.0 37.0 37.0 95-99 36.239700000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.241699999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.2102 37.0 37.0 37.0 37.0 37.0 110-114 36.169200000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.229 37.0 37.0 37.0 37.0 37.0 120-124 36.1337 37.0 37.0 37.0 37.0 37.0 125-129 36.0339 37.0 37.0 37.0 37.0 37.0 130-134 36.011799999999994 37.0 37.0 37.0 37.0 37.0 135-139 36.034400000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.8132 37.0 37.0 37.0 37.0 37.0 145-149 35.805400000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.632000000000005 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 1.0 24 4.0 25 0.0 26 3.0 27 6.0 28 10.0 29 18.0 30 30.0 31 40.0 32 53.0 33 79.0 34 207.0 35 271.0 36 2768.0 37 509.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.0 10.125 4.375 35.5 2 21.976364093537843 13.955242645209957 32.68795574553683 31.380437515715364 3 19.675 13.475000000000001 26.924999999999997 39.925 4 24.7 20.599999999999998 21.475 33.225 5 29.175 25.124999999999996 22.75 22.95 6 26.075 30.599999999999998 21.075 22.25 7 18.05 27.025 35.825 19.1 8 19.25 27.175 29.2 24.375 9 23.05 21.6 32.2 23.150000000000002 10-14 22.81 27.675 24.465 25.05 15-19 23.880000000000003 25.06 24.735 26.325 20-24 23.169999999999998 27.029999999999998 24.02 25.779999999999998 25-29 23.225 24.91 25.115 26.75 30-34 24.625 25.185000000000002 24.240000000000002 25.95 35-39 23.61 25.245 25.055 26.090000000000003 40-44 23.74 24.81 26.179999999999996 25.27 45-49 24.325 24.9 24.65 26.125 50-54 24.205 24.935 23.735 27.125 55-59 24.08 24.205 25.419999999999998 26.295 60-64 23.955000000000002 24.240000000000002 25.77 26.035000000000004 65-69 24.44 26.085 24.23 25.245 70-74 25.71 23.974999999999998 24.635 25.679999999999996 75-79 26.045 23.885 23.505000000000003 26.565 80-84 25.955000000000002 24.075 23.98 25.990000000000002 85-89 26.11 23.825 24.02 26.045 90-94 25.7 24.27 24.279999999999998 25.75 95-99 26.009999999999998 24.235 24.015 25.740000000000002 100-104 26.179999999999996 23.905 23.86 26.055 105-109 26.009999999999998 24.14 23.71 26.14 110-114 25.645 24.73 24.055 25.569999999999997 115-119 26.14 24.39 23.455000000000002 26.015 120-124 26.25 24.335 23.51 25.905 125-129 26.515 24.25 23.085 26.150000000000002 130-134 26.88 23.91 23.52 25.69 135-139 26.32 24.665 22.720000000000002 26.295 140-144 26.5 24.72 22.91 25.869999999999997 145-149 27.04 24.54 22.46 25.96 150-151 26.7125 24.637500000000003 23.150000000000002 25.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 2.0 27 1.5 28 0.0 29 0.5 30 2.5 31 3.0 32 6.5 33 13.0 34 19.5 35 30.0 36 37.5 37 47.0 38 67.0 39 87.0 40 107.0 41 124.0 42 153.5 43 189.0 44 196.0 45 200.0 46 200.5 47 195.0 48 188.0 49 164.0 50 164.0 51 152.0 52 121.0 53 118.0 54 103.0 55 83.0 56 78.5 57 88.0 58 92.0 59 76.0 60 64.0 61 66.0 62 64.5 63 67.5 64 78.5 65 95.0 66 90.0 67 71.0 68 53.5 69 43.5 70 37.0 71 28.0 72 32.5 73 24.5 74 21.0 75 20.0 76 12.5 77 6.0 78 2.5 79 2.5 80 2.0 81 1.0 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.575 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.3 #Duplication Level Percentage of deduplicated Percentage of total 1 81.9356872635561 64.97500000000001 2 13.745271122320302 21.8 3 3.278688524590164 7.8 4 0.6935687263556116 2.1999999999999997 5 0.25220680958385877 1.0 6 0.031525851197982346 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.031525851197982346 0.5 >50 0.031525851197982346 1.575 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGACTGTTATCTCGTAT 63 1.575 TruSeq Adapter, Index 4 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGACTGTTATCGCGTAT 20 0.5 TruSeq Adapter, Index 4 (97% over 37bp) CCTCGGCACGCTTGATCTGGACAATCTTCTCAGCTTCAGCCTTCTCATTT 6 0.15 No Hit CTCCAGAACTCTTCGACGGTGTCGAAGGTGTAGCCTTTCTTGAGCGAGGT 5 0.125 No Hit ACAGCATGATGCCAACTACAGAGTTATATGATACAACAATCACAATTTCC 5 0.125 No Hit CCCGTTCAGTGCCTCCACACTCAAGTAGTCATCCAAACTTTCTTCTAAAT 5 0.125 No Hit CACGTGGCCAGCAGCACGGCCCCCGCCCCTAGCCGATGCCGATGCGACCC 5 0.125 No Hit CTTGATGACCTCGTTGAGATCATTGAACTTGAAGATTGACTGAACAGGCC 5 0.125 No Hit CTCGTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGG 5 0.125 No Hit GAGCCATCAGTGTCTTCCCAGTTCCAGGTGGTCCATATAAAAGAACCCCC 5 0.125 No Hit GGGTGATCTGAAGTGGAAGGAGCTGCGTTGTACTGCCCATATCCGGCATA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 90-91 1.275 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.7375 0.0 0.0 0.0 0.0 96-97 1.9125 0.0 0.0 0.0 0.0 98-99 2.1624999999999996 0.0 0.0 0.0 0.0 100-101 2.575 0.0 0.0 0.0 0.0 102-103 2.8875 0.0 0.0 0.0 0.0 104-105 3.1500000000000004 0.0 0.0 0.0 0.0 106-107 3.45 0.0 0.0 0.0 0.0 108-109 3.8125 0.0 0.0 0.0 0.0 110-111 4.15 0.0 0.0 0.0 0.0 112-113 4.625 0.0 0.0 0.0 0.0 114-115 5.1 0.0 0.0 0.0 0.0 116-117 5.45 0.0 0.0 0.0 0.0 118-119 6.0375 0.0 0.0 0.0 0.0 120-121 6.824999999999999 0.0 0.0 0.0 0.0 122-123 7.675000000000001 0.0 0.0 0.0 0.0 124-125 8.3875 0.0 0.0 0.0 0.0 126-127 9.1625 0.0 0.0 0.0 0.0 128-129 9.9375 0.0 0.0 0.0 0.0 130-131 10.8125 0.0 0.0 0.0 0.0 132-133 11.675 0.0 0.0 0.0 0.0 134-135 12.337499999999999 0.0 0.0 0.0 0.0 136-137 12.8375 0.0 0.0 0.0 0.0 138-139 14.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACCTA 10 0.006830828 145.0 2 GAGCACA 65 6.491996E-4 44.615383 9 AAGAGCA 70 9.353284E-4 41.428574 7 GATCGGA 70 9.353284E-4 41.428574 1 TCGGAAG 70 9.353284E-4 41.428574 3 CGGAAGA 70 9.353284E-4 41.428574 4 AGAGCAC 70 9.353284E-4 41.428574 8 ATCGGAA 70 9.353284E-4 41.428574 2 GGAAGAG 70 9.353284E-4 41.428574 5 GAAGAGC 90 0.0032161705 32.22222 6 AGGGGGG 20 0.00593511 29.0 65-69 >>END_MODULE SRR12951326 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12951326_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.157 37.0 37.0 37.0 37.0 37.0 2 36.033 37.0 37.0 37.0 37.0 37.0 3 36.047 37.0 37.0 37.0 37.0 37.0 4 36.058 37.0 37.0 37.0 37.0 37.0 5 36.1075 37.0 37.0 37.0 37.0 37.0 6 36.1325 37.0 37.0 37.0 37.0 37.0 7 36.066 37.0 37.0 37.0 37.0 37.0 8 35.9465 37.0 37.0 37.0 37.0 37.0 9 36.1035 37.0 37.0 37.0 37.0 37.0 10-14 35.962599999999995 37.0 37.0 37.0 37.0 37.0 15-19 35.9216 37.0 37.0 37.0 37.0 37.0 20-24 35.7907 37.0 37.0 37.0 37.0 37.0 25-29 35.5853 37.0 37.0 37.0 37.0 37.0 30-34 35.4892 37.0 37.0 37.0 37.0 37.0 35-39 35.39659999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.4495 37.0 37.0 37.0 37.0 37.0 45-49 35.4629 37.0 37.0 37.0 37.0 37.0 50-54 35.448 37.0 37.0 37.0 37.0 37.0 55-59 35.3574 37.0 37.0 37.0 37.0 37.0 60-64 35.485200000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.4028 37.0 37.0 37.0 37.0 37.0 70-74 35.318200000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.2878 37.0 37.0 37.0 37.0 37.0 80-84 35.301500000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.318 37.0 37.0 37.0 37.0 37.0 90-94 35.518600000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.494 37.0 37.0 37.0 37.0 37.0 100-104 35.497699999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.4644 37.0 37.0 37.0 37.0 37.0 110-114 35.4304 37.0 37.0 37.0 37.0 37.0 115-119 35.5524 37.0 37.0 37.0 37.0 37.0 120-124 35.4881 37.0 37.0 37.0 37.0 37.0 125-129 35.3815 37.0 37.0 37.0 37.0 37.0 130-134 35.240899999999996 37.0 37.0 37.0 34.6 37.0 135-139 35.1346 37.0 37.0 37.0 32.2 37.0 140-144 35.013 37.0 37.0 37.0 29.8 37.0 145-149 34.8891 37.0 37.0 37.0 25.0 37.0 150-151 34.58475 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 8.0 14 12.0 15 11.0 16 7.0 17 7.0 18 4.0 19 1.0 20 14.0 21 12.0 22 9.0 23 11.0 24 17.0 25 13.0 26 12.0 27 21.0 28 26.0 29 27.0 30 29.0 31 47.0 32 53.0 33 99.0 34 196.0 35 496.0 36 2618.0 37 249.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.925 21.45 7.725 24.9 2 30.8 23.974999999999998 24.275 20.95 3 25.95 24.85 26.700000000000003 22.5 4 28.449999999999996 30.25 19.55 21.75 5 29.7 30.9 18.475 20.925 6 28.050000000000004 32.95 17.9 21.099999999999998 7 27.450000000000003 20.825 30.15 21.575 8 25.7 22.775000000000002 22.775000000000002 28.749999999999996 9 27.325 21.525 23.9 27.250000000000004 10-14 29.09 24.525 22.384999999999998 24.0 15-19 27.994999999999997 24.035 23.05 24.92 20-24 28.515 23.895 23.28 24.310000000000002 25-29 28.634999999999998 24.42 22.509999999999998 24.435000000000002 30-34 28.52 24.23 23.35 23.9 35-39 27.975 24.895 22.955000000000002 24.175 40-44 27.889999999999997 24.58 23.494999999999997 24.035 45-49 27.634999999999998 25.0 23.380000000000003 23.985 50-54 28.02 23.905 23.810000000000002 24.265 55-59 28.405 23.925 23.21 24.46 60-64 28.249999999999996 23.87 23.815 24.065 65-69 28.375 23.93 23.52 24.175 70-74 28.749999999999996 24.310000000000002 23.335 23.605 75-79 27.505000000000003 24.8 24.215 23.48 80-84 27.96 24.675 23.61 23.755000000000003 85-89 28.26 24.3 23.169999999999998 24.27 90-94 28.405 24.245 23.68 23.669999999999998 95-99 29.225 24.224999999999998 23.025000000000002 23.525 100-104 29.07 24.565 23.24 23.125 105-109 29.154999999999998 24.455 23.885 22.505 110-114 29.515 24.13 23.075000000000003 23.28 115-119 29.04 24.759999999999998 22.900000000000002 23.3 120-124 29.909999999999997 24.685000000000002 22.689999999999998 22.715 125-129 30.25 24.545 23.04 22.165000000000003 130-134 30.745 24.005000000000003 22.95 22.3 135-139 31.15 23.825 22.675 22.35 140-144 31.665 24.59 22.34 21.404999999999998 145-149 32.21 24.22 21.805 21.765 150-151 31.924999999999997 24.837500000000002 22.55 20.6875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 1.5 10 1.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.5 20 1.5 21 1.0 22 1.0 23 1.0 24 0.5 25 1.0 26 0.5 27 0.0 28 1.0 29 6.0 30 7.0 31 3.0 32 5.5 33 13.0 34 23.0 35 31.0 36 39.5 37 52.5 38 59.5 39 72.0 40 106.5 41 132.0 42 144.5 43 153.5 44 165.0 45 172.0 46 177.5 47 182.0 48 175.5 49 175.5 50 158.0 51 131.0 52 109.0 53 101.0 54 108.0 55 111.0 56 94.0 57 80.0 58 88.5 59 85.0 60 76.5 61 62.5 62 60.5 63 68.5 64 68.0 65 66.0 66 64.0 67 60.0 68 60.5 69 57.5 70 44.0 71 48.5 72 49.5 73 34.0 74 23.5 75 21.5 76 16.5 77 12.0 78 9.0 79 3.0 80 2.0 81 6.0 82 6.5 83 3.5 84 1.5 85 4.0 86 6.0 87 4.0 88 4.0 89 4.0 90 2.0 91 1.5 92 2.0 93 3.0 94 3.0 95 2.0 96 3.5 97 6.0 98 9.5 99 12.0 100 19.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 80.875 #Duplication Level Percentage of deduplicated Percentage of total 1 82.81298299845442 66.975 2 13.230293663060277 21.4 3 2.8438948995363216 6.9 4 0.7109737248840804 2.3 5 0.3091190108191654 1.25 6 0.061823802163833076 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.030911901081916538 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 35 0.8750000000000001 No Hit CAAACTAACAAACACAAGATCCCAGATCCAAGCTTATGTTTTTGATGTGA 6 0.15 No Hit ATTGGAACTAGACAACGGCGTCCAGCAGGACAGTCATGAATTTCTCACCT 6 0.15 No Hit TGCTTCCCTTCTCTCTCTTGTCTCGCTGTGCGGCTCTCGCGACTTCCCCC 5 0.125 No Hit ACTCACTGTACGATGATTATGTTTGGATGGAGAGGTTTGGAGATCCCTTG 5 0.125 No Hit CATGTCTCTTCTGTTGAATACAACAAGGTTCTCTACGACTTGTAGTTCTG 5 0.125 No Hit GAGTTCCTTTGGTTCCCGTGGTCTCTGTTTTCTTCAATATGTTTCTGTTT 5 0.125 No Hit GAAGCTGCAGGTGCACGTCGGCCCGCCAGGCTCCGGGGCGGGCGGAGCGC 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGT 5 0.125 No Hit ACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 5 0.125 No Hit GCCATGTTGCTATGTTTTGGTTACATCCAGGATGTATTCTCGTTGTTTTT 5 0.125 No Hit AAAATGTGTTGTTTTAAAAACCTCCACGAGACAAACTATATTCCTCCCTG 5 0.125 No Hit GGAAAGGTGTTGAACAGGGCCCTCAGATTGATGATGAGCAATTCAACAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1625 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.48750000000000004 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.85 0.0 0.0 0.0 0.0 88-89 1.0125000000000002 0.0 0.0 0.0 0.0 90-91 1.3 0.0 0.0 0.0 0.0 92-93 1.5 0.0 0.0 0.0 0.0 94-95 1.7625 0.0 0.0 0.0 0.0 96-97 1.9375 0.0 0.0 0.0 0.0 98-99 2.175 0.0 0.0 0.0 0.0 100-101 2.55 0.0 0.0 0.0 0.0 102-103 2.8625 0.0 0.0 0.0 0.0 104-105 3.125 0.0 0.0 0.0 0.0 106-107 3.425 0.0 0.0 0.0 0.0 108-109 3.7875 0.0 0.0 0.0 0.0 110-111 4.125 0.0 0.0 0.0 0.0 112-113 4.6 0.0 0.0 0.0 0.0 114-115 5.075 0.0 0.0 0.0 0.0 116-117 5.425 0.0 0.0 0.0 0.0 118-119 6.012499999999999 0.0 0.0 0.0 0.0 120-121 6.800000000000001 0.0 0.0 0.0 0.0 122-123 7.65 0.0 0.0 0.0 0.0 124-125 8.3625 0.0 0.0 0.0 0.0 126-127 9.1125 0.0 0.0 0.0 0.0 128-129 9.9125 0.0 0.0 0.0 0.0 130-131 10.7875 0.0 0.0 0.0 0.0 132-133 11.6625 0.0 0.0 0.0 0.0 134-135 12.35 0.0 0.0 0.0 0.0 136-137 12.8625 0.0 0.0 0.0 0.0 138-139 14.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCCCT 10 0.006830828 145.0 145 >>END_MODULE Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615697 spots for SRR12951326.sra Written 1615697 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra Read 1615685 spots for SRR12951326.sra Written 1615685 spots for SRR12951326.sra SRR ids: ['SRR12951326.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ll78i49q SRR12951326.sra spots: 32313712 blocks: [[1, 1615685], [1615686, 3231370], [3231371, 4847055], [4847056, 6462740], [6462741, 8078425], [8078426, 9694110], [9694111, 11309795], [11309796, 12925480], [12925481, 14541165], [14541166, 16156850], [16156851, 17772535], [17772536, 19388220], [19388221, 21003905], [21003906, 22619590], [22619591, 24235275], [24235276, 25850960], [25850961, 27466645], [27466646, 29082330], [29082331, 30698015], [30698016, 32313712]] SRR12951326 file size 10959912 SRR12951326 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12951326 SRR12951326_1.fastq SRR12951326_2.fastq Input file: SRR12951326_1.fastq Paired file: SRR12951326_2.fastq trimmed: SRR12951326-trimmed-pair1.fastq, SRR12951326-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 11:57:01 2024 >> started Sat Dec 7 11:57:54 2024 >> done (53.264s) 32313712 read pairs processed; of these: 212 ( 0.00%) short read pairs filtered out after trimming by size control 578489 ( 1.79%) empty read pairs filtered out after trimming by size control 31735011 (98.21%) read pairs available; of these: 5478536 (17.26%) trimmed read pairs available after processing 26256475 (82.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 23 0.00% 20 25 0.00% 21 34 0.00% 22 35 0.00% 23 49 0.00% 24 45 0.00% 25 62 0.00% 26 65 0.00% 27 86 0.00% 28 68 0.00% 29 66 0.00% 30 90 0.00% 31 78 0.00% 32 94 0.00% 33 94 0.00% 34 105 0.00% 35 97 0.00% 36 104 0.00% 37 126 0.00% 38 123 0.00% 39 150 0.00% 40 114 0.00% 41 135 0.00% 42 153 0.00% 43 166 0.00% 44 177 0.00% 45 161 0.00% 46 219 0.00% 47 197 0.00% 48 249 0.00% 49 304 0.00% 50 352 0.00% 51 358 0.00% 52 427 0.00% 53 430 0.00% 54 425 0.00% 55 499 0.00% 56 563 0.00% 57 676 0.00% 58 766 0.00% 59 934 0.00% 60 1007 0.00% 61 1161 0.00% 62 1347 0.00% 63 1484 0.00% 64 1766 0.01% 65 1811 0.01% 66 2016 0.01% 67 2298 0.01% 68 2630 0.01% 69 2930 0.01% 70 3405 0.01% 71 3976 0.01% 72 4534 0.01% 73 5105 0.02% 74 5879 0.02% 75 6314 0.02% 76 6866 0.02% 77 7751 0.02% 78 8629 0.03% 79 9704 0.03% 80 10708 0.03% 81 12130 0.04% 82 13544 0.04% 83 15471 0.05% 84 16953 0.05% 85 18433 0.06% 86 19906 0.06% 87 21474 0.07% 88 22963 0.07% 89 24633 0.08% 90 26009 0.08% 91 28698 0.09% 92 31329 0.10% 93 33591 0.11% 94 36137 0.11% 95 38335 0.12% 96 39844 0.13% 97 41965 0.13% 98 43865 0.14% 99 45268 0.14% 100 47542 0.15% 101 50048 0.16% 102 52533 0.17% 103 54919 0.17% 104 57507 0.18% 105 60564 0.19% 106 62402 0.20% 107 64094 0.20% 108 65557 0.21% 109 68105 0.21% 110 69250 0.22% 111 71191 0.22% 112 74832 0.24% 113 75955 0.24% 114 80060 0.25% 115 81688 0.26% 116 84372 0.27% 117 85522 0.27% 118 87968 0.28% 119 88328 0.28% 120 89159 0.28% 121 91108 0.29% 122 92479 0.29% 123 95090 0.30% 124 98584 0.31% 125 99743 0.31% 126 102906 0.32% 127 103342 0.33% 128 104094 0.33% 129 106033 0.33% 130 106244 0.33% 131 107725 0.34% 132 108949 0.34% 133 110043 0.35% 134 112743 0.36% 135 115300 0.36% 136 116881 0.37% 137 117296 0.37% 138 118237 0.37% 139 118211 0.37% 140 118875 0.37% 141 120146 0.38% 142 120817 0.38% 143 120647 0.38% 144 122616 0.39% 145 123467 0.39% 146 123619 0.39% 147 124638 0.39% 148 125259 0.39% 149 125145 0.39% 150 125894 0.40% 151 26256475 82.74% 31735011 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=30 prefix-density=0.27 prefix-fanout=2.9 sequence=GAACCGGAACCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=370.10 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=20.7 sequence=CCGCCGCCGCGTAGCTTCTGGTGGACGGGGCCAGCAGCTGGGCCAGCGCGCGGGCAGCAGCCGAGGAACCGGAGAGAGCGAGAGCCATCGATTGATCTGTGTGTTTTGATCGGATGGCTGGTGGCGCTCCGGCTCTCTGCTGCTGCTCCAACGTGGGTTGCTGG criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=35 prefix-density=0.80 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=181.39 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=22.2 sequence=CGGCGGCGGCGGAG SRR12951326 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 11:58:34 Started mapping on | Dec 07 11:58:34 Finished on | Dec 07 12:01:56 Mapping speed, Million of reads per hour | 565.57 Number of input reads | 31735011 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 29566080 Uniquely mapped reads % | 93.17% Average mapped length | 291.50 Number of splices: Total | 27801598 Number of splices: Annotated (sjdb) | 25861969 Number of splices: GT/AG | 27390350 Number of splices: GC/AG | 344508 Number of splices: AT/AC | 18407 Number of splices: Non-canonical | 48333 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 344511 % of reads mapped to multiple loci | 1.09% Number of reads mapped to too many loci | 99239 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.75% % of reads unmapped: other | 1.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1824420 1824420 1824420 N_multimapping 344511 344511 344511 N_noFeature 1045881 28723423 1295493 N_ambiguous 690003 4118 97480 UnstrandedReadsAssigned:27830196 PositiveStrandReadsAssigned:838539 NegativeStrandReadsAssigned:28173107 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12951326 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12951326-trimmed-pair1.fastq SRR12951326-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,735,011 reads, 28,703,577 reads pseudoaligned [quant] estimated average fragment length: 248.122 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR12951326.ke.tsv 35125 SRR12951326.se.tsv 88098 total ==> SRR12951326.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.631 0 0 PNS24247 1044 796.878 179.072 10.9731 PNS24249 1928 1680.88 320.695 9.31647 PNS24246 1044 796.878 179.072 10.9731 PNS24248 1044 796.878 179.072 10.9731 PNS24244 1471 1223.88 353.09 14.0878 PNS24243 293 108.678 3 1.34795 KQK14069 1603 1355.88 68719.9 2474.9 KQK14071 474 250.021 1020.88 199.384 ==> SRR12951326.se.tsv <== BRADI_1g14170v3 72835 BRADI_1g53295v3 307 BRADI_1g59795v3 815 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 727 BRADI_1g74790v3 2953 BRADI_1g09890v3 0 BRADI_1g77505v3 524 BRADI_1g48960v3 0 SRR12951326 completed mapping pipeline successfully