Starting /dee2/code/volunteer_pipeline.sh SRR13172448 current disk space = 1551433867264 free memory = 1607239524 SRR13172448 SRAfilesize 21b55657591461b8a5ea6e6a531df6d2 SRR13172448.sra SRR13172448.sra file validated SRR13172448 is paired end SRR13172448 is conventional basespace SRR13172448 read1 length is 30-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13172448_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 30-101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.55475 34.0 31.0 34.0 31.0 37.0 2 33.8265 34.0 33.0 34.0 31.0 39.0 3 33.839 34.0 33.0 34.0 31.0 38.0 4 36.8805 37.0 37.0 37.0 35.0 38.0 5 36.68075 37.0 37.0 37.0 35.0 38.0 6 36.742 37.0 37.0 37.0 35.0 39.0 7 36.7605 37.0 37.0 37.0 35.0 40.0 8 36.754 37.0 37.0 37.0 35.0 39.0 9 38.32625 39.0 39.0 39.0 37.0 39.0 10-11 38.37375 39.0 39.0 39.0 37.0 39.0 12-13 38.391 39.0 39.0 39.0 37.0 40.0 14-15 39.27275 40.0 38.5 41.0 36.0 41.0 16-17 38.96525 40.0 38.0 41.0 35.0 41.0 18-19 38.993 40.0 38.0 41.0 35.0 41.0 20-21 38.9225 40.0 38.0 41.0 35.0 41.0 22-23 38.743625 40.0 38.0 41.0 35.0 41.0 24-25 38.7435 40.0 38.0 41.0 35.0 41.0 26-27 38.620374999999996 40.0 37.0 41.0 35.0 41.0 28-29 38.555625 40.0 37.0 41.0 35.0 41.0 30-31 38.42992560728745 40.0 37.0 41.0 35.0 41.0 32-33 38.40123462108477 40.0 37.5 41.0 35.0 41.0 34-35 38.40066434925015 40.0 37.5 41.0 35.0 41.0 36-37 38.22330543563988 40.0 37.0 41.0 34.0 41.0 38-39 38.077734595338555 40.0 37.0 41.0 33.5 41.0 40-41 37.98296144744151 40.0 36.0 41.0 33.5 41.0 42-43 37.933418158706004 40.0 36.0 41.0 33.0 41.0 44-45 37.84819752269436 40.0 35.0 41.0 33.0 41.0 46-47 37.43619259754135 39.0 35.0 41.0 33.0 41.0 48-49 37.39655973236815 39.0 35.0 41.0 33.0 41.0 50-51 37.38996701607047 39.0 35.0 41.0 33.0 41.0 52-53 37.30236053192499 39.0 35.0 41.0 33.0 41.0 54-55 36.854203423984686 38.0 35.0 40.0 31.5 41.0 56-57 36.98448145925037 38.0 35.0 40.0 33.0 41.0 58-59 36.93180023089706 38.0 35.0 40.0 33.0 41.0 60-61 36.3951355719047 37.0 35.0 40.0 31.0 41.0 62-63 36.292350400499636 37.0 35.0 40.0 32.0 41.0 64-65 36.03885905962615 36.0 35.0 39.5 31.0 41.0 66-67 35.64792090268131 36.0 34.0 39.0 31.0 41.0 68-69 35.348392385001546 35.0 34.0 39.0 31.0 40.0 70-71 35.03136948254577 35.0 34.0 38.0 30.0 40.0 72-73 34.712293819777386 35.0 34.0 37.0 30.0 39.5 74-75 34.42785564774478 35.0 33.5 37.0 30.0 39.0 76-77 33.49257347743783 34.5 32.5 35.5 28.5 38.5 78-79 34.04122071159965 35.0 33.0 36.0 30.0 37.5 80-81 34.01286469842266 35.0 33.0 36.0 30.0 37.0 82-83 33.67962738987955 35.0 33.0 35.0 29.5 37.0 84-85 33.470307800134336 35.0 33.0 35.0 29.0 36.0 86-87 33.45169858156028 35.0 33.0 35.0 30.0 36.0 88-89 33.39820831075818 35.0 33.0 35.0 29.0 36.0 90-91 33.31875450022103 35.0 33.0 35.0 29.0 35.0 92-93 33.256864906570485 35.0 33.0 35.0 29.0 35.0 94-95 33.208840442711406 35.0 33.0 35.0 29.0 35.0 96-97 33.27083869767044 35.0 33.0 35.0 29.5 35.0 98-99 33.30167323965233 35.0 33.0 35.0 29.5 35.0 100-101 32.91596039096039 34.5 32.0 35.0 28.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 1.0 25 7.0 26 12.0 27 20.0 28 27.0 29 46.0 30 59.0 31 84.0 32 110.0 33 145.0 34 257.0 35 465.0 36 688.0 37 1119.0 38 855.0 39 101.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 17.4 39.75 17.974999999999998 24.875 2 22.675 24.8 24.6 27.925 3 18.45 25.95 32.05 23.549999999999997 4 20.1 25.3 33.425 21.175 5 23.045991455139482 23.67429002261875 32.74692133701935 20.532797185222417 6 20.075000000000003 24.7 33.35 21.875 7 22.25 23.849999999999998 32.85 21.05 8 19.425 24.825 34.300000000000004 21.45 9 19.75 23.5 35.875 20.875 10-11 21.275 23.825 33.8125 21.087500000000002 12-13 20.349999999999998 24.4 32.875 22.375 14-15 20.6375 25.074999999999996 32.65 21.637500000000003 16-17 20.974999999999998 24.3875 33.9875 20.65 18-19 20.837500000000002 24.925 32.775 21.462500000000002 20-21 20.6375 25.0 33.2625 21.099999999999998 22-23 21.0 24.525 33.4125 21.0625 24-25 20.625 24.349999999999998 33.4875 21.5375 26-27 20.95 25.0 33.25 20.8 28-29 20.5875 25.424999999999997 32.65 21.337500000000002 30-31 20.92555331991952 24.899396378269618 32.50754527162978 21.667505030181086 32-33 21.940819227290348 25.59762243183874 30.559503811861997 21.902054529008915 34-35 22.374129091626134 25.778887866438804 29.89351912711976 21.953463914815302 36-37 23.21216126900198 26.939854593522806 28.67151354923992 21.176470588235293 38-39 21.959638874137017 25.491237387148168 29.87254381306426 22.676579925650557 40-41 22.29027962716378 26.40479360852197 29.45406125166445 21.8508655126498 42-43 22.068045363575717 25.897264843228818 29.15276851234156 22.881921280853902 44-45 22.648829431438127 26.39464882943144 28.8695652173913 22.086956521739133 46-47 23.10169036758787 25.83847598604776 28.186208746981485 22.873624899382882 48-49 21.457435344827587 27.653556034482758 28.259698275862068 22.629310344827587 50-51 23.011478730587438 26.792707629979745 28.264686022957463 21.931127616475354 52-53 22.518618821936357 26.445497630331754 28.47664184157075 22.55924170616114 54-55 22.32324603066902 27.384991179264485 28.294205455285653 21.997557334780836 56-57 22.85286511501293 26.45977950183748 28.678372124676738 22.008983258472846 58-59 23.073776080730944 27.751261420973684 27.35578889949543 21.819173598799946 60-61 23.44582593250444 26.83426697636289 27.503757343899437 22.21614974723323 62-63 22.97352900836648 27.883692223288985 27.170484158551638 21.972294609792893 64-65 22.81694026762312 27.176162229273004 27.1485722168575 22.858325286246377 66-67 21.957635331579674 28.049286999861557 26.872490654852555 23.120587013706217 68-69 21.780250347705145 28.74826147426982 26.773296244784422 22.69819193324061 70-71 22.24857023294741 28.28846422095132 26.44720323615567 23.0157623099456 72-73 22.387015530992024 28.137680145515603 26.79445921365608 22.680845109836294 74-75 21.790374631682337 28.735793461484494 27.178335905710675 22.29549600112249 76-77 23.668639053254438 27.542969850662157 26.73992673992674 22.048464356156664 78-79 23.414285714285715 28.642857142857142 25.657142857142855 22.285714285714285 80-81 22.04747342362021 29.79467016164264 25.396825396825395 22.76103101791175 82-83 23.67340955731457 29.302257402521253 24.655526238639695 22.368806801524478 84-85 22.72995283018868 29.731721698113205 24.660966981132077 22.87735849056604 86-87 23.45021452877645 29.013167628347386 24.619026483207577 22.91759135966859 88-89 22.71711604349769 29.375837926411442 24.787725309101745 23.119320720989126 90-91 23.8808204821081 28.68692918101512 24.584518640515046 22.84773169636173 92-93 23.762675949750264 28.863326774632963 24.216739821401546 23.157257454215227 94-95 23.0745674475578 28.47955902618282 25.8919001684275 22.55397335783188 96-97 23.525760397268776 28.289882060831783 25.481067659838608 22.703289882060833 98-99 22.35887732576474 28.71333964049196 25.46515294859666 23.462630085146643 100-101 22.93900804289544 27.630697050938334 25.619973190348528 23.810321715817693 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 69.0 1 153.0 2 266.5 3 270.0 4 218.0 5 100.5 6 7.5 7 4.0 8 3.0 9 5.0 10 5.5 11 4.5 12 4.0 13 4.5 14 3.5 15 1.5 16 4.0 17 7.5 18 10.0 19 10.0 20 8.0 21 6.5 22 7.5 23 10.0 24 9.0 25 7.0 26 10.0 27 13.0 28 16.0 29 16.0 30 18.0 31 22.5 32 28.0 33 34.5 34 42.0 35 52.0 36 68.5 37 77.0 38 80.5 39 107.0 40 121.5 41 128.0 42 150.0 43 154.0 44 149.0 45 141.5 46 147.0 47 152.0 48 144.5 49 134.0 50 130.5 51 114.5 52 95.5 53 100.0 54 89.0 55 75.0 56 62.5 57 64.5 58 65.5 59 53.0 60 45.0 61 47.0 62 48.0 63 47.5 64 51.5 65 41.0 66 36.0 67 48.5 68 42.5 69 30.5 70 30.5 71 29.5 72 23.0 73 17.5 74 15.5 75 13.0 76 12.5 77 10.5 78 7.5 79 4.5 80 3.0 81 3.0 82 2.0 83 1.0 84 1.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.525 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.026284662899198317 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 30-31 110.0 32-33 78.0 34-35 24.0 36-37 16.0 38-39 16.0 40-41 7.0 42-43 7.0 44-45 12.0 46-47 14.0 48-49 10.0 50-51 12.0 52-53 6.0 54-55 13.0 56-57 7.0 58-59 6.0 60-61 12.0 62-63 22.0 64-65 13.0 66-67 18.0 68-69 10.0 70-71 11.0 72-73 9.0 74-75 16.0 76-77 8.0 78-79 101.0 80-81 26.0 82-83 20.0 84-85 12.0 86-87 23.0 88-89 16.0 90-91 33.0 92-93 36.0 94-95 39.0 96-97 52.0 98-99 77.0 100-101 3108.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.68531468531468 88.2 2 0.5874125874125874 1.05 3 0.1958041958041958 0.525 4 0.16783216783216784 0.6 5 0.055944055944055944 0.25 6 0.0 0.0 7 0.055944055944055944 0.35000000000000003 8 0.0 0.0 9 0.027972027972027972 0.22499999999999998 >10 0.13986013986013987 3.5999999999999996 >50 0.08391608391608392 5.2 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 95 2.375 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 61 1.525 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 52 1.3 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTT 43 1.075 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 41 1.0250000000000001 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 35 0.8750000000000001 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 14 0.35000000000000003 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 9 0.22499999999999998 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTTT 40 9.913492E-10 79.1 1 CTTTTTT 40 9.913492E-10 79.1 2 >>END_MODULE SRR13172448 read2 length is 30-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13172448_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 30-101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.821 34.0 31.0 34.0 31.0 40.0 2 33.9945 34.0 31.0 34.0 31.0 41.0 3 33.8085 34.0 31.0 34.0 31.0 40.0 4 36.81325 37.0 37.0 37.0 35.0 41.0 5 36.84175 37.0 37.0 37.0 35.0 41.0 6 36.7805 37.0 37.0 37.0 35.0 41.0 7 36.736 37.0 37.0 37.0 35.0 41.0 8 36.70175 37.0 37.0 37.0 35.0 41.0 9 37.7975 39.0 38.0 39.0 35.0 41.0 10-11 37.987375 39.0 38.0 39.0 35.0 41.0 12-13 38.071749999999994 39.0 38.0 39.0 35.0 41.0 14-15 38.664874999999995 40.0 37.5 41.0 35.5 41.0 16-17 38.42075 40.0 37.0 41.0 35.0 41.0 18-19 38.320875 40.0 36.5 41.0 35.0 41.0 20-21 38.12725 40.0 35.5 41.0 34.5 41.0 22-23 37.967875 40.0 35.5 41.0 34.5 41.0 24-25 37.959 40.0 35.0 41.0 34.0 41.0 26-27 37.848875 40.0 35.0 41.0 33.5 41.0 28-29 37.595875 39.0 35.0 41.0 33.0 41.0 30-31 37.79900477707007 39.5 35.0 41.0 33.0 41.0 32-33 37.8176959063026 40.0 35.0 41.0 33.0 41.0 34-35 37.792851052520845 40.0 35.5 41.0 33.0 41.0 36-37 37.61858179356548 39.5 35.0 41.0 33.0 41.0 38-39 37.471970828464634 39.0 35.0 41.0 33.0 41.0 40-41 37.39719751921855 39.0 35.0 41.0 33.0 41.0 42-43 37.28800626588932 39.0 35.0 41.0 33.0 41.0 44-45 37.05990788453289 38.5 35.0 40.5 32.0 41.0 46-47 36.91922880455627 38.0 35.0 40.0 32.0 41.0 48-49 36.88995809801336 38.0 35.0 40.0 32.0 41.0 50-51 36.34569370251718 37.5 34.5 39.5 31.0 40.5 52-53 36.5303257587389 38.0 35.0 40.0 31.5 41.0 54-55 36.785403025918015 38.0 35.0 40.0 32.0 41.0 56-57 36.50113574894519 38.0 35.0 40.0 31.5 41.0 58-59 36.533643492447 37.5 35.0 40.0 31.5 41.0 60-61 36.27138625529209 37.0 35.0 40.0 31.5 41.0 62-63 36.009236582544965 36.0 34.5 40.0 31.0 41.0 64-65 35.88887531631097 36.0 34.5 39.5 31.0 41.0 66-67 35.662325098165425 35.5 34.0 39.0 31.0 41.0 68-69 35.47377116919948 35.0 34.0 39.0 31.0 41.0 70-71 35.10786079305806 35.0 34.0 38.0 31.0 40.0 72-73 34.94556907626209 35.0 34.0 37.0 31.0 39.5 74-75 34.55569466319041 35.0 34.0 37.0 30.0 39.0 76-77 34.27278580810342 35.0 34.0 36.0 30.0 39.0 78-79 34.0518609422727 35.0 33.0 36.0 30.0 37.5 80-81 33.96839839753576 35.0 33.0 36.0 30.0 37.0 82-83 33.79414248822319 35.0 33.5 35.0 29.5 37.0 84-85 33.44454102787464 35.0 33.0 35.0 29.0 36.0 86-87 33.254894272382856 35.0 33.0 35.0 29.0 36.0 88-89 32.96366591982855 35.0 33.0 35.0 28.5 36.0 90-91 33.05678078032166 35.0 33.0 35.0 29.0 35.5 92-93 32.83842879406065 35.0 32.5 35.0 28.5 35.0 94-95 32.969911443508025 35.0 33.0 35.0 29.0 35.0 96-97 32.98562259342917 35.0 33.0 35.0 29.0 35.0 98-99 33.025773350194235 34.5 33.0 35.0 29.0 35.0 100-101 32.83428507423671 34.0 32.0 35.0 28.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 6.0 23 10.0 24 5.0 25 21.0 26 22.0 27 38.0 28 42.0 29 49.0 30 64.0 31 77.0 32 124.0 33 158.0 34 241.0 35 538.0 36 674.0 37 1100.0 38 741.0 39 86.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 15.875 45.975 15.5 22.650000000000002 2 20.65 22.475 19.6 37.275000000000006 3 16.6 29.95 33.375 20.075000000000003 4 17.474999999999998 22.8 40.325 19.400000000000002 5 26.0 23.474999999999998 32.625 17.9 6 25.924999999999997 21.25 33.324999999999996 19.5 7 25.974999999999998 22.6 33.2 18.224999999999998 8 19.825 23.9 37.05 19.225 9 20.349999999999998 22.975 36.3 20.375 10-11 20.352544068008502 23.72796599574947 35.741967745968246 20.177522190273784 12-13 20.525 23.625 34.8375 21.0125 14-15 20.375 24.349999999999998 34.150000000000006 21.125 16-17 20.3375 24.3 34.5875 20.775 18-19 20.4125 24.75 34.0125 20.825 20-21 20.8875 23.9125 35.475 19.725 22-23 20.3875 24.075 34.375 21.1625 24-25 20.9125 23.8375 34.9625 20.2875 26-27 20.0625 23.8375 35.362500000000004 20.7375 28-29 19.8125 23.849999999999998 35.85 20.4875 30-31 20.403785488958988 24.277602523659304 34.72555205047318 20.593059936908517 32-33 20.92534174553102 25.0 32.29495268138801 21.779705573080967 34-35 22.92847503373819 25.398110661268557 30.026990553306344 21.64642375168691 36-37 21.92192192192192 26.276276276276278 29.38847938847939 22.413322413322415 38-39 22.199341021416803 26.043382756727073 29.530477759472817 22.226798462383307 40-41 21.50626462894121 25.815778603882695 29.657166460140438 23.02079030703566 42-43 22.30971128608924 25.99806603121978 28.760878574388727 22.931344108302252 44-45 22.640986559512264 26.340584730497437 28.322017458777886 22.696411251212414 46-47 22.6635189557006 26.468546035272876 28.690459658380778 22.177475350645743 48-49 21.865400726054173 27.0594805920134 27.93912314995811 23.13599553197431 50-51 22.780193575536543 27.07252069013887 28.783840650862675 21.363445083461915 52-53 23.295374666104316 26.1493040911008 28.173766343315055 22.381554899479823 54-55 22.54196642685851 26.661024121878967 27.62025673578784 23.17675271547468 56-57 22.40622788393489 26.072186836518046 29.455060155697097 22.066525123849964 58-59 22.3327177155846 26.367381730359423 28.75408438698679 22.545816167069184 60-61 22.445776255707763 26.384132420091323 28.82420091324201 22.345890410958905 62-63 22.81456004585841 27.472055030094584 27.414732014903986 22.298652909143023 64-65 22.51474607970076 27.36296935692706 27.90965328729679 22.212631276075385 66-67 23.013579890205143 27.101993643455646 27.07310026004045 22.81132620629876 68-69 22.46734397677794 27.039187227866474 27.793904208998548 22.69956458635704 70-71 23.12062937062937 27.17074592074592 27.680652680652678 22.02797202797203 72-73 22.94169352475828 27.922648696161733 26.135364781716962 23.000292997363022 74-75 23.026025584472873 27.39303043670048 27.34891927657697 22.23202470224967 76-77 23.20556459967441 27.393813822702384 26.96462927334616 22.435992304277047 78-79 23.070890840652446 28.152446675031367 25.548933500627353 23.227728983688834 80-81 22.718962938341367 28.967924214724945 24.513877347515372 23.799235499418316 82-83 23.663994655978623 28.2064128256513 25.818303273213093 22.31128924515698 84-85 23.568910525432266 27.144535840188016 25.130099043142522 24.1564545912372 86-87 22.62971100219706 28.663173905695455 25.992901808348822 22.71421328375866 88-89 23.837902264600714 27.890345649582837 25.251149327430618 23.020602758385834 90-91 23.407178430362354 28.335909325090157 24.351708741198692 23.90520350334879 92-93 23.56002775850104 28.74739764052741 25.520471894517694 22.172102706453853 94-95 23.15548512061983 27.980278217996123 25.145272054939248 23.718964606444796 96-97 23.422134811371357 28.660826032540676 25.210084033613445 22.706955122474522 98-99 23.70964800291811 29.71001276673354 23.91026810140434 22.67007112894401 100-101 22.521994134897362 29.130009775171068 24.04692082111437 24.301075268817204 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 77.0 1 171.0 2 337.0 3 385.0 4 318.0 5 141.0 6 5.5 7 3.5 8 3.5 9 3.0 10 2.5 11 1.5 12 1.5 13 3.5 14 3.5 15 4.5 16 4.0 17 2.5 18 2.0 19 3.0 20 4.0 21 4.0 22 4.5 23 6.5 24 6.5 25 7.0 26 12.5 27 13.5 28 11.0 29 12.5 30 18.5 31 24.0 32 29.5 33 32.0 34 34.0 35 46.0 36 59.5 37 70.0 38 83.5 39 96.5 40 124.5 41 155.0 42 150.5 43 145.5 44 153.0 45 152.5 46 156.0 47 163.0 48 146.5 49 131.5 50 128.0 51 109.0 52 95.5 53 96.5 54 93.5 55 74.0 56 67.0 57 62.0 58 57.5 59 61.0 60 52.5 61 50.0 62 49.0 63 42.0 64 41.0 65 41.5 66 47.5 67 53.0 68 42.0 69 37.0 70 34.5 71 28.0 72 25.0 73 18.5 74 17.0 75 16.0 76 12.0 77 10.0 78 9.5 79 7.0 80 4.5 81 4.0 82 3.0 83 2.0 84 2.0 85 2.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0125 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 30-31 159.0 32-33 117.0 34-35 57.0 36-37 24.0 38-39 8.0 40-41 13.0 42-43 11.0 44-45 7.0 46-47 15.0 48-49 21.0 50-51 9.0 52-53 10.0 54-55 14.0 56-57 12.0 58-59 14.0 60-61 18.0 62-63 13.0 64-65 13.0 66-67 16.0 68-69 13.0 70-71 19.0 72-73 13.0 74-75 20.0 76-77 37.0 78-79 335.0 80-81 13.0 82-83 15.0 84-85 19.0 86-87 25.0 88-89 24.0 90-91 24.0 92-93 42.0 94-95 41.0 96-97 53.0 98-99 78.0 100-101 2678.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70279619486884 85.6 2 0.46122801960219084 0.8 3 0.23061400980109542 0.6 4 0.2594407610262323 0.8999999999999999 5 0.08648025367541078 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.11530700490054771 2.5 >50 0.14413375612568463 9.225 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 89 2.225 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 82 2.0500000000000003 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTT 74 1.8499999999999999 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 69 1.725 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 55 1.375 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 42 1.05 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 30 0.75 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 16 0.4 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGGGG 20 2.8003371E-5 84.2125 2 ACTTTTT 60 0.0 70.177086 1 ACATGGG 25 8.467084E-5 67.37 1 CTTTTTT 65 0.0 64.77885 2 >>END_MODULE Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792688 spots for SRR13172448.sra Written 1792688 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra Read 1792679 spots for SRR13172448.sra Written 1792679 spots for SRR13172448.sra SRR ids: ['SRR13172448.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ztwsxdko SRR13172448.sra spots: 35853589 blocks: [[1, 1792679], [1792680, 3585358], [3585359, 5378037], [5378038, 7170716], [7170717, 8963395], [8963396, 10756074], [10756075, 12548753], [12548754, 14341432], [14341433, 16134111], [16134112, 17926790], [17926791, 19719469], [19719470, 21512148], [21512149, 23304827], [23304828, 25097506], [25097507, 26890185], [26890186, 28682864], [28682865, 30475543], [30475544, 32268222], [32268223, 34060901], [34060902, 35853589]] SRR13172448 file size 8016275 SRR13172448 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13172448 SRR13172448_1.fastq SRR13172448_2.fastq Input file: SRR13172448_1.fastq Paired file: SRR13172448_2.fastq trimmed: SRR13172448-trimmed-pair1.fastq, SRR13172448-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:47:09 2024 >> started Fri Dec 6 10:47:55 2024 >> done (45.901s) 35853589 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 24 ( 0.00%) empty read pairs filtered out after trimming by size control 35853564 (100.00%) read pairs available; of these: 1000745 ( 2.79%) trimmed read pairs available after processing 34852819 (97.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 9 0.00% 29 592 0.00% 30 8951 0.02% 31 18211 0.05% 32 22442 0.06% 33 22756 0.06% 34 21486 0.06% 35 19439 0.05% 36 17980 0.05% 37 16948 0.05% 38 16484 0.05% 39 16871 0.05% 40 16690 0.05% 41 16989 0.05% 42 17913 0.05% 43 18643 0.05% 44 20329 0.06% 45 22126 0.06% 46 23855 0.07% 47 25962 0.07% 48 29148 0.08% 49 31799 0.09% 50 35061 0.10% 51 39289 0.11% 52 42846 0.12% 53 47095 0.13% 54 61018 0.17% 55 65394 0.18% 56 67400 0.19% 57 69991 0.20% 58 75583 0.21% 59 81403 0.23% 60 89406 0.25% 61 97129 0.27% 62 115847 0.32% 63 159580 0.45% 64 210440 0.59% 65 1023752 2.86% 66 1703798 4.75% 67 893058 2.49% 68 405710 1.13% 69 272811 0.76% 70 237030 0.66% 71 224280 0.63% 72 213027 0.59% 73 205797 0.57% 74 231364 0.65% 75 191669 0.53% 76 186426 0.52% 77 191877 0.54% 78 234160 0.65% 79 231545 0.65% 80 225342 0.63% 81 209149 0.58% 82 232473 0.65% 83 244939 0.68% 84 255054 0.71% 85 260098 0.73% 86 296502 0.83% 87 327152 0.91% 88 427021 1.19% 89 3180377 8.87% 90 198250 0.55% 91 150682 0.42% 92 137158 0.38% 93 150911 0.42% 94 176024 0.49% 95 215390 0.60% 96 270630 0.75% 97 415563 1.16% 98 1022813 2.85% 99 1319099 3.68% 100 4114044 11.47% 101 13915482 38.81% 35853564 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.44 fanout-score-rank=25 prefix-density=0.20 prefix-fanout=3.0 sequence=AGCTAGCTAGCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=245.46 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=26.0 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=25 prefix-density=0.18 prefix-fanout=2.9 sequence=AGCTAGCTAGCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=13 fanout-score=216.97 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=26.1 sequence=AAGAAGAAGAAA SRR13172448 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:48:52 Started mapping on | Dec 06 10:48:52 Finished on | Dec 06 10:56:01 Mapping speed, Million of reads per hour | 300.87 Number of input reads | 35853564 Average input read length | 180 UNIQUE READS: Uniquely mapped reads number | 27154337 Uniquely mapped reads % | 75.74% Average mapped length | 182.67 Number of splices: Total | 12683725 Number of splices: Annotated (sjdb) | 11867555 Number of splices: GT/AG | 12388632 Number of splices: GC/AG | 158350 Number of splices: AT/AC | 9444 Number of splices: Non-canonical | 127299 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.01% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2001261 % of reads mapped to multiple loci | 5.58% Number of reads mapped to too many loci | 151549 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.04% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 9875600 9875600 9875600 N_multimapping 2001261 2001261 2001261 N_noFeature 828143 14475983 12969387 N_ambiguous 652507 56881 66538 UnstrandedReadsAssigned:25673687 PositiveStrandReadsAssigned:12621473 NegativeStrandReadsAssigned:14118412 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=97 echo kmer=93 SRR13172448 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13172448-trimmed-pair1.fastq SRR13172448-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,853,564 reads, 29,985,630 reads pseudoaligned [quant] estimated average fragment length: 168.408 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR13172448.ke.tsv 35125 SRR13172448.se.tsv 88098 total ==> SRR13172448.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 768.751 0 0 PNS24247 1044 876.592 45.198 2.39231 PNS24249 1928 1760.59 150.923 3.97734 PNS24246 1044 876.592 45.198 2.39231 PNS24248 1044 876.592 45.198 2.39231 PNS24244 1471 1303.59 327.483 11.6558 PNS24243 293 131.484 3 1.05863 KQK14069 1603 1435.59 869.915 28.1152 KQK14071 474 308.157 0 0 ==> SRR13172448.se.tsv <== BRADI_1g14170v3 1127 BRADI_1g53295v3 34 BRADI_1g59795v3 340 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 1038 BRADI_1g74790v3 118 BRADI_1g09890v3 0 BRADI_1g77505v3 403 BRADI_1g48960v3 0 SRR13172448 completed mapping pipeline successfully