Starting /dee2/code/volunteer_pipeline.sh SRR13172454 current disk space = 1551281754112 free memory = 1597008232 SRR13172454 SRAfilesize 19c2403d051b0dbdc478824e516aae80 SRR13172454.sra SRR13172454.sra file validated SRR13172454 is paired end SRR13172454 is conventional basespace SRR13172454 read1 length is 30-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13172454_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 30-101 %GC 38 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 34.15725 34.0 33.0 34.0 31.0 40.0 2 34.4855 34.0 34.0 34.0 31.0 41.0 3 34.51975 34.0 34.0 34.0 31.0 41.0 4 37.19525 37.0 37.0 37.0 35.0 41.0 5 37.1105 37.0 37.0 37.0 35.0 41.0 6 37.04025 37.0 37.0 37.0 35.0 41.0 7 37.17475 37.0 37.0 37.0 35.0 41.0 8 37.189 37.0 37.0 37.0 35.0 41.0 9 38.6485 39.0 39.0 39.0 37.0 41.0 10-11 38.640875 39.0 39.0 39.0 37.0 41.0 12-13 38.569874999999996 39.0 39.0 39.0 37.0 41.0 14-15 39.115624999999994 40.0 38.0 41.0 36.5 41.0 16-17 38.732 40.0 37.0 41.0 35.0 41.0 18-19 38.61025 40.0 36.0 41.0 35.0 41.0 20-21 38.40375 40.0 35.0 41.0 35.0 41.0 22-23 38.351124999999996 40.0 35.0 41.0 35.0 41.0 24-25 38.23075 40.0 35.0 41.0 35.0 41.0 26-27 38.283875 40.0 35.0 41.0 35.0 41.0 28-29 38.230125 40.0 35.0 41.0 35.0 41.0 30-31 37.97849136502677 40.0 35.0 41.0 34.0 41.0 32-33 37.973052571861345 40.0 35.0 41.0 33.0 41.0 34-35 38.0664906638894 40.0 36.0 41.0 34.0 41.0 36-37 38.11656324792812 40.0 36.0 41.0 34.0 41.0 38-39 38.07956085636934 40.0 35.0 41.0 34.0 41.0 40-41 38.05699261894564 40.0 35.0 41.0 34.0 41.0 42-43 37.8123864110431 40.0 35.0 41.0 33.5 41.0 44-45 37.81838422816948 39.5 35.0 41.0 33.5 41.0 46-47 37.724154453213075 39.5 35.0 41.0 33.5 41.0 48-49 37.49616942673627 39.0 35.0 41.0 33.0 41.0 50-51 37.5319760193153 39.0 35.0 41.0 33.0 41.0 52-53 37.55056541248783 39.0 35.0 41.0 33.0 41.0 54-55 37.45494750068276 39.0 35.0 41.0 33.0 41.0 56-57 37.37043421821657 39.0 35.0 41.0 33.0 41.0 58-59 37.11269073548824 38.0 35.0 40.0 33.0 41.0 60-61 37.02384367785686 38.0 35.0 40.0 33.0 41.0 62-63 36.70802372738447 37.0 35.0 40.0 33.0 41.0 64-65 36.43920236643764 37.0 35.0 40.0 32.5 41.0 66-67 36.10301571143454 36.0 35.0 39.0 32.0 41.0 68-69 35.63206625202808 35.5 34.5 39.0 31.0 40.5 70-71 35.41729510028506 35.0 34.0 38.5 31.0 40.0 72-73 35.088410039957076 35.0 34.0 37.0 31.0 39.5 74-75 34.76098832125635 35.0 34.0 37.0 31.0 39.0 76-77 34.03880528143939 34.5 32.5 36.0 30.0 39.0 78-79 34.65801326612945 35.0 34.0 36.0 31.0 39.0 80-81 34.545787218548455 35.0 34.0 36.0 31.0 37.5 82-83 34.32783811541432 35.0 34.0 35.5 31.0 37.0 84-85 34.118153671098334 35.0 34.0 35.0 31.0 36.5 86-87 33.82056993367148 35.0 34.0 35.0 31.0 36.0 88-89 33.65753806909157 35.0 33.5 35.0 30.5 36.0 90-91 33.863546773133876 35.0 34.0 35.0 31.0 36.0 92-93 33.686449625137364 35.0 34.0 35.0 31.0 35.5 94-95 33.66657549662099 35.0 34.0 35.0 31.0 35.0 96-97 33.72895655004653 35.0 34.0 35.0 31.0 35.0 98-99 33.80611149788354 35.0 34.0 35.0 31.0 35.0 100-101 33.17615313469081 34.5 32.5 35.0 29.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 3.0 23 0.0 24 3.0 25 10.0 26 10.0 27 12.0 28 20.0 29 30.0 30 43.0 31 56.0 32 72.0 33 110.0 34 236.0 35 527.0 36 635.0 37 1183.0 38 934.0 39 113.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 14.475 45.824999999999996 19.425 20.275000000000002 2 18.525 25.85 23.5 32.125 3 16.650000000000002 27.224999999999998 39.925 16.2 4 16.75 24.4 40.6 18.25 5 19.362929520943066 24.404314020566844 39.678956608979185 16.553799849510913 6 16.775000000000002 23.849999999999998 40.925 18.45 7 18.625 24.099999999999998 38.35 18.925 8 16.900000000000002 25.275 41.425 16.400000000000002 9 17.175 24.925 40.025 17.875 10-11 17.8125 25.074999999999996 39.85 17.2625 12-13 17.4375 25.124999999999996 39.825 17.6125 14-15 17.2125 25.0625 39.675 18.05 16-17 18.1875 25.5375 39.137499999999996 17.1375 18-19 17.6375 24.575 39.4125 18.375 20-21 17.7 25.162499999999998 38.737500000000004 18.4 22-23 17.974999999999998 24.575 39.1125 18.337500000000002 24-25 17.95 24.25 39.324999999999996 18.475 26-27 17.1125 25.4 39.225 18.2625 28-29 18.05 25.3 38.6125 18.0375 30-31 18.69241448946106 25.07888426101224 38.407169001640796 17.8215322478859 32-33 18.858200079291663 26.76093564160169 36.315580811417995 18.065283467688648 34-35 20.5661151374265 28.127991248461644 32.10720634486531 19.19868726924655 36-37 19.0410199556541 28.57538802660754 33.32871396895787 19.054878048780488 38-39 19.24791086350975 27.77158774373259 32.95264623955432 20.02785515320334 40-41 20.687727145652783 27.998322616717918 31.325132792843164 19.988817444786132 42-43 20.21873247335951 29.248457655636567 31.618059450364555 18.914750420639372 44-45 19.460067491563553 29.51349831271091 31.48200224971879 19.54443194600675 46-47 19.61060948081264 29.232505643340858 31.630925507900677 19.525959367945823 48-49 19.51875442321302 29.709837225760793 31.3517338995046 19.419674451521583 50-51 19.347054648687013 29.822569198012776 31.611071682044 19.21930447125621 52-53 19.99714937286203 29.57525655644242 30.458950969213227 19.968643101482325 54-55 20.085836909871244 30.51502145922747 29.656652360515025 19.742489270386265 56-57 19.05446184796666 30.708435119988504 30.809024285098435 19.4280787469464 58-59 19.541059315918602 31.303218357627365 30.37956415067109 18.776158175782943 60-61 19.506889050036257 30.935460478607684 29.60116026105874 19.956490210297318 62-63 18.974807048201544 32.15377894276977 29.45973496432212 19.411679044706567 64-65 19.499707431246343 31.93387946167349 28.993563487419543 19.57284961966062 66-67 19.506100249889755 31.589004850801118 29.972071145083053 18.932823754226078 68-69 18.664105216491798 31.8752770799468 30.56007093246638 18.90054677109502 70-71 20.115795724465556 31.146080760095014 29.112232779097386 19.62589073634204 72-73 19.498357718722005 32.63660794266946 28.530904747685877 19.334129590922664 74-75 19.414414414414413 32.732732732732735 28.303303303303302 19.54954954954955 76-77 19.831223628691983 32.15792646172393 28.661844484629295 19.349005424954793 78-79 19.968725566849102 33.729476153244725 26.411258795934323 19.890539483971853 80-81 20.61453422207771 34.69354576491627 24.174930905543814 20.5169891074622 82-83 20.743287491814012 35.216110019646365 23.935821872953504 20.104780615586115 84-85 19.91420557663752 35.91816531925425 23.626464279821814 20.54116482428642 86-87 20.29201924672308 35.22482163597146 24.788451966152316 19.694707151153143 88-89 20.29106724657076 34.69387755102041 24.60689193710271 20.408163265306122 90-91 20.51455653351388 33.750846310088015 25.355450236966824 20.379146919431278 92-93 20.198562136254708 34.49161246148579 24.37521396781924 20.93461143444026 94-95 20.607111882046834 35.160450997398094 23.746747614917606 20.485689505637467 96-97 20.26143790849673 34.76417594064653 23.617735382441264 21.356650768415474 98-99 20.499461013295004 34.387351778656125 23.715415019762844 21.39777218828602 100-101 20.279192605168834 34.18222976796831 24.97641954348236 20.562158083380496 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 164.0 1 289.5 2 459.5 3 472.5 4 383.0 5 164.0 6 3.5 7 4.0 8 5.5 9 7.0 10 4.0 11 3.0 12 4.5 13 6.0 14 5.0 15 3.5 16 5.5 17 6.0 18 4.5 19 4.5 20 11.0 21 15.5 22 14.0 23 15.0 24 17.5 25 21.0 26 22.5 27 19.5 28 23.0 29 26.0 30 26.5 31 31.5 32 41.5 33 44.0 34 52.5 35 74.0 36 89.5 37 94.5 38 98.0 39 107.5 40 116.0 41 133.0 42 134.5 43 129.0 44 138.5 45 125.0 46 109.5 47 121.5 48 121.5 49 106.0 50 101.0 51 102.0 52 97.0 53 75.5 54 56.0 55 52.0 56 54.0 57 51.5 58 45.0 59 42.5 60 33.5 61 29.5 62 29.0 63 27.5 64 24.5 65 24.5 66 27.5 67 22.5 68 22.0 69 22.5 70 16.5 71 10.0 72 9.0 73 7.5 74 6.0 75 6.5 76 5.5 77 4.0 78 4.0 79 3.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 1.5 97 1.5 98 1.5 99 5.0 100 8.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.325 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 30-31 173.0 32-33 148.0 34-35 65.0 36-37 20.0 38-39 14.0 40-41 13.0 42-43 8.0 44-45 11.0 46-47 13.0 48-49 8.0 50-51 17.0 52-53 12.0 54-55 15.0 56-57 15.0 58-59 15.0 60-61 16.0 62-63 15.0 64-65 15.0 66-67 18.0 68-69 18.0 70-71 18.0 72-73 17.0 74-75 16.0 76-77 27.0 78-79 210.0 80-81 22.0 82-83 25.0 84-85 18.0 86-87 23.0 88-89 34.0 90-91 33.0 92-93 33.0 94-95 47.0 96-97 56.0 98-99 51.0 100-101 2741.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 79.4 #Duplication Level Percentage of deduplicated Percentage of total 1 98.14231738035264 77.925 2 0.4408060453400504 0.7000000000000001 3 0.4093198992443325 0.975 4 0.28337531486146095 0.8999999999999999 5 0.2204030226700252 0.8750000000000001 6 0.09445843828715365 0.44999999999999996 7 0.09445843828715365 0.525 8 0.031486146095717885 0.2 9 0.0 0.0 >10 0.09445843828715365 1.7999999999999998 >50 0.12594458438287154 7.95 >100 0.06297229219143577 7.7 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 184 4.6 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 124 3.1 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 95 2.375 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 87 2.175 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTT 75 1.875 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 61 1.525 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 44 1.0999999999999999 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 16 0.4 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 8 0.2 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit ACACGTCTGAACTCCAGTCACCCGTCCCGATCTCGTATGCCGTCTTCTGCTTGAAAAAA 6 0.15 TruSeq Adapter, Index 16 (96% over 28bp) ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTTT 45 0.0 88.07693 2 ACTTTTT 50 0.0 79.26923 1 >>END_MODULE SRR13172454 read2 length is 30-101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13172454_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 30-101 %GC 37 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.062 34.0 31.0 40.0 31.0 41.0 2 35.31225 34.0 33.0 40.0 31.0 41.0 3 35.08975 34.0 33.0 40.0 31.0 41.0 4 37.56975 37.0 37.0 40.0 35.0 41.0 5 37.439 37.0 37.0 40.0 35.0 41.0 6 37.5595 37.0 37.0 41.0 35.0 41.0 7 37.469 37.0 37.0 41.0 35.0 41.0 8 37.2015 37.0 37.0 40.0 35.0 41.0 9 38.275 39.0 38.0 40.0 35.0 41.0 10-11 38.42425 39.0 38.0 40.0 35.5 41.0 12-13 38.44225 39.0 38.5 40.0 35.5 41.0 14-15 38.428124999999994 39.5 37.0 41.0 35.5 41.0 16-17 37.8605 39.5 35.0 41.0 35.0 41.0 18-19 37.790499999999994 39.5 35.0 41.0 35.0 41.0 20-21 37.67275 39.0 35.0 41.0 35.0 41.0 22-23 37.573625 39.0 35.0 40.5 34.5 41.0 24-25 37.362625 39.0 35.0 41.0 34.0 41.0 26-27 37.38849999999999 39.0 35.0 41.0 34.0 41.0 28-29 37.104625 38.0 35.0 41.0 33.0 41.0 30-31 37.067090433772265 38.5 35.0 40.5 33.0 41.0 32-33 37.383438722518406 39.0 35.0 41.0 33.0 41.0 34-35 37.50710382513661 39.0 35.0 41.0 33.0 41.0 36-37 37.37948562387241 39.0 35.0 41.0 33.0 41.0 38-39 37.01254440246842 38.5 35.0 40.5 32.5 41.0 40-41 37.00639656825062 38.0 35.0 40.0 33.0 41.0 42-43 37.1226444732379 38.0 35.0 40.0 33.0 41.0 44-45 36.86188165896256 38.0 35.0 40.0 33.0 41.0 46-47 36.757283243110415 38.0 35.0 40.0 33.0 41.0 48-49 36.631057642570795 37.5 35.0 40.0 32.0 41.0 50-51 36.346640248623245 37.5 35.0 39.5 32.5 40.5 52-53 36.520770864377326 37.5 35.0 39.5 32.5 40.5 54-55 36.842014446849184 37.0 35.0 40.0 33.0 41.0 56-57 36.90792939402341 37.0 35.0 40.0 33.0 41.0 58-59 36.59810058590419 37.0 35.0 40.0 33.0 41.0 60-61 36.22592954133748 36.0 35.0 40.0 32.0 41.0 62-63 36.1140310603641 35.5 35.0 40.0 32.0 41.0 64-65 36.014481198222114 35.0 35.0 39.5 32.0 41.0 66-67 35.54174266318158 35.0 34.5 39.0 31.0 41.0 68-69 35.414353542513986 35.0 34.0 39.0 31.0 40.0 70-71 35.04125813714552 35.0 34.0 37.5 30.5 40.0 72-73 35.06302688305052 35.0 34.0 37.0 31.0 39.5 74-75 34.89273706600796 35.0 34.0 37.0 31.0 39.0 76-77 34.56011466651361 35.0 34.0 36.0 31.0 39.0 78-79 34.440058325921434 35.0 34.0 36.0 30.5 38.5 80-81 34.40172102678444 35.0 34.0 36.0 31.0 37.5 82-83 33.84687617254147 35.0 33.5 35.5 30.0 37.0 84-85 33.869017037252384 35.0 34.0 35.0 30.0 37.0 86-87 33.77668901784993 35.0 34.0 35.0 30.5 36.0 88-89 33.79865173128646 35.0 34.0 35.0 31.0 36.0 90-91 33.429206963609815 35.0 33.0 35.0 30.0 36.0 92-93 33.411333848150775 35.0 33.0 35.0 30.0 35.0 94-95 33.22903675970048 35.0 33.0 35.0 29.0 35.0 96-97 33.38229270502764 35.0 33.0 35.0 30.0 35.0 98-99 33.45775515393038 35.0 33.0 35.0 30.0 35.0 100-101 33.015908291284354 34.5 32.0 35.0 28.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 5.0 23 10.0 24 12.0 25 13.0 26 12.0 27 19.0 28 30.0 29 47.0 30 42.0 31 63.0 32 91.0 33 120.0 34 237.0 35 569.0 36 764.0 37 1255.0 38 644.0 39 64.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 11.55 58.15 14.725 15.575 2 14.099999999999998 21.925 18.575 45.4 3 12.950000000000001 32.875 40.325 13.850000000000001 4 14.124999999999998 19.75 52.300000000000004 13.825000000000001 5 26.75 20.525 39.85 12.875 6 27.925 19.475 39.4 13.200000000000001 7 26.875 19.8 40.2 13.125 8 19.225 21.7 44.125 14.95 9 18.45 22.75 43.55 15.25 10-11 17.6625 22.3375 42.9625 17.0375 12-13 16.525000000000002 23.3125 43.6625 16.5 14-15 18.1625 22.5 42.975 16.3625 16-17 17.5125 23.2625 42.85 16.375 18-19 17.2375 22.8875 43.3375 16.537499999999998 20-21 16.875 23.125 43.762499999999996 16.2375 22-23 17.849999999999998 22.35 42.8 17.0 24-25 17.712500000000002 22.912499999999998 42.95 16.425 26-27 18.512500000000003 22.625 42.625 16.2375 28-29 18.175 22.112499999999997 43.1875 16.525000000000002 30-31 17.591769338244635 23.523434523053474 43.16016766162835 15.724628477073544 32-33 19.3246541903987 24.233794412801736 38.33740168158394 18.104149715215623 34-35 19.709277469003847 27.34786945988314 34.71569046601112 18.227162605101896 36-37 20.891405342624854 26.713124274099886 33.07200929152149 19.323461091753774 38-39 21.093407396579448 25.990352287677236 34.161672270135945 18.754568045607368 40-41 19.577030400939933 27.507710383316198 34.351593479218685 18.563665736525188 42-43 19.811042220253913 28.210806023029228 33.30380868024801 18.67434307646885 44-45 19.934737466627116 28.181548501928212 32.20112726194008 19.6825867695046 46-47 20.476900149031295 28.56929955290611 32.35469448584203 18.599105812220568 48-49 19.448606532813905 28.993107581660173 32.30446508840276 19.253820797123165 50-51 20.48920428808697 27.691378529367356 32.100256681262266 19.719160501283405 52-53 19.905789393709163 27.95927670566783 32.88254064731804 19.25239325330497 54-55 19.62131623148572 28.55397770652008 32.60039700717667 19.224309054817528 56-57 20.150168556543058 28.363469200122587 32.59270609868219 18.89365614465216 58-59 20.744844567559248 28.793474915358573 31.779008925823334 18.68267159125885 60-61 19.71005552128316 28.51634793337446 32.341147439851945 19.432449105490438 62-63 19.90396530359356 29.0272614622057 32.372986369268894 18.695786864931847 64-65 20.44569113292816 28.549166277076516 31.136044880785413 19.869097709209914 66-67 19.996863237139273 29.485570890840652 31.82245922208281 18.695106649937266 68-69 20.13560391043835 29.596341847997476 30.85777357300536 19.410280668558812 70-71 20.098194488438388 29.66423820082357 30.978777320240734 19.25878999049731 72-73 19.99681579366343 29.75640821525235 30.17035503900653 20.076420952077694 74-75 19.8202535708554 31.182795698924732 30.524795377948966 18.472155352270903 76-77 20.501618122977348 30.24271844660194 29.708737864077673 19.54692556634304 78-79 20.647995606809445 31.484532308255535 28.244554274208312 19.622917810726705 80-81 21.063607924921794 34.786235662148066 24.48383733055266 19.666319082377477 82-83 20.761464030290284 33.129995793016406 25.999158603281447 20.109381573411863 84-85 21.53585783795219 33.805796488258935 24.455257034059656 20.203088639729216 86-87 19.868113167411188 34.43948096149755 26.01574133163157 19.67666453945969 88-89 20.496894409937887 34.525594345684304 24.28785607196402 20.689655172413794 90-91 20.090634441087612 35.02373759171342 24.773413897280967 20.112214069917997 92-93 20.135548753825976 34.36816790555313 24.42063839090512 21.075644949715784 94-95 20.507166482910694 34.37706725468578 24.52039691289967 20.59536934950386 96-97 20.313549832026876 33.72900335946248 25.800671892497203 20.156774916013436 98-99 20.20501138952164 34.829157175398635 23.75854214123007 21.20728929384966 100-101 21.46621945376138 34.97843794920939 23.239099185433638 20.316243411595593 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 138.0 1 315.0 2 589.0 3 644.0 4 529.0 5 230.0 6 4.5 7 5.5 8 5.5 9 4.5 10 2.5 11 1.0 12 3.0 13 4.5 14 5.0 15 5.0 16 4.0 17 4.0 18 5.0 19 7.0 20 10.5 21 13.0 22 14.0 23 11.5 24 8.5 25 11.5 26 14.0 27 13.0 28 17.5 29 26.0 30 23.0 31 23.5 32 34.0 33 43.0 34 54.5 35 61.0 36 63.0 37 80.0 38 103.5 39 110.5 40 113.5 41 120.5 42 128.5 43 138.5 44 137.5 45 139.0 46 138.5 47 131.0 48 122.0 49 108.0 50 110.5 51 100.0 52 87.0 53 78.0 54 64.0 55 59.0 56 53.5 57 53.0 58 50.5 59 44.0 60 42.5 61 38.0 62 34.5 63 35.5 64 29.0 65 23.0 66 20.0 67 22.5 68 22.5 69 19.0 70 16.0 71 12.5 72 10.5 73 7.0 74 4.5 75 5.5 76 6.5 77 6.0 78 3.0 79 1.0 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.5 94 2.0 95 1.0 96 0.0 97 0.0 98 0.5 99 4.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 30-31 259.0 32-33 201.0 34-35 89.0 36-37 26.0 38-39 15.0 40-41 18.0 42-43 18.0 44-45 15.0 46-47 15.0 48-49 26.0 50-51 24.0 52-53 16.0 54-55 10.0 56-57 16.0 58-59 8.0 60-61 12.0 62-63 19.0 64-65 18.0 66-67 21.0 68-69 14.0 70-71 15.0 72-73 22.0 74-75 25.0 76-77 59.0 78-79 635.0 80-81 24.0 82-83 12.0 84-85 14.0 86-87 16.0 88-89 18.0 90-91 27.0 92-93 18.0 94-95 27.0 96-97 43.0 98-99 54.0 100-101 2151.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 74.9 #Duplication Level Percentage of deduplicated Percentage of total 1 97.9973297730307 73.4 2 0.5674232309746329 0.8500000000000001 3 0.30040053404539385 0.675 4 0.20026702269692925 0.6 5 0.26702269692923897 1.0 6 0.20026702269692925 0.8999999999999999 7 0.10013351134846463 0.525 8 0.0 0.0 9 0.03337783711615487 0.22499999999999998 >10 0.10013351134846463 1.2 >50 0.06675567423230974 3.8249999999999997 >100 0.16688918558077437 16.8 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 204 5.1 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 129 3.225 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTT 125 3.125 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 108 2.7 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 106 2.65 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 92 2.3 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 61 1.525 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 24 0.6 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 13 0.325 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 11 0.27499999999999997 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 9 0.22499999999999998 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit ACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGGGT 20 4.4952605E-5 76.55 3 CTTTTTT 95 0.0 76.55 2 ACATGGG 55 0.0 76.549995 1 ACTTTTT 90 0.0 76.549995 1 CATGGGG 45 1.8189894E-12 76.549995 2 >>END_MODULE Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188644 spots for SRR13172454.sra Written 1188644 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra Read 1188626 spots for SRR13172454.sra Written 1188626 spots for SRR13172454.sra SRR ids: ['SRR13172454.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_51drjtpd SRR13172454.sra spots: 23772538 blocks: [[1, 1188626], [1188627, 2377252], [2377253, 3565878], [3565879, 4754504], [4754505, 5943130], [5943131, 7131756], [7131757, 8320382], [8320383, 9509008], [9509009, 10697634], [10697635, 11886260], [11886261, 13074886], [13074887, 14263512], [14263513, 15452138], [15452139, 16640764], [16640765, 17829390], [17829391, 19018016], [19018017, 20206642], [20206643, 21395268], [21395269, 22583894], [22583895, 23772538]] SRR13172454 file size 5100654 SRR13172454 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13172454 SRR13172454_1.fastq SRR13172454_2.fastq Input file: SRR13172454_1.fastq Paired file: SRR13172454_2.fastq trimmed: SRR13172454-trimmed-pair1.fastq, SRR13172454-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 10:53:35 2024 >> started Fri Dec 6 10:54:00 2024 >> done (25.037s) 23772538 read pairs processed; of these: 8 ( 0.00%) short read pairs filtered out after trimming by size control 103 ( 0.00%) empty read pairs filtered out after trimming by size control 23772427 (100.00%) read pairs available; of these: 1072848 ( 4.51%) trimmed read pairs available after processing 22699579 (95.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 2 0.00% 23 4 0.00% 24 0 0.00% 25 4 0.00% 26 6 0.00% 27 3 0.00% 28 19 0.00% 29 316 0.00% 30 2286 0.01% 31 4823 0.02% 32 6210 0.03% 33 7106 0.03% 34 7869 0.03% 35 8296 0.03% 36 9338 0.04% 37 10169 0.04% 38 11435 0.05% 39 12485 0.05% 40 13676 0.06% 41 14823 0.06% 42 16481 0.07% 43 17651 0.07% 44 19761 0.08% 45 22010 0.09% 46 24627 0.10% 47 27464 0.12% 48 30889 0.13% 49 35046 0.15% 50 39260 0.17% 51 46438 0.20% 52 52244 0.22% 53 59179 0.25% 54 80126 0.34% 55 83366 0.35% 56 77844 0.33% 57 80183 0.34% 58 87084 0.37% 59 94636 0.40% 60 103286 0.43% 61 112448 0.47% 62 133800 0.56% 63 178156 0.75% 64 241506 1.02% 65 1119163 4.71% 66 1812627 7.62% 67 951277 4.00% 68 381613 1.61% 69 227724 0.96% 70 190621 0.80% 71 182189 0.77% 72 174788 0.74% 73 168690 0.71% 74 173606 0.73% 75 164317 0.69% 76 162486 0.68% 77 173232 0.73% 78 228036 0.96% 79 219672 0.92% 80 208709 0.88% 81 196138 0.83% 82 224119 0.94% 83 237648 1.00% 84 249541 1.05% 85 254923 1.07% 86 305004 1.28% 87 335360 1.41% 88 511356 2.15% 89 4203803 17.68% 90 176492 0.74% 91 67683 0.28% 92 62049 0.26% 93 67052 0.28% 94 76952 0.32% 95 92164 0.39% 96 115143 0.48% 97 176295 0.74% 98 425478 1.79% 99 554415 2.33% 100 1715474 7.22% 101 5414229 22.78% 23772427 reads passed initial QC criterion=sequence-density sequence-density=0.05 sequence-density-rank=1 fanout-score=11.49 fanout-score-rank=17 prefix-density=0.10 prefix-fanout=6.3 sequence=AGCTAGCTAGCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=303.78 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.7 sequence=CAGCAGCAGGATACATGGAAGGAAGACAATAGATAAAGATTCCAGAGCCAGACGGATGACACAGACGGACCCCTATGGCCCGAAGCCCAACCTAAACCCAGATCTCATCAGACTCACTCACACAGACACGATAGCGACACGCGAGACTCGGATCTTATTTTGTTTAACGACACGACGACGAC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=49 prefix-density=0.00 prefix-fanout=1.0 sequence=GTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=36 fanout-score=201.60 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=20.3 sequence=AAGAAGAAGAAA SRR13172454 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 10:54:53 Started mapping on | Dec 06 10:54:53 Finished on | Dec 06 11:03:57 Mapping speed, Million of reads per hour | 157.32 Number of input reads | 23772427 Average input read length | 170 UNIQUE READS: Uniquely mapped reads number | 15024899 Uniquely mapped reads % | 63.20% Average mapped length | 169.87 Number of splices: Total | 5185003 Number of splices: Annotated (sjdb) | 4702303 Number of splices: GT/AG | 5048550 Number of splices: GC/AG | 68198 Number of splices: AT/AC | 4607 Number of splices: Non-canonical | 63648 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1495049 % of reads mapped to multiple loci | 6.29% Number of reads mapped to too many loci | 84016 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 29.75% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 10455607 10455607 10455607 N_multimapping 1495049 1495049 1495049 N_noFeature 657336 8591899 6727516 N_ambiguous 423544 29275 35109 UnstrandedReadsAssigned:13944019 PositiveStrandReadsAssigned:6403725 NegativeStrandReadsAssigned:8262274 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=78 echo kmer=73 SRR13172454 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13172454-trimmed-pair1.fastq SRR13172454-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,772,427 reads, 18,747,428 reads pseudoaligned [quant] estimated average fragment length: 157.241 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52973 SRR13172454.ke.tsv 35125 SRR13172454.se.tsv 88098 total ==> SRR13172454.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 779.887 0 0 PNS24247 1044 887.759 0 0 PNS24249 1928 1771.76 143.447 6.44025 PNS24246 1044 887.759 0 0 PNS24248 1044 887.759 0 0 PNS24244 1471 1314.76 549.553 33.2492 PNS24243 293 141.088 5 2.81902 KQK14069 1603 1446.76 0 0 KQK14071 474 319 0 0 ==> SRR13172454.se.tsv <== BRADI_1g14170v3 0 BRADI_1g53295v3 26 BRADI_1g59795v3 813 BRADI_1g07683v3 0 BRADI_1g00485v3 190 BRADI_1g20270v3 482 BRADI_1g74790v3 0 BRADI_1g09890v3 0 BRADI_1g77505v3 259 BRADI_1g48960v3 0 SRR13172454 completed mapping pipeline successfully