Starting /dee2/code/volunteer_pipeline.sh SRR13292038 current disk space = 1516112543744 free memory = 1607758444 SRR13292038 SRAfilesize a468367061b7fb3b7da65c6d8aa67a06 SRR13292038.sra SRR13292038.sra file validated SRR13292038 is paired end SRR13292038 is conventional basespace SRR13292038 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13292038_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7425 37.0 37.0 37.0 37.0 37.0 2 35.80325 37.0 37.0 37.0 37.0 37.0 3 36.1205 37.0 37.0 37.0 37.0 37.0 4 36.253 37.0 37.0 37.0 37.0 37.0 5 36.288 37.0 37.0 37.0 37.0 37.0 6 36.287 37.0 37.0 37.0 37.0 37.0 7 36.306 37.0 37.0 37.0 37.0 37.0 8 36.4425 37.0 37.0 37.0 37.0 37.0 9 36.4125 37.0 37.0 37.0 37.0 37.0 10-14 36.349399999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.3528 37.0 37.0 37.0 37.0 37.0 20-24 36.284 37.0 37.0 37.0 37.0 37.0 25-29 36.1338 37.0 37.0 37.0 37.0 37.0 30-34 36.2841 37.0 37.0 37.0 37.0 37.0 35-39 36.2441 37.0 37.0 37.0 37.0 37.0 40-44 36.1806 37.0 37.0 37.0 37.0 37.0 45-49 36.0459 37.0 37.0 37.0 37.0 37.0 50-54 36.138600000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1104 37.0 37.0 37.0 37.0 37.0 60-64 36.0532 37.0 37.0 37.0 37.0 37.0 65-69 35.791 37.0 37.0 37.0 37.0 37.0 70-74 35.998200000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.0374 37.0 37.0 37.0 37.0 37.0 80-84 35.6167 37.0 37.0 37.0 34.6 37.0 85-89 35.9241 37.0 37.0 37.0 37.0 37.0 90-94 35.7637 37.0 37.0 37.0 37.0 37.0 95-99 35.7055 37.0 37.0 37.0 34.6 37.0 100-104 35.924699999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.8251 37.0 37.0 37.0 37.0 37.0 110-114 35.839 37.0 37.0 37.0 37.0 37.0 115-119 35.8093 37.0 37.0 37.0 37.0 37.0 120-124 35.7322 37.0 37.0 37.0 37.0 37.0 125-129 35.6239 37.0 37.0 37.0 37.0 37.0 130-134 35.5604 37.0 37.0 37.0 37.0 37.0 135-139 35.5044 37.0 37.0 37.0 34.6 37.0 140-144 35.5082 37.0 37.0 37.0 37.0 37.0 145-149 35.118100000000005 37.0 37.0 37.0 34.6 37.0 150-151 35.006 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 5.0 24 3.0 25 7.0 26 8.0 27 16.0 28 22.0 29 32.0 30 47.0 31 53.0 32 88.0 33 132.0 34 181.0 35 436.0 36 2653.0 37 316.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.525 9.175 8.5 46.800000000000004 2 24.654782827014813 13.78358021591765 31.78508661812704 29.7765503389405 3 23.849999999999998 15.2 22.25 38.7 4 27.075 22.625 19.7 30.599999999999998 5 28.199999999999996 28.325 20.825 22.650000000000002 6 25.674999999999997 30.85 22.625 20.849999999999998 7 18.925 23.425 36.475 21.175 8 22.075 24.0 28.575 25.35 9 21.0 20.875 32.85 25.275 10-14 23.315 25.915 25.040000000000003 25.729999999999997 15-19 23.625 24.94 24.825 26.61 20-24 23.474999999999998 24.715 25.165 26.645000000000003 25-29 24.404999999999998 24.65 24.495 26.450000000000003 30-34 23.825 24.81 24.77 26.595000000000002 35-39 24.535 24.57 24.67 26.224999999999998 40-44 24.07 24.435000000000002 24.755 26.740000000000002 45-49 24.615000000000002 24.515 24.04 26.83 50-54 23.785 24.765 24.705 26.745 55-59 24.240000000000002 24.72 24.555 26.484999999999996 60-64 24.490000000000002 24.965 24.05 26.495 65-69 25.019999999999996 24.685000000000002 24.04 26.255 70-74 24.795 24.135 24.55 26.52 75-79 24.38 24.555 24.54 26.525 80-84 24.52 24.97 23.855 26.655 85-89 24.75 24.605 24.195 26.450000000000003 90-94 25.215 24.0 24.884999999999998 25.900000000000002 95-99 25.1 24.205 24.565 26.13 100-104 24.52 24.58 24.154999999999998 26.745 105-109 25.085 24.345 23.78 26.790000000000003 110-114 24.815 24.990000000000002 24.2 25.995 115-119 25.650000000000002 24.33 23.71 26.31 120-124 24.575 24.42 23.965 27.04 125-129 24.86 24.959999999999997 24.055 26.125 130-134 25.419999999999998 24.759999999999998 23.75 26.07 135-139 24.9 25.095 23.87 26.135 140-144 25.05 24.255 24.075 26.619999999999997 145-149 25.629999999999995 24.575 22.770000000000003 27.025 150-151 25.2625 24.425 23.7875 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.5 29 1.5 30 2.5 31 6.0 32 8.0 33 11.0 34 22.5 35 32.5 36 43.0 37 55.5 38 66.5 39 79.5 40 101.5 41 130.0 42 163.0 43 177.0 44 175.0 45 184.5 46 176.0 47 171.5 48 170.0 49 172.0 50 169.0 51 151.5 52 142.5 53 128.0 54 110.0 55 98.5 56 86.5 57 81.0 58 84.5 59 85.5 60 83.5 61 83.0 62 83.0 63 73.0 64 65.5 65 63.0 66 70.5 67 64.5 68 49.0 69 48.0 70 35.0 71 26.5 72 29.5 73 29.0 74 26.0 75 19.5 76 21.0 77 15.0 78 6.5 79 8.5 80 6.5 81 2.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.175 #Duplication Level Percentage of deduplicated Percentage of total 1 92.35150528885274 85.125 2 6.91619202603743 12.75 3 0.6238133984269053 1.725 4 0.10848928668294007 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.9625 0.0 0.0 0.0 0.0 122-123 2.1625 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.5375 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.2874999999999996 0.0 0.0 0.0 0.0 132-133 3.6875 0.0 0.0 0.0 0.0 134-135 4.050000000000001 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13292038 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13292038_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.68 37.0 37.0 37.0 37.0 37.0 2 35.936 37.0 37.0 37.0 37.0 37.0 3 36.111 37.0 37.0 37.0 37.0 37.0 4 36.0445 37.0 37.0 37.0 37.0 37.0 5 35.915 37.0 37.0 37.0 37.0 37.0 6 34.553 37.0 37.0 37.0 25.0 37.0 7 36.262 37.0 37.0 37.0 37.0 37.0 8 36.37 37.0 37.0 37.0 37.0 37.0 9 36.152 37.0 37.0 37.0 37.0 37.0 10-14 36.049099999999996 37.0 37.0 37.0 34.6 37.0 15-19 35.5372 37.0 37.0 37.0 32.2 37.0 20-24 36.1141 37.0 37.0 37.0 37.0 37.0 25-29 35.8615 37.0 37.0 37.0 37.0 37.0 30-34 35.9209 37.0 37.0 37.0 34.6 37.0 35-39 35.9822 37.0 37.0 37.0 37.0 37.0 40-44 36.1176 37.0 37.0 37.0 37.0 37.0 45-49 35.8376 37.0 37.0 37.0 37.0 37.0 50-54 35.998400000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.011 37.0 37.0 37.0 37.0 37.0 60-64 35.9996 37.0 37.0 37.0 37.0 37.0 65-69 36.008700000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.829899999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.9035 37.0 37.0 37.0 37.0 37.0 80-84 35.629599999999996 37.0 37.0 37.0 34.6 37.0 85-89 34.8541 37.0 37.0 37.0 27.4 37.0 90-94 35.86579999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.7806 37.0 37.0 37.0 37.0 37.0 100-104 35.8005 37.0 37.0 37.0 37.0 37.0 105-109 35.580400000000004 37.0 37.0 37.0 34.6 37.0 110-114 35.7218 37.0 37.0 37.0 37.0 37.0 115-119 35.5851 37.0 37.0 37.0 37.0 37.0 120-124 35.5928 37.0 37.0 37.0 37.0 37.0 125-129 35.5772 37.0 37.0 37.0 37.0 37.0 130-134 35.301700000000004 37.0 37.0 37.0 32.2 37.0 135-139 35.3574 37.0 37.0 37.0 34.6 37.0 140-144 35.379 37.0 37.0 37.0 34.6 37.0 145-149 35.31269999999999 37.0 37.0 37.0 37.0 37.0 150-151 34.847750000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 7.0 23 8.0 24 7.0 25 10.0 26 14.0 27 21.0 28 16.0 29 20.0 30 25.0 31 44.0 32 81.0 33 147.0 34 256.0 35 679.0 36 2438.0 37 222.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.75 14.549999999999999 11.924999999999999 37.775 2 29.799999999999997 20.45 28.299999999999997 21.45 3 22.675 24.65 25.324999999999996 27.35 4 26.450000000000003 29.075 19.25 25.224999999999998 5 28.075 29.95 20.200000000000003 21.775 6 22.400000000000002 35.55 18.8 23.25 7 23.325000000000003 17.75 33.15 25.775 8 22.650000000000002 22.275 23.474999999999998 31.6 9 22.625 21.25 26.775 29.349999999999998 10-14 25.495 24.58 22.375 27.55 15-19 25.6 24.235 23.56 26.605 20-24 26.369999999999997 24.035 23.119999999999997 26.474999999999998 25-29 25.445 24.545 23.419999999999998 26.590000000000003 30-34 26.009999999999998 24.3 23.02 26.669999999999998 35-39 26.424999999999997 24.305 23.51 25.759999999999998 40-44 26.11 24.13 23.415 26.345000000000002 45-49 26.384999999999998 23.93 24.205 25.480000000000004 50-54 26.575 24.45 23.93 25.045 55-59 26.479999999999997 24.3 23.62 25.6 60-64 26.745 23.765 23.585 25.905 65-69 26.515 24.195 23.65 25.64 70-74 26.77 24.12 23.685000000000002 25.424999999999997 75-79 26.939999999999998 24.305 23.385 25.369999999999997 80-84 26.69 24.685000000000002 23.27 25.355 85-89 27.345000000000002 24.52 22.925 25.21 90-94 26.895000000000003 24.3 23.705000000000002 25.1 95-99 27.77 23.835 23.505000000000003 24.89 100-104 27.29 24.085 23.345 25.28 105-109 26.665 23.66 23.94 25.735000000000003 110-114 26.965 23.995 23.919999999999998 25.119999999999997 115-119 27.265 24.115000000000002 23.03 25.590000000000003 120-124 27.355 24.055 23.905 24.685000000000002 125-129 27.37 24.445 23.119999999999997 25.064999999999998 130-134 27.33 24.295 23.265 25.11 135-139 27.165 24.52 23.965 24.349999999999998 140-144 27.615000000000002 24.755 23.215 24.415 145-149 27.575 24.224999999999998 23.555 24.645 150-151 27.85 24.099999999999998 23.150000000000002 24.9 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 2.5 29 5.5 30 4.5 31 5.5 32 8.5 33 10.5 34 18.0 35 24.0 36 30.0 37 45.5 38 60.5 39 80.5 40 108.0 41 126.0 42 127.5 43 142.0 44 160.0 45 155.5 46 165.0 47 176.0 48 157.5 49 134.5 50 129.5 51 125.0 52 134.5 53 132.0 54 114.5 55 110.5 56 106.5 57 100.5 58 89.5 59 93.0 60 99.0 61 94.0 62 83.5 63 75.5 64 81.5 65 89.5 66 80.5 67 75.0 68 68.0 69 59.0 70 62.5 71 57.5 72 46.5 73 40.0 74 33.0 75 19.5 76 11.5 77 12.0 78 10.0 79 4.0 80 4.5 81 4.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.35 #Duplication Level Percentage of deduplicated Percentage of total 1 93.57257632565613 87.35000000000001 2 5.811462238885913 10.85 3 0.5356186395286556 1.5 4 0.08034279592929834 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5375 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.9875 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.6875 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138-139 4.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATATT 10 0.006830828 145.0 4 >>END_MODULE Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248677 spots for SRR13292038.sra Written 248677 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra Read 248668 spots for SRR13292038.sra Written 248668 spots for SRR13292038.sra SRR ids: ['SRR13292038.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9plr57dz SRR13292038.sra spots: 4973369 blocks: [[1, 248668], [248669, 497336], [497337, 746004], [746005, 994672], [994673, 1243340], [1243341, 1492008], [1492009, 1740676], [1740677, 1989344], [1989345, 2238012], [2238013, 2486680], [2486681, 2735348], [2735349, 2984016], [2984017, 3232684], [3232685, 3481352], [3481353, 3730020], [3730021, 3978688], [3978689, 4227356], [4227357, 4476024], [4476025, 4724692], [4724693, 4973369]] SRR13292038 file size 1678285 SRR13292038 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13292038 SRR13292038_1.fastq SRR13292038_2.fastq Input file: SRR13292038_1.fastq Paired file: SRR13292038_2.fastq trimmed: SRR13292038-trimmed-pair1.fastq, SRR13292038-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:10:09 2024 >> started Thu Dec 12 02:10:15 2024 >> done (6.128s) 4973369 read pairs processed; of these: 12 ( 0.00%) short read pairs filtered out after trimming by size control 390 ( 0.01%) empty read pairs filtered out after trimming by size control 4972967 (99.99%) read pairs available; of these: 391712 ( 7.88%) trimmed read pairs available after processing 4581255 (92.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 3 0.00% 27 3 0.00% 28 2 0.00% 29 2 0.00% 30 3 0.00% 31 3 0.00% 32 5 0.00% 33 6 0.00% 34 2 0.00% 35 4 0.00% 36 4 0.00% 37 4 0.00% 38 6 0.00% 39 5 0.00% 40 6 0.00% 41 7 0.00% 42 4 0.00% 43 4 0.00% 44 6 0.00% 45 4 0.00% 46 10 0.00% 47 4 0.00% 48 9 0.00% 49 9 0.00% 50 9 0.00% 51 11 0.00% 52 14 0.00% 53 9 0.00% 54 12 0.00% 55 12 0.00% 56 12 0.00% 57 21 0.00% 58 20 0.00% 59 13 0.00% 60 19 0.00% 61 28 0.00% 62 39 0.00% 63 33 0.00% 64 40 0.00% 65 40 0.00% 66 37 0.00% 67 35 0.00% 68 52 0.00% 69 48 0.00% 70 64 0.00% 71 43 0.00% 72 70 0.00% 73 82 0.00% 74 76 0.00% 75 89 0.00% 76 114 0.00% 77 142 0.00% 78 137 0.00% 79 156 0.00% 80 190 0.00% 81 195 0.00% 82 199 0.00% 83 233 0.00% 84 267 0.01% 85 310 0.01% 86 296 0.01% 87 394 0.01% 88 427 0.01% 89 464 0.01% 90 499 0.01% 91 570 0.01% 92 639 0.01% 93 702 0.01% 94 787 0.02% 95 929 0.02% 96 988 0.02% 97 1085 0.02% 98 1210 0.02% 99 1257 0.03% 100 1435 0.03% 101 1531 0.03% 102 1653 0.03% 103 1787 0.04% 104 2055 0.04% 105 2165 0.04% 106 2361 0.05% 107 2545 0.05% 108 2722 0.05% 109 2963 0.06% 110 3173 0.06% 111 3347 0.07% 112 3702 0.07% 113 3871 0.08% 114 4154 0.08% 115 4419 0.09% 116 4646 0.09% 117 4953 0.10% 118 5196 0.10% 119 5568 0.11% 120 5565 0.11% 121 5903 0.12% 122 6299 0.13% 123 6709 0.13% 124 6963 0.14% 125 7234 0.15% 126 7469 0.15% 127 7893 0.16% 128 8322 0.17% 129 8346 0.17% 130 8637 0.17% 131 8880 0.18% 132 9175 0.18% 133 9785 0.20% 134 9753 0.20% 135 10159 0.20% 136 10318 0.21% 137 10876 0.22% 138 11016 0.22% 139 11351 0.23% 140 11566 0.23% 141 12036 0.24% 142 12325 0.25% 143 12704 0.26% 144 12538 0.25% 145 12964 0.26% 146 13348 0.27% 147 13614 0.27% 148 14194 0.29% 149 14061 0.28% 150 14224 0.29% 151 4581255 92.12% 4972967 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.35 fanout-score-rank=31 prefix-density=0.22 prefix-fanout=3.6 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=1148.03 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=29.5 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=35 prefix-density=0.31 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=406.68 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=21.3 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR13292038 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:10:56 Started mapping on | Dec 12 02:10:56 Finished on | Dec 12 02:11:45 Mapping speed, Million of reads per hour | 365.36 Number of input reads | 4972967 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 4774629 Uniquely mapped reads % | 96.01% Average mapped length | 298.10 Number of splices: Total | 4858497 Number of splices: Annotated (sjdb) | 4553364 Number of splices: GT/AG | 4794508 Number of splices: GC/AG | 55661 Number of splices: AT/AC | 3437 Number of splices: Non-canonical | 4891 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.70 Insertion rate per base | 0.00% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 51486 % of reads mapped to multiple loci | 1.04% Number of reads mapped to too many loci | 4536 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.33% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 146852 146852 146852 N_multimapping 51486 51486 51486 N_noFeature 136869 4664464 174762 N_ambiguous 83069 639 10867 UnstrandedReadsAssigned:4554691 PositiveStrandReadsAssigned:109526 NegativeStrandReadsAssigned:4589000 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR13292038 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13292038-trimmed-pair1.fastq SRR13292038-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,972,967 reads, 4,651,897 reads pseudoaligned [quant] estimated average fragment length: 277.773 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR13292038.ke.tsv 35125 SRR13292038.se.tsv 88098 total ==> SRR13292038.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.984 0 0 PNS24247 1044 767.227 25.2028 10.4522 PNS24249 1928 1651.23 47.4869 9.15062 PNS24246 1044 767.227 25.2028 10.4522 PNS24248 1044 767.227 25.2028 10.4522 PNS24244 1471 1194.23 20.9048 5.56983 PNS24243 293 88.8047 0 0 KQK14069 1603 1326.23 2072.09 497.136 KQK14071 474 223.897 30.4126 43.2205 ==> SRR13292038.se.tsv <== BRADI_1g14170v3 2243 BRADI_1g53295v3 18 BRADI_1g59795v3 52 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 283 BRADI_1g74790v3 24 BRADI_1g09890v3 0 BRADI_1g77505v3 34 BRADI_1g48960v3 0 SRR13292038 completed mapping pipeline successfully