Starting /dee2/code/volunteer_pipeline.sh SRR13292039 current disk space = 1516105830400 free memory = 1607723920 SRR13292039 SRAfilesize 5209a48e7f5d197ee0faef62577227a8 SRR13292039.sra SRR13292039.sra file validated SRR13292039 is paired end SRR13292039 is conventional basespace SRR13292039 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13292039_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.647 37.0 37.0 37.0 37.0 37.0 2 35.6915 37.0 37.0 37.0 37.0 37.0 3 35.9875 37.0 37.0 37.0 37.0 37.0 4 36.0855 37.0 37.0 37.0 37.0 37.0 5 36.223 37.0 37.0 37.0 37.0 37.0 6 36.327 37.0 37.0 37.0 37.0 37.0 7 36.28 37.0 37.0 37.0 37.0 37.0 8 36.321 37.0 37.0 37.0 37.0 37.0 9 36.4505 37.0 37.0 37.0 37.0 37.0 10-14 36.373599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2936 37.0 37.0 37.0 37.0 37.0 20-24 36.259699999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.1255 37.0 37.0 37.0 37.0 37.0 30-34 36.182100000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.132600000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1448 37.0 37.0 37.0 37.0 37.0 45-49 35.9584 37.0 37.0 37.0 37.0 37.0 50-54 36.1048 37.0 37.0 37.0 37.0 37.0 55-59 36.044399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.053399999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.82359999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.9868 37.0 37.0 37.0 37.0 37.0 75-79 35.94840000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.5884 37.0 37.0 37.0 34.6 37.0 85-89 35.9323 37.0 37.0 37.0 37.0 37.0 90-94 35.864399999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7387 37.0 37.0 37.0 34.6 37.0 100-104 35.910199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.845 37.0 37.0 37.0 37.0 37.0 110-114 35.8185 37.0 37.0 37.0 37.0 37.0 115-119 35.848 37.0 37.0 37.0 37.0 37.0 120-124 35.7418 37.0 37.0 37.0 37.0 37.0 125-129 35.6258 37.0 37.0 37.0 37.0 37.0 130-134 35.5191 37.0 37.0 37.0 34.6 37.0 135-139 35.4994 37.0 37.0 37.0 34.6 37.0 140-144 35.4894 37.0 37.0 37.0 37.0 37.0 145-149 35.0182 37.0 37.0 37.0 34.6 37.0 150-151 34.95225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 4.0 25 4.0 26 8.0 27 12.0 28 12.0 29 41.0 30 52.0 31 81.0 32 97.0 33 148.0 34 185.0 35 407.0 36 2649.0 37 299.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.525 9.4 5.925 39.15 2 22.320080523402115 13.059889280322093 36.260694514343236 28.359335681932563 3 20.775 16.55 23.925 38.75 4 26.924999999999997 25.55 20.025000000000002 27.500000000000004 5 26.325 29.549999999999997 23.25 20.875 6 23.799999999999997 32.324999999999996 21.55 22.325 7 18.025 23.925 38.675 19.375 8 19.775000000000002 23.799999999999997 30.15 26.275 9 20.424999999999997 21.725 31.874999999999996 25.974999999999998 10-14 23.035 26.974999999999998 24.775 25.215 15-19 23.255 25.06 25.775 25.91 20-24 23.580000000000002 25.47 25.240000000000002 25.71 25-29 23.485 25.555 25.569999999999997 25.39 30-34 23.474999999999998 25.705 24.95 25.869999999999997 35-39 23.04 25.935000000000002 25.41 25.615 40-44 23.875 24.84 25.25 26.035000000000004 45-49 22.994999999999997 25.629999999999995 25.1 26.275 50-54 23.355 25.025 25.669999999999998 25.95 55-59 23.635 25.205 25.385 25.775 60-64 23.189999999999998 25.385 24.965 26.46 65-69 23.895 25.165 24.68 26.26 70-74 23.365 24.91 25.025 26.700000000000003 75-79 23.91 25.155 24.81 26.125 80-84 23.885 25.025 25.445 25.645 85-89 23.53 24.985 25.47 26.015 90-94 23.865 25.1 25.245 25.790000000000003 95-99 24.07 24.990000000000002 25.355 25.585 100-104 23.965 25.295 25.0 25.740000000000002 105-109 23.735 24.605 25.005 26.655 110-114 23.735 25.135 24.83 26.3 115-119 24.26 25.224999999999998 24.585 25.929999999999996 120-124 23.745 26.025 23.830000000000002 26.400000000000002 125-129 23.995 25.380000000000003 24.97 25.655 130-134 24.759999999999998 25.2 24.385 25.655 135-139 24.740000000000002 24.925 24.705 25.629999999999995 140-144 24.104999999999997 25.34 24.6 25.955000000000002 145-149 24.834999999999997 25.395 24.2 25.569999999999997 150-151 24.675 24.9875 23.7875 26.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 0.5 27 1.0 28 2.0 29 1.5 30 2.0 31 8.0 32 12.5 33 16.0 34 22.0 35 31.5 36 40.0 37 53.5 38 68.5 39 103.0 40 141.5 41 153.0 42 162.5 43 172.5 44 187.0 45 203.5 46 208.5 47 191.5 48 170.5 49 168.0 50 171.0 51 166.0 52 144.5 53 126.0 54 118.0 55 113.5 56 104.5 57 89.5 58 85.0 59 84.0 60 75.5 61 63.5 62 51.0 63 55.5 64 58.5 65 45.0 66 50.5 67 53.0 68 47.0 69 45.0 70 37.5 71 25.0 72 17.5 73 16.0 74 12.0 75 7.5 76 4.5 77 3.0 78 3.5 79 2.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.65 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.52357590624149 83.95 2 7.9585718179340414 14.6 3 0.49059689288634506 1.35 4 0.027255382938130283 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.025 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.15 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.425 0.0 0.0 0.0 0.0 132-133 4.862500000000001 0.0 0.0 0.0 0.0 134-135 5.425000000000001 0.0 0.0 0.0 0.0 136-137 5.887499999999999 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAGCT 10 0.006830828 145.0 1 ATGTTCA 10 0.006830828 145.0 4 ATGTAAT 10 0.006830828 145.0 6 >>END_MODULE SRR13292039 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13292039_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.703 37.0 37.0 37.0 37.0 37.0 2 35.879 37.0 37.0 37.0 37.0 37.0 3 35.9925 37.0 37.0 37.0 37.0 37.0 4 36.042 37.0 37.0 37.0 37.0 37.0 5 35.8525 37.0 37.0 37.0 37.0 37.0 6 34.465 37.0 37.0 37.0 25.0 37.0 7 36.2455 37.0 37.0 37.0 37.0 37.0 8 36.2345 37.0 37.0 37.0 37.0 37.0 9 36.0405 37.0 37.0 37.0 37.0 37.0 10-14 36.0299 37.0 37.0 37.0 34.6 37.0 15-19 35.4177 37.0 37.0 37.0 32.2 37.0 20-24 36.05159999999999 37.0 37.0 37.0 37.0 37.0 25-29 35.7196 37.0 37.0 37.0 37.0 37.0 30-34 35.8617 37.0 37.0 37.0 34.6 37.0 35-39 35.87179999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.012299999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.801 37.0 37.0 37.0 37.0 37.0 50-54 35.938 37.0 37.0 37.0 37.0 37.0 55-59 36.0391 37.0 37.0 37.0 37.0 37.0 60-64 35.954499999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.9248 37.0 37.0 37.0 37.0 37.0 70-74 35.821200000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.8161 37.0 37.0 37.0 37.0 37.0 80-84 35.58669999999999 37.0 37.0 37.0 34.6 37.0 85-89 34.7441 37.0 37.0 37.0 27.4 37.0 90-94 35.771 37.0 37.0 37.0 37.0 37.0 95-99 35.7327 37.0 37.0 37.0 37.0 37.0 100-104 35.6853 37.0 37.0 37.0 37.0 37.0 105-109 35.52719999999999 37.0 37.0 37.0 34.6 37.0 110-114 35.6623 37.0 37.0 37.0 37.0 37.0 115-119 35.4779 37.0 37.0 37.0 37.0 37.0 120-124 35.522000000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.49550000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.2953 37.0 37.0 37.0 32.2 37.0 135-139 35.2962 37.0 37.0 37.0 34.6 37.0 140-144 35.2854 37.0 37.0 37.0 34.6 37.0 145-149 35.293400000000005 37.0 37.0 37.0 32.2 37.0 150-151 34.795500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 2.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 5.0 22 7.0 23 4.0 24 10.0 25 13.0 26 8.0 27 12.0 28 28.0 29 23.0 30 39.0 31 49.0 32 80.0 33 139.0 34 247.0 35 683.0 36 2440.0 37 204.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.5 18.725 8.6 31.175000000000004 2 28.925 23.075000000000003 27.224999999999998 20.775 3 22.35 25.5 28.15 24.0 4 25.95 32.65 19.8 21.6 5 26.424999999999997 33.575 18.875 21.125 6 22.3 34.925 20.075000000000003 22.7 7 21.2 19.950000000000003 33.725 25.124999999999996 8 23.674999999999997 22.025 24.474999999999998 29.825000000000003 9 23.325000000000003 22.675 27.125 26.875 10-14 25.929999999999996 25.465 23.200000000000003 25.405 15-19 25.64 25.14 24.02 25.2 20-24 25.405 25.080000000000002 23.745 25.77 25-29 26.21 25.14 23.72 24.93 30-34 25.85 25.509999999999998 23.82 24.82 35-39 26.145000000000003 24.72 24.015 25.119999999999997 40-44 26.215 25.009999999999998 24.46 24.315 45-49 25.395 25.4 24.05 25.155 50-54 25.995 25.424999999999997 24.21 24.37 55-59 26.200000000000003 25.105 24.21 24.485 60-64 26.21 25.03 24.385 24.375 65-69 25.605 25.695 24.645 24.055 70-74 26.455000000000002 25.430000000000003 24.15 23.965 75-79 26.27 25.185000000000002 24.12 24.425 80-84 26.21 24.91 24.485 24.395 85-89 25.814999999999998 25.915 24.285 23.985 90-94 26.265 25.115 24.335 24.285 95-99 26.939999999999998 24.67 25.09 23.3 100-104 26.845000000000002 24.98 23.799999999999997 24.375 105-109 26.045 24.945 24.55 24.46 110-114 26.735 25.435000000000002 24.44 23.39 115-119 26.950000000000003 25.595000000000002 23.645 23.810000000000002 120-124 26.63 25.435000000000002 24.58 23.355 125-129 26.58 25.740000000000002 24.005000000000003 23.674999999999997 130-134 26.795 25.380000000000003 23.925 23.9 135-139 26.77 25.779999999999998 23.915 23.535 140-144 27.495000000000005 25.695 23.75 23.06 145-149 27.63 25.369999999999997 23.935000000000002 23.064999999999998 150-151 27.9375 25.825 24.212500000000002 22.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 1.0 27 3.0 28 4.5 29 4.0 30 3.5 31 6.0 32 10.0 33 14.5 34 20.0 35 26.0 36 32.0 37 47.5 38 68.5 39 84.5 40 116.0 41 144.0 42 150.5 43 164.0 44 167.5 45 174.5 46 192.5 47 188.0 48 183.5 49 180.5 50 160.5 51 139.5 52 136.0 53 127.5 54 115.5 55 112.5 56 104.5 57 89.5 58 87.0 59 86.0 60 76.5 61 72.0 62 83.5 63 76.5 64 66.5 65 68.0 66 62.5 67 67.0 68 58.0 69 43.0 70 37.0 71 33.5 72 31.0 73 22.0 74 12.5 75 12.5 76 8.5 77 3.5 78 2.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.875 #Duplication Level Percentage of deduplicated Percentage of total 1 93.0013458950202 86.375 2 6.379542395693136 11.85 3 0.5652759084791386 1.575 4 0.053835800807537006 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0125 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.05 0.0 0.025 0.0 0.0 76-77 0.075 0.0 0.025 0.0 0.0 78-79 0.075 0.0 0.025 0.0 0.0 80-81 0.075 0.0 0.025 0.0 0.0 82-83 0.075 0.0 0.025 0.0 0.0 84-85 0.075 0.0 0.025 0.0 0.0 86-87 0.0875 0.0 0.025 0.0 0.0 88-89 0.1625 0.0 0.025 0.0 0.0 90-91 0.3 0.0 0.025 0.0 0.0 92-93 0.3625 0.0 0.025 0.0 0.0 94-95 0.4125 0.0 0.025 0.0 0.0 96-97 0.5125 0.0 0.025 0.0 0.0 98-99 0.5625 0.0 0.025 0.0 0.0 100-101 0.6375 0.0 0.025 0.0 0.0 102-103 0.6875 0.0 0.025 0.0 0.0 104-105 0.825 0.0 0.025 0.0 0.0 106-107 0.9375 0.0 0.025 0.0 0.0 108-109 1.05 0.0 0.025 0.0 0.0 110-111 1.3125 0.0 0.025 0.0 0.0 112-113 1.5 0.0 0.025 0.0 0.0 114-115 1.6375 0.0 0.025 0.0 0.0 116-117 2.05 0.0 0.025 0.0 0.0 118-119 2.2875 0.0 0.025 0.0 0.0 120-121 2.5875 0.0 0.025 0.0 0.0 122-123 2.9125 0.0 0.025 0.0 0.0 124-125 3.175 0.0 0.025 0.0 0.0 126-127 3.625 0.0 0.025 0.0 0.0 128-129 4.075 0.0 0.025 0.0 0.0 130-131 4.4375 0.0 0.025 0.0 0.0 132-133 4.887499999999999 0.0 0.025 0.0 0.0 134-135 5.475 0.0 0.025 0.0 0.0 136-137 5.95 0.0 0.025 0.0 0.0 138-139 6.575 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTCAC 10 0.006830828 145.0 2 GACCTCA 10 0.006830828 145.0 1 ATTCAAG 10 0.006830828 145.0 145 >>END_MODULE Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280317 spots for SRR13292039.sra Written 280317 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra Read 280303 spots for SRR13292039.sra Written 280303 spots for SRR13292039.sra SRR ids: ['SRR13292039.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xsbx2vog SRR13292039.sra spots: 5606074 blocks: [[1, 280303], [280304, 560606], [560607, 840909], [840910, 1121212], [1121213, 1401515], [1401516, 1681818], [1681819, 1962121], [1962122, 2242424], [2242425, 2522727], [2522728, 2803030], [2803031, 3083333], [3083334, 3363636], [3363637, 3643939], [3643940, 3924242], [3924243, 4204545], [4204546, 4484848], [4484849, 4765151], [4765152, 5045454], [5045455, 5325757], [5325758, 5606074]] SRR13292039 file size 1892070 SRR13292039 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13292039 SRR13292039_1.fastq SRR13292039_2.fastq Input file: SRR13292039_1.fastq Paired file: SRR13292039_2.fastq trimmed: SRR13292039-trimmed-pair1.fastq, SRR13292039-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:10:05 2024 >> started Thu Dec 12 02:10:11 2024 >> done (5.905s) 5606074 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 425 ( 0.01%) empty read pairs filtered out after trimming by size control 5605639 (99.99%) read pairs available; of these: 549686 ( 9.81%) trimmed read pairs available after processing 5055953 (90.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 2 0.00% 25 0 0.00% 26 4 0.00% 27 1 0.00% 28 3 0.00% 29 0 0.00% 30 1 0.00% 31 5 0.00% 32 2 0.00% 33 4 0.00% 34 1 0.00% 35 3 0.00% 36 4 0.00% 37 5 0.00% 38 1 0.00% 39 6 0.00% 40 2 0.00% 41 13 0.00% 42 7 0.00% 43 7 0.00% 44 1 0.00% 45 9 0.00% 46 10 0.00% 47 5 0.00% 48 13 0.00% 49 14 0.00% 50 10 0.00% 51 14 0.00% 52 19 0.00% 53 15 0.00% 54 13 0.00% 55 23 0.00% 56 22 0.00% 57 16 0.00% 58 16 0.00% 59 18 0.00% 60 36 0.00% 61 40 0.00% 62 50 0.00% 63 49 0.00% 64 39 0.00% 65 46 0.00% 66 54 0.00% 67 53 0.00% 68 96 0.00% 69 78 0.00% 70 87 0.00% 71 110 0.00% 72 132 0.00% 73 127 0.00% 74 172 0.00% 75 168 0.00% 76 218 0.00% 77 203 0.00% 78 255 0.00% 79 262 0.00% 80 292 0.01% 81 328 0.01% 82 394 0.01% 83 423 0.01% 84 513 0.01% 85 575 0.01% 86 601 0.01% 87 674 0.01% 88 713 0.01% 89 858 0.02% 90 846 0.02% 91 971 0.02% 92 1162 0.02% 93 1179 0.02% 94 1384 0.02% 95 1604 0.03% 96 1640 0.03% 97 1960 0.03% 98 1976 0.04% 99 2180 0.04% 100 2413 0.04% 101 2485 0.04% 102 2756 0.05% 103 3032 0.05% 104 3319 0.06% 105 3614 0.06% 106 3851 0.07% 107 4131 0.07% 108 4511 0.08% 109 4809 0.09% 110 4892 0.09% 111 5115 0.09% 112 5455 0.10% 113 5676 0.10% 114 6296 0.11% 115 6776 0.12% 116 7078 0.13% 117 7318 0.13% 118 7684 0.14% 119 7912 0.14% 120 8341 0.15% 121 8721 0.16% 122 8901 0.16% 123 9480 0.17% 124 9758 0.17% 125 10336 0.18% 126 10699 0.19% 127 10864 0.19% 128 11362 0.20% 129 11704 0.21% 130 12154 0.22% 131 12391 0.22% 132 12705 0.23% 133 13143 0.23% 134 13544 0.24% 135 13878 0.25% 136 14290 0.25% 137 14657 0.26% 138 15023 0.27% 139 15637 0.28% 140 15842 0.28% 141 15931 0.28% 142 16146 0.29% 143 16579 0.30% 144 16920 0.30% 145 17528 0.31% 146 17486 0.31% 147 18034 0.32% 148 18450 0.33% 149 18554 0.33% 150 18665 0.33% 151 5055953 90.19% 5605639 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.17 fanout-score-rank=27 prefix-density=0.25 prefix-fanout=3.4 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=1185.07 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=29.2 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=36 prefix-density=0.38 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=399.50 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=20.8 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR13292039 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:10:50 Started mapping on | Dec 12 02:10:50 Finished on | Dec 12 02:11:23 Mapping speed, Million of reads per hour | 611.52 Number of input reads | 5605639 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 5330597 Uniquely mapped reads % | 95.09% Average mapped length | 297.05 Number of splices: Total | 5572008 Number of splices: Annotated (sjdb) | 5242893 Number of splices: GT/AG | 5498061 Number of splices: GC/AG | 64590 Number of splices: AT/AC | 4072 Number of splices: Non-canonical | 5285 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.51 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 63146 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 12507 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.25% % of reads unmapped: other | 1.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 211896 211896 211896 N_multimapping 63146 63146 63146 N_noFeature 166573 5201516 206708 N_ambiguous 102157 668 13501 UnstrandedReadsAssigned:5061867 PositiveStrandReadsAssigned:128413 NegativeStrandReadsAssigned:5110388 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR13292039 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13292039-trimmed-pair1.fastq SRR13292039-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,605,639 reads, 5,195,767 reads pseudoaligned [quant] estimated average fragment length: 262.626 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52973 SRR13292039.ke.tsv 35125 SRR13292039.se.tsv 88098 total ==> SRR13292039.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 674.95 7.55572 3.19809 PNS24247 1044 782.374 23.3228 8.51636 PNS24249 1928 1666.37 45.3874 7.78126 PNS24246 1044 782.374 23.3228 8.51636 PNS24248 1044 782.374 23.3228 8.51636 PNS24244 1471 1209.37 37.0884 8.76122 PNS24243 293 93.3133 0 0 KQK14069 1603 1341.37 1845.89 393.136 KQK14071 474 233.213 32.9362 40.3467 ==> SRR13292039.se.tsv <== BRADI_1g14170v3 2024 BRADI_1g53295v3 25 BRADI_1g59795v3 128 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 314 BRADI_1g74790v3 17 BRADI_1g09890v3 0 BRADI_1g77505v3 45 BRADI_1g48960v3 0 SRR13292039 completed mapping pipeline successfully