Starting /dee2/code/volunteer_pipeline.sh SRR13292040 current disk space = 1543236202496 free memory = 1479114352 SRR13292040 SRAfilesize 82d1cdec28510de756ee48eb4dc52bc8 SRR13292040.sra SRR13292040.sra file validated SRR13292040 is paired end SRR13292040 is conventional basespace SRR13292040 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13292040_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2775 37.0 37.0 37.0 37.0 37.0 2 36.06825 37.0 37.0 37.0 37.0 37.0 3 36.254 37.0 37.0 37.0 37.0 37.0 4 36.5535 37.0 37.0 37.0 37.0 37.0 5 36.3535 37.0 37.0 37.0 37.0 37.0 6 36.468 37.0 37.0 37.0 37.0 37.0 7 36.311 37.0 37.0 37.0 37.0 37.0 8 36.4595 37.0 37.0 37.0 37.0 37.0 9 36.4925 37.0 37.0 37.0 37.0 37.0 10-14 36.455499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.4354 37.0 37.0 37.0 37.0 37.0 20-24 36.4439 37.0 37.0 37.0 37.0 37.0 25-29 36.35699999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.3346 37.0 37.0 37.0 37.0 37.0 35-39 36.3237 37.0 37.0 37.0 37.0 37.0 40-44 36.241600000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.2882 37.0 37.0 37.0 37.0 37.0 50-54 36.1887 37.0 37.0 37.0 37.0 37.0 55-59 36.25750000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.21810000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2251 37.0 37.0 37.0 37.0 37.0 70-74 36.1782 37.0 37.0 37.0 37.0 37.0 75-79 36.0978 37.0 37.0 37.0 37.0 37.0 80-84 36.11710000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.0832 37.0 37.0 37.0 37.0 37.0 90-94 36.01525 37.0 37.0 37.0 37.0 37.0 95-99 36.029199999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.0521 37.0 37.0 37.0 37.0 37.0 105-109 35.971799999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.97795000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.881099999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.91265 37.0 37.0 37.0 37.0 37.0 125-129 35.85125000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.80625 37.0 37.0 37.0 37.0 37.0 135-139 35.69975000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.6242 37.0 37.0 37.0 37.0 37.0 145-149 35.62365 37.0 37.0 37.0 37.0 37.0 150-151 35.10125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 4.0 26 5.0 27 15.0 28 19.0 29 22.0 30 38.0 31 54.0 32 74.0 33 116.0 34 169.0 35 310.0 36 2687.0 37 483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.3 9.4 8.275 45.025 2 22.376038258243142 13.214195821797132 34.58343820790335 29.826327712056383 3 21.7 15.0 23.25 40.050000000000004 4 27.250000000000004 23.95 19.6 29.2 5 25.8 28.199999999999996 23.9 22.1 6 22.8 31.900000000000002 23.674999999999997 21.625 7 18.5 23.875 37.325 20.3 8 21.2 23.75 28.425 26.625 9 20.05 21.425 33.975 24.55 10-14 22.645 25.96 25.259999999999998 26.135 15-19 23.49 24.740000000000002 25.39 26.38 20-24 23.01 25.735000000000003 25.235000000000003 26.02 25-29 23.630000000000003 25.115 25.064999999999998 26.19 30-34 23.575 25.324999999999996 25.005 26.095000000000002 35-39 23.13 25.705 25.545 25.619999999999997 40-44 23.21 25.39 25.105 26.295 45-49 23.425 24.87 24.815 26.889999999999997 50-54 23.265 25.009999999999998 25.095 26.63 55-59 23.78 25.259999999999998 24.785 26.174999999999997 60-64 23.915 24.375 25.869999999999997 25.840000000000003 65-69 24.565 24.88 24.565 25.990000000000002 70-74 24.610000000000003 24.795 24.795 25.8 75-79 24.26 24.795 24.81 26.135 80-84 23.76 24.63 25.345000000000002 26.265 85-89 24.175 24.365000000000002 25.045 26.415 90-94 23.936196809840492 25.061253062653133 24.89624481224061 26.106305315265764 95-99 24.09 23.885 25.615 26.41 100-104 24.295 24.185000000000002 24.759999999999998 26.76 105-109 24.335 24.65 24.67 26.345000000000002 110-114 24.15120756037802 24.65123256162808 24.7962398119906 26.401320066003297 115-119 24.3 24.9 24.925 25.874999999999996 120-124 24.456114028507127 24.58614653663416 24.751187796949235 26.206551637909474 125-129 24.298644796719508 25.288793318997847 24.40866129919488 26.003900585087763 130-134 24.8062403120156 24.901245062253114 24.14620731036552 26.146307315365767 135-139 24.718707806170926 24.498674801220183 24.508676301445217 26.273941091163678 140-144 24.57245724572457 24.597459745974597 25.02250225022502 25.807580758075808 145-149 24.956239059764943 25.316329082270567 23.515878969742435 26.211552888222055 150-151 24.69367341835459 23.943485871467868 25.23130782695674 26.131532883220803 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 1.0 28 2.0 29 3.5 30 7.0 31 10.0 32 12.0 33 13.5 34 22.0 35 29.0 36 36.0 37 57.5 38 68.5 39 101.0 40 117.0 41 129.5 42 158.0 43 177.0 44 192.0 45 196.5 46 213.5 47 198.0 48 177.5 49 174.5 50 163.0 51 151.0 52 141.0 53 132.0 54 111.0 55 100.5 56 99.0 57 79.5 58 75.5 59 81.0 60 76.0 61 68.0 62 57.0 63 60.5 64 66.5 65 62.5 66 57.0 67 50.5 68 50.5 69 43.5 70 36.0 71 30.0 72 20.0 73 17.0 74 19.0 75 16.0 76 9.5 77 7.0 78 6.5 79 5.0 80 3.0 81 1.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.675 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.025 125-129 0.015 130-134 0.005 135-139 0.015 140-144 0.01 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 93.7633262260128 87.94999999999999 2 5.890191897654584 11.05 3 0.31982942430703626 0.8999999999999999 4 0.026652452025586353 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.7625000000000002 0.0 0.0 0.0 0.0 120-121 1.9249999999999998 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.775 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.2750000000000004 0.0 0.0 0.0 0.0 132-133 3.6375 0.0 0.0 0.0 0.0 134-135 4.1875 0.0 0.0 0.0 0.0 136-137 4.55 0.0 0.0 0.0 0.0 138-139 4.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGATG 10 0.006830828 145.0 2 GTCAACT 10 0.006830828 145.0 1 GAGATCG 10 0.006830828 145.0 145 >>END_MODULE SRR13292040 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13292040_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.046 37.0 37.0 37.0 37.0 37.0 2 36.0065 37.0 37.0 37.0 37.0 37.0 3 36.07 37.0 37.0 37.0 37.0 37.0 4 36.074 37.0 37.0 37.0 37.0 37.0 5 36.1825 37.0 37.0 37.0 37.0 37.0 6 36.125 37.0 37.0 37.0 37.0 37.0 7 36.1145 37.0 37.0 37.0 37.0 37.0 8 36.222 37.0 37.0 37.0 37.0 37.0 9 36.1815 37.0 37.0 37.0 37.0 37.0 10-14 36.1922 37.0 37.0 37.0 37.0 37.0 15-19 36.1528 37.0 37.0 37.0 37.0 37.0 20-24 36.129650000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.14300000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.0973 37.0 37.0 37.0 37.0 37.0 35-39 36.073899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.105999999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.0348 37.0 37.0 37.0 37.0 37.0 50-54 36.1125 37.0 37.0 37.0 37.0 37.0 55-59 36.0162 37.0 37.0 37.0 37.0 37.0 60-64 35.925 37.0 37.0 37.0 37.0 37.0 65-69 35.941 37.0 37.0 37.0 37.0 37.0 70-74 35.94029999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.9191 37.0 37.0 37.0 37.0 37.0 80-84 35.929700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.857299999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.7732 37.0 37.0 37.0 37.0 37.0 95-99 35.840999999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.7719 37.0 37.0 37.0 37.0 37.0 105-109 35.7758 37.0 37.0 37.0 37.0 37.0 110-114 35.704699999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.6671 37.0 37.0 37.0 37.0 37.0 120-124 35.6992 37.0 37.0 37.0 37.0 37.0 125-129 35.4889 37.0 37.0 37.0 37.0 37.0 130-134 35.5297 37.0 37.0 37.0 37.0 37.0 135-139 35.5036 37.0 37.0 37.0 37.0 37.0 140-144 35.356899999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.4701 37.0 37.0 37.0 37.0 37.0 150-151 34.58525 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 0.0 16 2.0 17 1.0 18 0.0 19 0.0 20 2.0 21 3.0 22 5.0 23 4.0 24 10.0 25 5.0 26 11.0 27 8.0 28 24.0 29 36.0 30 35.0 31 60.0 32 79.0 33 98.0 34 178.0 35 507.0 36 2590.0 37 339.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.375 14.774999999999999 12.475 36.375 2 27.925 22.35 28.175 21.55 3 21.8 23.549999999999997 27.525 27.125 4 27.325 29.575000000000003 17.825 25.275 5 27.85 30.525000000000002 20.0 21.625 6 24.45 33.85 19.275000000000002 22.425 7 23.7 17.525 34.225 24.55 8 23.425 21.325 24.95 30.3 9 24.025 22.675 26.474999999999998 26.825 10-14 26.155 24.985 22.575 26.284999999999997 15-19 25.552555255525554 24.367436743674368 23.862386238623863 26.21762176217622 20-24 25.586279313965697 25.146257312865643 23.876193809690484 25.391269563478176 25-29 26.14 24.41 23.369999999999997 26.08 30-34 25.825 25.540000000000003 23.365 25.27 35-39 25.917591759175917 25.06750675067507 23.697369736973698 25.317531753175317 40-44 25.874999999999996 24.935 23.145 26.045 45-49 25.94 25.259999999999998 23.73 25.069999999999997 50-54 25.915 24.240000000000002 24.34 25.505 55-59 26.435 24.79 23.535 25.240000000000002 60-64 27.169999999999998 24.285 23.91 24.635 65-69 26.25 25.319999999999997 23.875 24.555 70-74 27.005000000000003 24.905 23.635 24.455 75-79 27.065 25.11 23.335 24.490000000000002 80-84 26.634999999999998 24.625 23.82 24.92 85-89 26.655 24.404999999999998 24.490000000000002 24.45 90-94 26.924999999999997 25.119999999999997 23.75 24.205 95-99 26.669999999999998 24.865000000000002 24.08 24.385 100-104 26.834999999999997 24.93 23.825 24.41 105-109 26.41 24.795 24.404999999999998 24.39 110-114 27.065 25.014999999999997 23.835 24.085 115-119 27.310000000000002 24.975 23.5 24.215 120-124 27.279999999999998 25.115 23.369999999999997 24.235 125-129 27.265 24.975 24.16 23.599999999999998 130-134 27.465 25.419999999999998 22.97 24.145 135-139 27.284999999999997 25.15 24.03 23.535 140-144 28.294999999999998 24.635 23.595 23.474999999999998 145-149 28.055000000000003 25.619999999999997 23.035 23.29 150-151 28.325 25.337500000000002 23.1875 23.150000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 1.5 28 2.5 29 3.0 30 3.5 31 5.0 32 7.5 33 12.5 34 16.5 35 24.0 36 37.0 37 52.0 38 60.0 39 79.5 40 107.5 41 124.0 42 145.0 43 160.5 44 165.0 45 169.0 46 188.0 47 196.5 48 183.5 49 174.0 50 154.5 51 137.0 52 128.5 53 122.0 54 118.0 55 97.0 56 84.0 57 78.0 58 80.0 59 87.5 60 81.5 61 72.0 62 74.0 63 74.5 64 71.5 65 79.5 66 81.0 67 78.0 68 70.0 69 61.5 70 56.0 71 42.5 72 33.5 73 30.0 74 22.0 75 13.5 76 10.5 77 9.0 78 5.0 79 6.0 80 3.5 81 2.0 82 1.5 83 0.5 84 0.5 85 0.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.55 #Duplication Level Percentage of deduplicated Percentage of total 1 93.66648850881882 87.625 2 5.879208979155532 11.0 3 0.3741314804917157 1.05 4 0.053447354355959376 0.2 5 0.026723677177979688 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5875 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.625 0.0 0.0 0.0 0.0 118-119 1.7875 0.0 0.0 0.0 0.0 120-121 1.9500000000000002 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.7875 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.6875 0.0 0.0 0.0 0.0 134-135 4.2625 0.0 0.0 0.0 0.0 136-137 4.6 0.0 0.0 0.0 0.0 138-139 5.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCAAG 10 0.006830828 145.0 6 GCCAAGT 10 0.006830828 145.0 7 >>END_MODULE Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511963 spots for SRR13292040.sra Written 1511963 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra Read 1511951 spots for SRR13292040.sra Written 1511951 spots for SRR13292040.sra SRR ids: ['SRR13292040.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uklsle1v SRR13292040.sra spots: 30239032 blocks: [[1, 1511951], [1511952, 3023902], [3023903, 4535853], [4535854, 6047804], [6047805, 7559755], [7559756, 9071706], [9071707, 10583657], [10583658, 12095608], [12095609, 13607559], [13607560, 15119510], [15119511, 16631461], [16631462, 18143412], [18143413, 19655363], [19655364, 21167314], [21167315, 22679265], [22679266, 24191216], [24191217, 25703167], [25703168, 27215118], [27215119, 28727069], [28727070, 30239032]] SRR13292040 file size 10254845 SRR13292040 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13292040 SRR13292040_1.fastq SRR13292040_2.fastq Input file: SRR13292040_1.fastq Paired file: SRR13292040_2.fastq trimmed: SRR13292040-trimmed-pair1.fastq, SRR13292040-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 14:09:28 2024 >> started Sat Dec 7 14:13:46 2024 >> done (258.778s) 30239032 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 5727 ( 0.02%) empty read pairs filtered out after trimming by size control 30233225 (99.98%) read pairs available; of these: 2396390 ( 7.93%) trimmed read pairs available after processing 27836835 (92.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 7 0.00% 21 5 0.00% 22 12 0.00% 23 9 0.00% 24 10 0.00% 25 19 0.00% 26 29 0.00% 27 12 0.00% 28 27 0.00% 29 24 0.00% 30 18 0.00% 31 23 0.00% 32 24 0.00% 33 34 0.00% 34 37 0.00% 35 41 0.00% 36 37 0.00% 37 40 0.00% 38 43 0.00% 39 46 0.00% 40 57 0.00% 41 66 0.00% 42 49 0.00% 43 50 0.00% 44 59 0.00% 45 71 0.00% 46 77 0.00% 47 72 0.00% 48 76 0.00% 49 101 0.00% 50 92 0.00% 51 140 0.00% 52 124 0.00% 53 117 0.00% 54 123 0.00% 55 142 0.00% 56 139 0.00% 57 169 0.00% 58 168 0.00% 59 214 0.00% 60 230 0.00% 61 263 0.00% 62 262 0.00% 63 281 0.00% 64 330 0.00% 65 302 0.00% 66 349 0.00% 67 378 0.00% 68 389 0.00% 69 426 0.00% 70 528 0.00% 71 571 0.00% 72 717 0.00% 73 741 0.00% 74 775 0.00% 75 880 0.00% 76 991 0.00% 77 1062 0.00% 78 1239 0.00% 79 1304 0.00% 80 1520 0.01% 81 1682 0.01% 82 1815 0.01% 83 2059 0.01% 84 2274 0.01% 85 2668 0.01% 86 3005 0.01% 87 3332 0.01% 88 3491 0.01% 89 3913 0.01% 90 4276 0.01% 91 4644 0.02% 92 5282 0.02% 93 5807 0.02% 94 6520 0.02% 95 6887 0.02% 96 7743 0.03% 97 8354 0.03% 98 8929 0.03% 99 9891 0.03% 100 10681 0.04% 101 11472 0.04% 102 12694 0.04% 103 13615 0.05% 104 14661 0.05% 105 15573 0.05% 106 17036 0.06% 107 18039 0.06% 108 19262 0.06% 109 20304 0.07% 110 21626 0.07% 111 22932 0.08% 112 24373 0.08% 113 25541 0.08% 114 27098 0.09% 115 28686 0.09% 116 30278 0.10% 117 31792 0.11% 118 33509 0.11% 119 34599 0.11% 120 35949 0.12% 121 37881 0.13% 122 38823 0.13% 123 40994 0.14% 124 42320 0.14% 125 44169 0.15% 126 45584 0.15% 127 47984 0.16% 128 49089 0.16% 129 50262 0.17% 130 51948 0.17% 131 53217 0.18% 132 55064 0.18% 133 56690 0.19% 134 57503 0.19% 135 59481 0.20% 136 62085 0.21% 137 63465 0.21% 138 64737 0.21% 139 66471 0.22% 140 68005 0.22% 141 69378 0.23% 142 71184 0.24% 143 71685 0.24% 144 73652 0.24% 145 75448 0.25% 146 77266 0.26% 147 77892 0.26% 148 80998 0.27% 149 81845 0.27% 150 82820 0.27% 151 27836835 92.07% 30233225 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.45 fanout-score-rank=26 prefix-density=0.26 prefix-fanout=4.2 sequence=GGCAGCCTCCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=1206.99 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=26.5 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=33 prefix-density=0.43 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=292.71 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=20.9 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR13292040 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 14:19:14 Started mapping on | Dec 07 14:19:15 Finished on | Dec 07 14:39:07 Mapping speed, Million of reads per hour | 91.31 Number of input reads | 30233225 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 29180448 Uniquely mapped reads % | 96.52% Average mapped length | 297.96 Number of splices: Total | 30895484 Number of splices: Annotated (sjdb) | 28967663 Number of splices: GT/AG | 30485239 Number of splices: GC/AG | 356188 Number of splices: AT/AC | 23046 Number of splices: Non-canonical | 31011 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338130 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 41328 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.51% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 714647 714647 714647 N_multimapping 338130 338130 338130 N_noFeature 846560 28521880 1054381 N_ambiguous 521207 3984 71612 UnstrandedReadsAssigned:27812681 PositiveStrandReadsAssigned:654584 NegativeStrandReadsAssigned:28054455 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR13292040 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13292040-trimmed-pair1.fastq SRR13292040-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,233,225 reads, 28,469,015 reads pseudoaligned [quant] estimated average fragment length: 284.404 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,320 rounds 52973 SRR13292040.ke.tsv 35125 SRR13292040.se.tsv 88098 total ==> SRR13292040.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 653.164 0 0 PNS24247 1044 760.596 114.304 7.9273 PNS24249 1928 1644.6 273.426 8.77001 PNS24246 1044 760.596 114.304 7.9273 PNS24248 1044 760.596 114.304 7.9273 PNS24244 1471 1187.6 117.662 5.22623 PNS24243 293 88.8519 3 1.78104 KQK14069 1603 1319.6 7626.26 304.852 KQK14071 474 220.872 79.8378 19.0672 ==> SRR13292040.se.tsv <== BRADI_1g14170v3 7978 BRADI_1g53295v3 129 BRADI_1g59795v3 441 BRADI_1g07683v3 0 BRADI_1g00485v3 71 BRADI_1g20270v3 1827 BRADI_1g74790v3 65 BRADI_1g09890v3 0 BRADI_1g77505v3 217 BRADI_1g48960v3 0 SRR13292040 completed mapping pipeline successfully