Starting /dee2/code/volunteer_pipeline.sh SRR13662575 current disk space = 1525848363008 free memory = 1552527984 SRR13662575 SRAfilesize c47184d7c17084bc744857d62632ed9b SRR13662575.sra SRR13662575.sra file validated SRR13662575 is paired end SRR13662575 is conventional basespace SRR13662575 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662575_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43475 33.0 33.0 34.0 31.0 34.0 2 32.4385 33.0 33.0 34.0 31.0 34.0 3 32.37175 33.0 33.0 34.0 31.0 34.0 4 32.36825 33.0 33.0 34.0 31.0 34.0 5 32.381 33.0 33.0 34.0 31.0 34.0 6 36.03425 38.0 36.0 38.0 33.0 38.0 7 36.39 38.0 37.0 38.0 33.0 38.0 8 36.65525 38.0 38.0 38.0 34.0 38.0 9 36.8145 38.0 38.0 38.0 34.0 38.0 10-11 36.698625 38.0 38.0 38.0 34.5 38.0 12-13 36.752250000000004 38.0 38.0 38.0 34.0 38.0 14-15 36.671125 38.0 38.0 38.0 34.0 38.0 16-17 36.6595 38.0 38.0 38.0 34.0 38.0 18-19 36.82 38.0 38.0 38.0 35.0 38.0 20-21 36.820625 38.0 38.0 38.0 34.5 38.0 22-23 36.671 38.0 38.0 38.0 34.5 38.0 24-25 36.697375 38.0 38.0 38.0 34.0 38.0 26-27 36.687 38.0 38.0 38.0 34.5 38.0 28-29 36.623625000000004 38.0 38.0 38.0 34.5 38.0 30-31 36.67675 38.0 38.0 38.0 34.0 38.0 32-33 36.6505 38.0 38.0 38.0 34.0 38.0 34-35 36.7475 38.0 38.0 38.0 34.5 38.0 36-37 36.656499999999994 38.0 38.0 38.0 34.5 38.0 38-39 36.61575 38.0 38.0 38.0 34.0 38.0 40-41 36.499750000000006 38.0 38.0 38.0 33.5 38.0 42-43 36.500375000000005 38.0 38.0 38.0 34.0 38.0 44-45 36.445875 38.0 38.0 38.0 33.5 38.0 46-47 36.55675 38.0 38.0 38.0 34.0 38.0 48-49 36.584875 38.0 38.0 38.0 34.0 38.0 50-51 36.508250000000004 38.0 38.0 38.0 34.0 38.0 52-53 36.588125 38.0 38.0 38.0 34.0 38.0 54-55 36.456125 38.0 38.0 38.0 33.5 38.0 56-57 36.422625 38.0 38.0 38.0 34.0 38.0 58-59 36.481375 38.0 38.0 38.0 34.0 38.0 60-61 36.527625 38.0 38.0 38.0 34.0 38.0 62-63 36.5115 38.0 38.0 38.0 34.0 38.0 64-65 36.688625 38.0 38.0 38.0 34.0 38.0 66-67 36.581625 38.0 38.0 38.0 34.0 38.0 68-69 36.6275 38.0 38.0 38.0 34.0 38.0 70-71 36.535375 38.0 38.0 38.0 34.0 38.0 72-73 36.0235 38.0 37.0 38.0 33.0 38.0 74-75 36.279375 38.0 38.0 38.0 33.0 38.0 76-77 36.39725 38.0 38.0 38.0 33.5 38.0 78-79 36.2375 38.0 38.0 38.0 32.5 38.0 80-81 36.3655 38.0 38.0 38.0 33.5 38.0 82-83 35.894 38.0 37.0 38.0 32.0 38.0 84-85 36.3155 38.0 38.0 38.0 33.5 38.0 86-87 36.121125000000006 38.0 38.0 38.0 33.0 38.0 88-89 36.12575 38.0 37.5 38.0 33.0 38.0 90-91 36.105000000000004 38.0 37.5 38.0 33.0 38.0 92-93 35.79675 38.0 37.0 38.0 31.0 38.0 94-95 35.6185 38.0 36.5 38.0 30.0 38.0 96-97 35.771249999999995 38.0 37.0 38.0 31.5 38.0 98-99 35.8005 38.0 37.0 38.0 31.5 38.0 100-101 36.111625000000004 38.0 38.0 38.0 33.0 38.0 102-103 35.662875 38.0 37.0 38.0 31.0 38.0 104-105 35.62587499999999 38.0 37.0 38.0 31.0 38.0 106-107 35.537875 38.0 36.0 38.0 30.5 38.0 108-109 35.66025 38.0 37.0 38.0 31.0 38.0 110-111 35.6845 38.0 37.0 38.0 31.0 38.0 112-113 35.588625 38.0 36.0 38.0 31.5 38.0 114-115 35.550749999999994 38.0 36.0 38.0 31.0 38.0 116-117 35.642624999999995 38.0 37.0 38.0 32.0 38.0 118-119 34.9935 38.0 36.0 38.0 28.0 38.0 120-121 34.796125 38.0 36.0 38.0 27.0 38.0 122-123 34.335499999999996 38.0 35.0 38.0 24.5 38.0 124-125 33.912375 38.0 35.0 38.0 24.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 1.0 17 2.0 18 2.0 19 1.0 20 3.0 21 4.0 22 6.0 23 5.0 24 10.0 25 8.0 26 19.0 27 46.0 28 43.0 29 70.0 30 75.0 31 80.0 32 110.0 33 162.0 34 190.0 35 286.0 36 497.0 37 2377.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.175 11.375 10.15 37.3 2 31.15 17.575 29.099999999999998 22.175 3 27.275 23.724999999999998 19.8 29.2 4 30.875000000000004 28.975 16.125 24.025 5 29.2 30.275000000000002 19.05 21.475 6 23.549999999999997 34.825 19.25 22.375 7 21.55 16.75 36.449999999999996 25.25 8 23.775 21.349999999999998 24.25 30.625000000000004 9 25.0 18.775 27.175 29.049999999999997 10-11 27.6 28.6875 19.3875 24.325 12-13 24.637500000000003 21.987499999999997 25.7125 27.6625 14-15 25.887500000000003 23.2625 24.45 26.400000000000002 16-17 27.8375 24.5125 22.45 25.2 18-19 26.487500000000004 22.75 23.25 27.5125 20-21 25.174999999999997 23.4375 23.875 27.5125 22-23 27.2625 23.200000000000003 23.1875 26.35 24-25 26.3625 24.099999999999998 23.200000000000003 26.337500000000002 26-27 26.487500000000004 24.425 22.6375 26.450000000000003 28-29 27.35 24.1625 21.6125 26.875 30-31 26.150000000000002 23.325000000000003 23.5875 26.937499999999996 32-33 26.887499999999996 23.775 24.025 25.3125 34-35 26.3 24.25 23.1875 26.2625 36-37 26.637499999999996 23.775 23.3 26.2875 38-39 27.025 23.925 22.375 26.674999999999997 40-41 26.900000000000002 23.925 22.825 26.35 42-43 26.6125 23.4625 22.775000000000002 27.150000000000002 44-45 26.525 23.3125 22.912499999999998 27.250000000000004 46-47 26.1 23.925 22.662499999999998 27.3125 48-49 26.700000000000003 23.25 23.525 26.525 50-51 26.825 23.3125 23.3625 26.5 52-53 26.8 23.275000000000002 23.7375 26.187500000000004 54-55 26.775 22.8875 22.787499999999998 27.55 56-57 26.450000000000003 24.125 22.975 26.450000000000003 58-59 26.775 23.8125 22.3125 27.1 60-61 27.0875 23.125 22.125 27.6625 62-63 26.85 23.75 22.5 26.900000000000002 64-65 27.700000000000003 23.325000000000003 22.5875 26.387500000000003 66-67 25.937500000000004 22.7 24.224999999999998 27.1375 68-69 26.150000000000002 24.3 22.7625 26.787499999999998 70-71 26.887499999999996 23.05 22.7625 27.3 72-73 27.0 22.725 23.325000000000003 26.950000000000003 74-75 26.85 22.900000000000002 23.8875 26.3625 76-77 25.900000000000002 23.625 23.150000000000002 27.325 78-79 26.875 23.2375 22.8875 27.0 80-81 27.3125 22.9375 22.662499999999998 27.0875 82-83 26.625 23.8375 22.3125 27.224999999999998 84-85 27.1 23.05 23.2875 26.5625 86-87 26.3 23.599999999999998 23.4125 26.687499999999996 88-89 27.750000000000004 22.8125 22.912499999999998 26.525 90-91 27.287499999999998 23.5125 22.9625 26.237500000000004 92-93 26.400000000000002 23.5 23.3625 26.737499999999997 94-95 26.650000000000002 22.875 22.9625 27.5125 96-97 27.775 23.075000000000003 22.8625 26.2875 98-99 26.1125 23.5625 23.9125 26.4125 100-101 27.0 22.7625 23.8625 26.375 102-103 27.224999999999998 22.825 23.275000000000002 26.674999999999997 104-105 25.662499999999998 24.2 23.549999999999997 26.5875 106-107 27.0875 21.987499999999997 24.0 26.924999999999997 108-109 27.987499999999997 22.4375 21.875 27.700000000000003 110-111 26.6 23.525 23.6125 26.2625 112-113 26.8625 23.0375 23.400000000000002 26.700000000000003 114-115 26.7125 23.599999999999998 22.475 27.212500000000002 116-117 26.924999999999997 23.2875 23.724999999999998 26.0625 118-119 27.5125 23.1125 22.400000000000002 26.974999999999998 120-121 26.450000000000003 23.3125 23.65 26.5875 122-123 27.037499999999998 23.1125 23.7125 26.137500000000003 124-125 27.787499999999998 23.2125 22.9375 26.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.0 28 2.0 29 2.0 30 0.0 31 3.5 32 9.0 33 13.5 34 16.5 35 28.5 36 50.0 37 53.5 38 58.5 39 71.5 40 79.0 41 98.0 42 120.0 43 131.0 44 133.0 45 132.5 46 130.5 47 139.0 48 149.5 49 155.5 50 157.0 51 144.0 52 134.5 53 120.0 54 108.5 55 113.5 56 107.0 57 95.5 58 91.0 59 83.0 60 85.5 61 91.0 62 85.0 63 79.5 64 81.0 65 92.5 66 92.5 67 82.5 68 81.5 69 72.0 70 63.5 71 61.0 72 52.0 73 51.0 74 44.0 75 31.5 76 26.0 77 22.5 78 19.5 79 13.0 80 7.5 81 8.0 82 8.0 83 5.5 84 3.5 85 1.5 86 1.0 87 1.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662575 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662575_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.05025 33.0 32.0 34.0 18.0 34.0 2 31.2505 33.0 32.0 34.0 25.0 34.0 3 31.00875 33.0 32.0 34.0 18.0 34.0 4 31.392 33.0 32.0 34.0 27.0 34.0 5 31.36875 33.0 32.0 34.0 27.0 34.0 6 35.14675 38.0 36.0 38.0 27.0 38.0 7 35.022 38.0 36.0 38.0 26.0 38.0 8 35.46175 38.0 36.0 38.0 29.0 38.0 9 35.46725 38.0 36.0 38.0 29.0 38.0 10-11 35.451 38.0 37.0 38.0 29.0 38.0 12-13 34.998125 38.0 36.0 38.0 26.5 38.0 14-15 35.075625 38.0 36.0 38.0 27.0 38.0 16-17 35.261375 38.0 36.0 38.0 27.5 38.0 18-19 35.581875 38.0 37.0 38.0 29.0 38.0 20-21 35.016875 38.0 36.0 38.0 27.0 38.0 22-23 35.46625 38.0 36.5 38.0 28.0 38.0 24-25 35.380375 38.0 36.5 38.0 28.0 38.0 26-27 34.9825 38.0 36.0 38.0 26.5 38.0 28-29 35.041875000000005 38.0 36.0 38.0 27.0 38.0 30-31 35.009625 38.0 35.5 38.0 26.0 38.0 32-33 34.957125 38.0 36.0 38.0 26.0 38.0 34-35 34.686625 38.0 35.5 38.0 25.0 38.0 36-37 35.247875 38.0 36.0 38.0 27.0 38.0 38-39 35.492375 38.0 37.0 38.0 28.5 38.0 40-41 35.090999999999994 38.0 36.0 38.0 27.0 38.0 42-43 35.344 38.0 36.5 38.0 27.5 38.0 44-45 34.9535 38.0 36.0 38.0 26.0 38.0 46-47 34.906875 38.0 36.0 38.0 26.0 38.0 48-49 35.113 38.0 36.0 38.0 27.0 38.0 50-51 35.394625000000005 38.0 36.0 38.0 28.0 38.0 52-53 35.175 38.0 36.0 38.0 27.0 38.0 54-55 35.459125 38.0 36.5 38.0 28.5 38.0 56-57 35.550875 38.0 36.5 38.0 29.5 38.0 58-59 35.5005 38.0 36.5 38.0 28.5 38.0 60-61 35.361125 38.0 36.0 38.0 28.0 38.0 62-63 35.658125 38.0 37.0 38.0 29.0 38.0 64-65 35.684749999999994 38.0 37.0 38.0 30.0 38.0 66-67 35.4255 38.0 36.0 38.0 28.5 38.0 68-69 35.370875 38.0 36.5 38.0 28.0 38.0 70-71 35.568 38.0 37.0 38.0 29.0 38.0 72-73 35.2565 38.0 36.0 38.0 27.5 38.0 74-75 35.534125 38.0 36.5 38.0 29.0 38.0 76-77 35.41 38.0 36.5 38.0 29.0 38.0 78-79 35.6695 38.0 37.0 38.0 29.5 38.0 80-81 35.479375000000005 38.0 36.5 38.0 29.5 38.0 82-83 35.298125 38.0 36.0 38.0 28.5 38.0 84-85 35.131625 38.0 36.0 38.0 27.5 38.0 86-87 35.29625 38.0 36.0 38.0 28.0 38.0 88-89 35.535 38.0 36.5 38.0 29.0 38.0 90-91 35.560874999999996 38.0 37.0 38.0 30.0 38.0 92-93 34.928625 38.0 35.5 38.0 26.5 38.0 94-95 35.06675 38.0 36.0 38.0 27.5 38.0 96-97 34.7765 38.0 35.5 38.0 25.0 38.0 98-99 34.8955 38.0 35.5 38.0 26.0 38.0 100-101 34.392624999999995 38.0 35.0 38.0 23.0 38.0 102-103 34.901875000000004 38.0 35.5 38.0 26.0 38.0 104-105 34.61575 38.0 35.0 38.0 24.5 38.0 106-107 34.68575 38.0 35.0 38.0 26.0 38.0 108-109 35.03 38.0 36.0 38.0 28.0 38.0 110-111 34.98425 38.0 36.0 38.0 27.5 38.0 112-113 34.84125 38.0 35.5 38.0 27.0 38.0 114-115 34.581125 38.0 35.0 38.0 25.0 38.0 116-117 34.559125 38.0 35.0 38.0 25.0 38.0 118-119 34.272625 38.0 35.0 38.0 23.0 38.0 120-121 34.451375 38.0 35.0 38.0 26.0 38.0 122-123 33.94825 38.0 35.0 38.0 23.0 38.0 124-125 33.54925 38.0 35.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 2.0 14 6.0 15 5.0 16 5.0 17 7.0 18 7.0 19 6.0 20 16.0 21 18.0 22 18.0 23 32.0 24 48.0 25 58.0 26 57.0 27 72.0 28 62.0 29 81.0 30 91.0 31 112.0 32 146.0 33 158.0 34 230.0 35 283.0 36 498.0 37 1980.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.325 11.65 10.75 37.275000000000006 2 30.85 18.05 28.599999999999998 22.5 3 26.724999999999998 23.125 20.349999999999998 29.799999999999997 4 30.85 28.175 15.75 25.224999999999998 5 30.4 30.275000000000002 18.925 20.4 6 23.7 33.675 20.200000000000003 22.425 7 22.075 15.25 37.85 24.825 8 22.875 20.599999999999998 26.075 30.45 9 24.425 18.525 27.500000000000004 29.549999999999997 10-11 27.950000000000003 27.925 19.2625 24.8625 12-13 25.25 21.85 25.3 27.6 14-15 25.5 23.825 24.825 25.85 16-17 26.674999999999997 23.4125 23.549999999999997 26.3625 18-19 26.6625 23.2375 23.025000000000002 27.075 20-21 25.95 24.9 23.1625 25.9875 22-23 26.637499999999996 23.9875 22.412499999999998 26.9625 24-25 26.8 23.425 22.8 26.974999999999998 26-27 26.5125 24.962500000000002 23.1 25.424999999999997 28-29 26.700000000000003 22.912499999999998 22.95 27.437499999999996 30-31 27.200000000000003 22.6375 23.425 26.737499999999997 32-33 26.7625 23.9875 23.4875 25.7625 34-35 26.5 24.0375 23.425 26.0375 36-37 26.5375 23.425 23.625 26.4125 38-39 26.8625 24.5375 23.05 25.55 40-41 27.1625 23.3625 22.95 26.525 42-43 26.450000000000003 23.35 22.9625 27.237499999999997 44-45 26.55 22.275 24.0 27.175 46-47 26.400000000000002 23.9875 23.025000000000002 26.5875 48-49 26.950000000000003 23.3625 23.4125 26.275 50-51 25.25 23.0125 24.675 27.0625 52-53 26.55 23.5875 23.2875 26.575 54-55 26.9125 22.625 22.6875 27.775 56-57 26.650000000000002 23.4625 23.35 26.5375 58-59 27.212500000000002 23.625 22.5125 26.650000000000002 60-61 27.0625 22.95 22.9875 27.0 62-63 26.3 23.2875 24.125 26.2875 64-65 26.35 22.4625 23.1 28.0875 66-67 26.950000000000003 22.900000000000002 22.9375 27.212500000000002 68-69 26.775 23.474999999999998 22.6125 27.1375 70-71 26.8125 23.5125 22.7625 26.9125 72-73 27.075 23.25 23.3875 26.2875 74-75 26.087500000000002 24.375 23.425 26.1125 76-77 26.900000000000002 23.75 22.3125 27.037499999999998 78-79 26.987499999999997 23.6875 23.175 26.150000000000002 80-81 27.3125 23.525 22.425 26.737499999999997 82-83 27.9125 22.925 22.85 26.3125 84-85 26.400000000000002 22.6 23.2375 27.762500000000003 86-87 26.5 23.2625 23.5625 26.674999999999997 88-89 27.500000000000004 23.275000000000002 22.55 26.674999999999997 90-91 26.325 23.0 23.45 27.224999999999998 92-93 25.75 23.4625 24.075 26.7125 94-95 27.175 22.537499999999998 22.900000000000002 27.3875 96-97 25.912499999999998 22.1375 24.5375 27.4125 98-99 27.0125 23.3375 23.4375 26.2125 100-101 26.950000000000003 23.275000000000002 23.2875 26.487500000000004 102-103 26.775 23.0375 22.6 27.5875 104-105 26.937499999999996 23.8625 22.625 26.575 106-107 27.05 22.625 22.875 27.450000000000003 108-109 26.775 22.5875 23.8125 26.825 110-111 26.450000000000003 23.0875 24.3625 26.1 112-113 27.975 21.637500000000003 23.35 27.037499999999998 114-115 26.775 23.2875 22.9625 26.974999999999998 116-117 26.387500000000003 23.3625 23.3375 26.9125 118-119 27.025 23.0875 23.65 26.237500000000004 120-121 27.037499999999998 22.925 22.575 27.462500000000002 122-123 27.474999999999998 23.1375 23.65 25.7375 124-125 27.3875 23.525 23.025000000000002 26.0625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 1.5 28 2.0 29 2.0 30 4.5 31 9.5 32 8.5 33 11.0 34 17.0 35 22.5 36 31.0 37 45.0 38 58.0 39 71.0 40 94.5 41 116.5 42 126.0 43 125.5 44 126.5 45 134.5 46 149.0 47 152.5 48 150.0 49 148.0 50 141.5 51 134.5 52 124.0 53 122.0 54 121.5 55 106.0 56 98.5 57 96.5 58 103.0 59 105.0 60 96.5 61 88.0 62 72.0 63 77.0 64 83.5 65 69.0 66 74.5 67 85.5 68 81.0 69 75.5 70 61.5 71 56.5 72 55.5 73 50.0 74 45.5 75 39.0 76 32.5 77 24.5 78 23.0 79 20.5 80 9.5 81 4.5 82 3.5 83 2.0 84 1.5 85 2.0 86 1.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606956 spots for SRR13662575.sra Written 606956 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra Read 606940 spots for SRR13662575.sra Written 606940 spots for SRR13662575.sra SRR ids: ['SRR13662575.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_poyj30qt SRR13662575.sra spots: 12138816 blocks: [[1, 606940], [606941, 1213880], [1213881, 1820820], [1820821, 2427760], [2427761, 3034700], [3034701, 3641640], [3641641, 4248580], [4248581, 4855520], [4855521, 5462460], [5462461, 6069400], [6069401, 6676340], [6676341, 7283280], [7283281, 7890220], [7890221, 8497160], [8497161, 9104100], [9104101, 9711040], [9711041, 10317980], [10317981, 10924920], [10924921, 11531860], [11531861, 12138816]] SRR13662575 file size 3487176 SRR13662575 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662575 SRR13662575_1.fastq SRR13662575_2.fastq Input file: SRR13662575_1.fastq Paired file: SRR13662575_2.fastq trimmed: SRR13662575-trimmed-pair1.fastq, SRR13662575-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:12:56 2024 >> started Tue Dec 10 07:13:09 2024 >> done (13.290s) 12138816 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 258 ( 0.00%) empty read pairs filtered out after trimming by size control 12138557 (100.00%) read pairs available; of these: 1504403 (12.39%) trimmed read pairs available after processing 10634154 (87.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 24 2 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 1 0.00% 38 2 0.00% 39 0 0.00% 40 2 0.00% 41 1 0.00% 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 2 0.00% 47 2 0.00% 48 1 0.00% 49 0 0.00% 50 2 0.00% 51 1 0.00% 52 0 0.00% 53 1 0.00% 54 1 0.00% 55 2 0.00% 56 1 0.00% 57 5 0.00% 58 2 0.00% 59 2 0.00% 60 5 0.00% 61 5 0.00% 62 11 0.00% 63 21 0.00% 64 39 0.00% 65 53 0.00% 66 76 0.00% 67 100 0.00% 68 113 0.00% 69 131 0.00% 70 167 0.00% 71 170 0.00% 72 209 0.00% 73 211 0.00% 74 240 0.00% 75 265 0.00% 76 289 0.00% 77 299 0.00% 78 365 0.00% 79 415 0.00% 80 467 0.00% 81 458 0.00% 82 526 0.00% 83 553 0.00% 84 590 0.00% 85 682 0.01% 86 747 0.01% 87 821 0.01% 88 867 0.01% 89 985 0.01% 90 1097 0.01% 91 1218 0.01% 92 1507 0.01% 93 1831 0.02% 94 4376 0.04% 95 4565 0.04% 96 4775 0.04% 97 5011 0.04% 98 5258 0.04% 99 5382 0.04% 100 5944 0.05% 101 6006 0.05% 102 6393 0.05% 103 6683 0.06% 104 7147 0.06% 105 7403 0.06% 106 7775 0.06% 107 8188 0.07% 108 8811 0.07% 109 9497 0.08% 110 10421 0.09% 111 11379 0.09% 112 12612 0.10% 113 14171 0.12% 114 15873 0.13% 115 17808 0.15% 116 40681 0.34% 117 45908 0.38% 118 53636 0.44% 119 63189 0.52% 120 78180 0.64% 121 98852 0.81% 122 140813 1.16% 123 228249 1.88% 124 553851 4.56% 125 10634154 87.61% 12138557 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=231.01 fanout-score-rank=5 prefix-density=1.11 prefix-fanout=26.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=404.00 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=26.8 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=236.08 fanout-score-rank=7 prefix-density=1.08 prefix-fanout=26.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=427.64 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=28.1 sequence=GCGGCGGCGGCC SRR13662575 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:13:54 Started mapping on | Dec 10 07:13:54 Finished on | Dec 10 07:15:06 Mapping speed, Million of reads per hour | 606.93 Number of input reads | 12138557 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 10832075 Uniquely mapped reads % | 89.24% Average mapped length | 246.60 Number of splices: Total | 7879144 Number of splices: Annotated (sjdb) | 7403672 Number of splices: GT/AG | 7756703 Number of splices: GC/AG | 87695 Number of splices: AT/AC | 4819 Number of splices: Non-canonical | 29927 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 521006 % of reads mapped to multiple loci | 4.29% Number of reads mapped to too many loci | 34735 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.58% % of reads unmapped: other | 1.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 785524 785524 785524 N_multimapping 521006 521006 521006 N_noFeature 332140 5481249 5479578 N_ambiguous 244641 24273 24135 UnstrandedReadsAssigned:10255294 PositiveStrandReadsAssigned:5326553 NegativeStrandReadsAssigned:5328362 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662575 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662575-trimmed-pair1.fastq SRR13662575-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,138,557 reads, 10,865,323 reads pseudoaligned [quant] estimated average fragment length: 196.045 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52973 SRR13662575.ke.tsv 35125 SRR13662575.se.tsv 88098 total ==> SRR13662575.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.157 0 0 PNS24247 1044 848.955 26.0673 3.7986 PNS24249 1928 1732.96 207.569 14.818 PNS24246 1044 848.955 26.0673 3.7986 PNS24248 1044 848.955 26.0673 3.7986 PNS24244 1471 1275.96 52.2291 5.06396 PNS24243 293 104.792 7 8.26384 KQK14069 1603 1407.96 2823.83 248.12 KQK14071 474 280.81 229.94 101.301 ==> SRR13662575.se.tsv <== BRADI_1g14170v3 3213 BRADI_1g53295v3 44 BRADI_1g59795v3 121 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 331 BRADI_1g74790v3 298 BRADI_1g09890v3 5 BRADI_1g77505v3 201 BRADI_1g48960v3 1 SRR13662575 completed mapping pipeline successfully