Starting /dee2/code/volunteer_pipeline.sh SRR13662576 current disk space = 1526044639232 free memory = 1552787296 SRR13662576 SRAfilesize 3a4f4c9f2d941de644ece7f68a8f6e49 SRR13662576.sra SRR13662576.sra file validated SRR13662576 is paired end SRR13662576 is conventional basespace SRR13662576 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662576_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.459 33.0 33.0 34.0 31.0 34.0 2 32.55475 34.0 33.0 34.0 31.0 34.0 3 32.5355 34.0 33.0 34.0 31.0 34.0 4 32.3915 34.0 33.0 34.0 31.0 34.0 5 32.489 34.0 33.0 34.0 31.0 34.0 6 36.02625 38.0 36.0 38.0 31.0 38.0 7 36.639 38.0 37.0 38.0 34.0 38.0 8 36.69975 38.0 38.0 38.0 34.0 38.0 9 36.853 38.0 38.0 38.0 35.0 38.0 10-11 36.8925 38.0 38.0 38.0 35.0 38.0 12-13 36.846999999999994 38.0 38.0 38.0 35.0 38.0 14-15 36.815 38.0 38.0 38.0 34.5 38.0 16-17 36.87375 38.0 38.0 38.0 35.0 38.0 18-19 36.8765 38.0 38.0 38.0 35.0 38.0 20-21 36.844625 38.0 38.0 38.0 35.0 38.0 22-23 36.75 38.0 38.0 38.0 34.5 38.0 24-25 36.6505 38.0 38.0 38.0 34.0 38.0 26-27 36.856750000000005 38.0 38.0 38.0 35.0 38.0 28-29 36.745000000000005 38.0 38.0 38.0 34.5 38.0 30-31 36.663875000000004 38.0 38.0 38.0 34.0 38.0 32-33 36.73475 38.0 38.0 38.0 34.5 38.0 34-35 36.72825 38.0 38.0 38.0 34.5 38.0 36-37 36.752624999999995 38.0 38.0 38.0 35.0 38.0 38-39 36.722625 38.0 38.0 38.0 34.0 38.0 40-41 36.73224999999999 38.0 38.0 38.0 34.5 38.0 42-43 36.694874999999996 38.0 38.0 38.0 34.0 38.0 44-45 36.576875 38.0 38.0 38.0 34.0 38.0 46-47 36.625625 38.0 38.0 38.0 34.0 38.0 48-49 36.66575 38.0 38.0 38.0 34.0 38.0 50-51 36.584875 38.0 38.0 38.0 34.0 38.0 52-53 36.565625 38.0 38.0 38.0 34.0 38.0 54-55 36.55525 38.0 38.0 38.0 34.0 38.0 56-57 36.59825 38.0 38.0 38.0 34.0 38.0 58-59 36.551125 38.0 38.0 38.0 34.0 38.0 60-61 36.527125 38.0 38.0 38.0 34.0 38.0 62-63 36.482625 38.0 38.0 38.0 34.0 38.0 64-65 36.493375 38.0 38.0 38.0 34.0 38.0 66-67 36.61 38.0 38.0 38.0 34.0 38.0 68-69 36.52 38.0 38.0 38.0 34.0 38.0 70-71 36.526375 38.0 38.0 38.0 34.0 38.0 72-73 36.514250000000004 38.0 38.0 38.0 34.0 38.0 74-75 36.419875000000005 38.0 38.0 38.0 33.5 38.0 76-77 36.44125 38.0 38.0 38.0 34.0 38.0 78-79 36.426500000000004 38.0 38.0 38.0 34.0 38.0 80-81 36.339124999999996 38.0 38.0 38.0 33.0 38.0 82-83 36.34 38.0 38.0 38.0 34.0 38.0 84-85 36.37125 38.0 38.0 38.0 33.5 38.0 86-87 36.214 38.0 38.0 38.0 33.0 38.0 88-89 36.212875 38.0 38.0 38.0 33.0 38.0 90-91 36.2525 38.0 38.0 38.0 33.5 38.0 92-93 36.106125000000006 38.0 37.5 38.0 33.0 38.0 94-95 36.056375 38.0 37.0 38.0 33.0 38.0 96-97 36.01775 38.0 37.0 38.0 33.0 38.0 98-99 36.133625 38.0 37.0 38.0 33.0 38.0 100-101 36.042874999999995 38.0 37.5 38.0 33.0 38.0 102-103 35.941 38.0 37.0 38.0 32.0 38.0 104-105 35.965625 38.0 37.5 38.0 33.0 38.0 106-107 35.88975 38.0 37.0 38.0 32.0 38.0 108-109 35.789 38.0 37.0 38.0 32.0 38.0 110-111 35.764250000000004 38.0 37.0 38.0 31.0 38.0 112-113 35.683875 38.0 36.0 38.0 31.0 38.0 114-115 35.838625 38.0 37.0 38.0 32.5 38.0 116-117 35.598375 38.0 36.0 38.0 31.0 38.0 118-119 35.5475 38.0 36.0 38.0 31.0 38.0 120-121 35.543375 38.0 36.0 38.0 31.0 38.0 122-123 35.25275 38.0 36.0 38.0 31.0 38.0 124-125 34.918125 38.0 36.0 38.0 31.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 2.0 18 1.0 19 2.0 20 0.0 21 4.0 22 6.0 23 6.0 24 8.0 25 12.0 26 26.0 27 30.0 28 45.0 29 34.0 30 68.0 31 84.0 32 117.0 33 141.0 34 188.0 35 234.0 36 491.0 37 2499.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.900000000000006 10.25 10.674999999999999 39.175 2 32.675 17.2 29.125 21.0 3 28.525 22.75 19.275000000000002 29.45 4 31.75 28.349999999999998 16.3 23.599999999999998 5 30.125 30.099999999999998 19.025 20.75 6 23.425 34.25 18.5 23.825 7 22.875 16.150000000000002 35.5 25.474999999999998 8 24.75 20.225 24.55 30.475 9 24.95 19.85 25.624999999999996 29.575000000000003 10-11 27.6375 28.5625 18.6875 25.112499999999997 12-13 25.55 22.9875 23.8625 27.6 14-15 26.437500000000004 23.799999999999997 23.5875 26.174999999999997 16-17 28.537499999999998 23.4625 22.412499999999998 25.587500000000002 18-19 26.787499999999998 22.6375 23.8375 26.737499999999997 20-21 27.8625 22.9875 22.900000000000002 26.25 22-23 27.4125 22.8 23.0375 26.75 24-25 27.6375 23.8875 22.1375 26.337500000000002 26-27 27.425 23.4375 22.325 26.8125 28-29 27.625 22.6125 22.575 27.187499999999996 30-31 26.0125 23.625 22.6375 27.725 32-33 27.450000000000003 23.3625 22.9625 26.224999999999998 34-35 26.900000000000002 23.1875 22.287499999999998 27.625 36-37 26.575 23.724999999999998 22.4375 27.2625 38-39 26.437500000000004 23.275000000000002 23.0375 27.250000000000004 40-41 27.437499999999996 21.8 23.0375 27.725 42-43 26.625 22.7 23.75 26.924999999999997 44-45 26.8375 23.400000000000002 22.0125 27.750000000000004 46-47 27.037499999999998 23.549999999999997 22.237499999999997 27.175 48-49 26.387500000000003 23.325000000000003 22.787499999999998 27.500000000000004 50-51 27.200000000000003 23.0625 23.0125 26.724999999999998 52-53 27.8375 23.1875 22.3 26.674999999999997 54-55 26.9125 23.225 23.25 26.6125 56-57 27.237499999999997 22.975 22.287499999999998 27.500000000000004 58-59 27.3 23.0125 22.662499999999998 27.025 60-61 27.2625 22.112499999999997 22.8375 27.787499999999998 62-63 27.037499999999998 23.175 22.175 27.6125 64-65 26.8125 22.55 22.6 28.037499999999998 66-67 27.250000000000004 22.4625 23.225 27.0625 68-69 27.200000000000003 22.4625 23.275000000000002 27.0625 70-71 27.6875 22.825 22.7375 26.75 72-73 27.1625 22.8625 22.925 27.05 74-75 27.787499999999998 22.9875 23.075000000000003 26.150000000000002 76-77 26.575 22.25 23.5 27.675 78-79 26.4625 22.287499999999998 22.7 28.549999999999997 80-81 26.474999999999998 22.6375 23.7125 27.175 82-83 27.0875 23.275000000000002 22.5125 27.125 84-85 26.450000000000003 22.825 23.5 27.224999999999998 86-87 27.975 22.3625 22.8125 26.85 88-89 27.1375 22.7375 22.5625 27.5625 90-91 27.150000000000002 22.175 22.625 28.050000000000004 92-93 26.987499999999997 22.8875 23.6375 26.487500000000004 94-95 27.537499999999998 22.425 21.925 28.1125 96-97 26.337500000000002 22.9875 22.875 27.800000000000004 98-99 27.6875 22.4875 23.6625 26.1625 100-101 26.5875 22.25 22.7 28.462500000000002 102-103 27.5875 22.45 22.4375 27.525 104-105 27.187499999999996 23.150000000000002 22.575 27.0875 106-107 27.3 22.775000000000002 22.5625 27.3625 108-109 26.85 22.900000000000002 22.2625 27.987499999999997 110-111 27.375 22.662499999999998 23.6875 26.275 112-113 27.725 23.25 21.9375 27.0875 114-115 26.737499999999997 22.8125 22.8875 27.5625 116-117 27.4125 22.3875 23.3875 26.8125 118-119 27.800000000000004 21.625 23.2125 27.3625 120-121 26.9625 23.075000000000003 23.4875 26.474999999999998 122-123 27.35 23.2625 22.3875 27.0 124-125 27.9375 22.1875 22.2 27.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 1.5 28 2.0 29 1.5 30 2.5 31 6.0 32 8.5 33 9.0 34 14.5 35 16.5 36 26.0 37 38.0 38 43.5 39 54.5 40 64.5 41 98.0 42 135.0 43 131.0 44 140.5 45 160.0 46 162.5 47 157.5 48 138.0 49 122.0 50 128.0 51 124.0 52 113.5 53 114.5 54 114.5 55 106.0 56 93.5 57 91.0 58 89.0 59 92.5 60 99.0 61 88.0 62 82.5 63 96.0 64 103.5 65 94.0 66 82.0 67 78.0 68 84.0 69 87.0 70 78.5 71 78.5 72 69.5 73 57.0 74 48.5 75 37.5 76 29.0 77 25.5 78 20.5 79 15.5 80 15.0 81 11.0 82 6.0 83 3.5 84 1.5 85 1.5 86 1.0 87 0.0 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662576 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662576_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0085 33.0 33.0 34.0 28.0 34.0 2 32.1475 33.0 33.0 34.0 30.0 34.0 3 32.21575 33.0 33.0 34.0 30.0 34.0 4 32.03875 33.0 33.0 34.0 30.0 34.0 5 32.00575 33.0 33.0 34.0 30.0 34.0 6 35.8795 38.0 37.0 38.0 31.0 38.0 7 36.13225 38.0 38.0 38.0 32.0 38.0 8 36.0135 38.0 38.0 38.0 31.0 38.0 9 36.05125 38.0 38.0 38.0 31.0 38.0 10-11 36.122749999999996 38.0 37.5 38.0 32.5 38.0 12-13 36.051625 38.0 38.0 38.0 32.0 38.0 14-15 36.109875 38.0 38.0 38.0 32.5 38.0 16-17 36.152125 38.0 38.0 38.0 32.5 38.0 18-19 36.086124999999996 38.0 38.0 38.0 32.0 38.0 20-21 36.047 38.0 37.5 38.0 32.0 38.0 22-23 35.965375 38.0 37.0 38.0 31.0 38.0 24-25 36.118375 38.0 37.5 38.0 32.5 38.0 26-27 36.162875 38.0 38.0 38.0 33.0 38.0 28-29 36.021874999999994 38.0 37.5 38.0 32.0 38.0 30-31 36.150125 38.0 38.0 38.0 33.0 38.0 32-33 36.093374999999995 38.0 38.0 38.0 32.5 38.0 34-35 36.0775 38.0 38.0 38.0 33.0 38.0 36-37 36.026624999999996 38.0 37.0 38.0 31.5 38.0 38-39 35.917874999999995 38.0 37.0 38.0 31.0 38.0 40-41 35.92575 38.0 37.0 38.0 31.0 38.0 42-43 35.958749999999995 38.0 37.0 38.0 31.0 38.0 44-45 35.948875 38.0 37.0 38.0 31.0 38.0 46-47 35.935375 38.0 37.0 38.0 31.0 38.0 48-49 35.995875 38.0 37.0 38.0 31.5 38.0 50-51 36.018625 38.0 37.5 38.0 31.5 38.0 52-53 35.888125 38.0 37.0 38.0 31.0 38.0 54-55 35.941625 38.0 37.0 38.0 31.0 38.0 56-57 35.940250000000006 38.0 37.0 38.0 31.0 38.0 58-59 35.947375 38.0 37.0 38.0 31.0 38.0 60-61 35.9555 38.0 37.0 38.0 31.0 38.0 62-63 36.0135 38.0 37.0 38.0 31.0 38.0 64-65 35.896 38.0 37.0 38.0 31.5 38.0 66-67 35.817625 38.0 37.0 38.0 30.5 38.0 68-69 35.768625 38.0 37.0 38.0 30.0 38.0 70-71 35.818 38.0 37.0 38.0 30.0 38.0 72-73 35.787000000000006 38.0 37.0 38.0 31.0 38.0 74-75 35.77775 38.0 37.0 38.0 31.0 38.0 76-77 35.691125 38.0 37.0 38.0 30.0 38.0 78-79 35.681125 38.0 37.0 38.0 30.0 38.0 80-81 35.539500000000004 38.0 37.0 38.0 30.0 38.0 82-83 35.63825 38.0 37.0 38.0 30.5 38.0 84-85 35.557 38.0 37.0 38.0 30.0 38.0 86-87 35.468125 38.0 36.5 38.0 29.0 38.0 88-89 35.43962500000001 38.0 36.5 38.0 29.5 38.0 90-91 35.389375 38.0 36.5 38.0 29.0 38.0 92-93 35.2555 38.0 36.0 38.0 28.0 38.0 94-95 35.30175 38.0 36.0 38.0 28.5 38.0 96-97 35.272 38.0 36.0 38.0 29.0 38.0 98-99 35.27325 38.0 36.0 38.0 29.0 38.0 100-101 35.0155 38.0 36.0 38.0 26.5 38.0 102-103 35.146875 38.0 36.0 38.0 28.5 38.0 104-105 34.947125 38.0 35.5 38.0 27.0 38.0 106-107 35.0475 38.0 36.0 38.0 28.0 38.0 108-109 34.893874999999994 38.0 36.0 38.0 27.5 38.0 110-111 34.771874999999994 38.0 36.0 38.0 26.0 38.0 112-113 34.521375000000006 38.0 35.5 38.0 24.5 38.0 114-115 34.48675 38.0 35.0 38.0 23.5 38.0 116-117 34.580875000000006 38.0 35.0 38.0 25.5 38.0 118-119 34.59075 38.0 35.0 38.0 26.0 38.0 120-121 34.3795 38.0 35.0 38.0 24.5 38.0 122-123 33.979375000000005 38.0 35.0 38.0 23.0 38.0 124-125 33.519875 38.0 35.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 2.0 15 4.0 16 4.0 17 8.0 18 5.0 19 8.0 20 6.0 21 18.0 22 18.0 23 16.0 24 38.0 25 38.0 26 47.0 27 59.0 28 57.0 29 65.0 30 105.0 31 91.0 32 128.0 33 142.0 34 160.0 35 239.0 36 438.0 37 2300.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.6 10.9 10.725 37.775 2 31.924999999999997 17.849999999999998 27.575 22.650000000000002 3 28.525 23.599999999999998 18.075 29.799999999999997 4 33.875 29.375 14.7 22.05 5 30.3 31.3 18.15 20.25 6 23.549999999999997 34.075 18.85 23.525 7 23.0 15.975 34.5 26.525 8 24.9 19.675 25.0 30.425 9 24.875 19.625 27.0 28.499999999999996 10-11 27.224999999999998 28.1625 19.1 25.5125 12-13 26.375 21.6125 24.212500000000002 27.800000000000004 14-15 26.937499999999996 22.525000000000002 24.375 26.1625 16-17 27.212500000000002 23.275000000000002 22.8125 26.700000000000003 18-19 27.450000000000003 22.175 23.0375 27.3375 20-21 27.0625 22.125 23.599999999999998 27.212500000000002 22-23 27.375 22.725 23.4125 26.487500000000004 24-25 27.750000000000004 22.775000000000002 22.6125 26.8625 26-27 26.875 23.425 22.287499999999998 27.4125 28-29 26.8125 23.549999999999997 22.7125 26.924999999999997 30-31 26.787499999999998 22.825 22.475 27.9125 32-33 26.1125 24.4375 23.1125 26.337500000000002 34-35 26.9625 23.974999999999998 22.400000000000002 26.6625 36-37 26.974999999999998 24.087500000000002 21.95 26.987499999999997 38-39 27.5125 23.125 22.7375 26.625 40-41 27.487499999999997 23.7625 22.3375 26.4125 42-43 27.187499999999996 23.275000000000002 21.912499999999998 27.625 44-45 27.737499999999997 23.575 22.1875 26.5 46-47 27.537499999999998 23.7125 22.5625 26.187500000000004 48-49 27.025 22.3375 22.5125 28.125 50-51 27.3125 23.8125 22.275 26.6 52-53 26.39409852463116 23.268317079269817 23.718429607401852 26.619154788697173 54-55 26.637499999999996 22.7625 23.1 27.500000000000004 56-57 26.92259597349006 23.28373139927473 22.958609478554457 26.835063148680753 58-59 27.125 23.849999999999998 22.237499999999997 26.787499999999998 60-61 27.250000000000004 22.725 22.175 27.85 62-63 26.8375 22.7 22.7625 27.700000000000003 64-65 26.732549412059043 22.979734801100825 22.9672254190643 27.32049036777583 66-67 26.747530323871448 22.84606727522821 23.096161060397648 27.31024134050269 68-69 27.425 22.8375 23.0875 26.650000000000002 70-71 26.924999999999997 22.3625 22.8625 27.85 72-73 26.81005377016381 23.22120795298237 22.84606727522821 27.12267100162561 74-75 27.2625 22.900000000000002 22.9625 26.875 76-77 27.2625 22.6125 22.5875 27.537499999999998 78-79 25.6125 22.925 23.474999999999998 27.987499999999997 80-81 26.55 23.25 22.912499999999998 27.287499999999998 82-83 27.650000000000002 22.5125 23.3375 26.5 84-85 27.625 22.8125 22.1375 27.425 86-87 27.325 22.162499999999998 22.912499999999998 27.6 88-89 27.1375 22.375 23.150000000000002 27.3375 90-91 27.500000000000004 22.7375 21.875 27.8875 92-93 26.637499999999996 23.200000000000003 22.0125 28.15 94-95 27.487499999999997 21.9375 23.1 27.474999999999998 96-97 27.05 22.3875 22.5 28.0625 98-99 27.775 23.2875 22.275 26.6625 100-101 27.0875 23.549999999999997 22.4875 26.875 102-103 27.287499999999998 22.525000000000002 22.275 27.9125 104-105 27.750000000000004 22.5 22.775000000000002 26.974999999999998 106-107 27.224999999999998 23.8625 22.1875 26.724999999999998 108-109 27.49874434957308 22.5891511803114 22.513812154696133 27.398292315419386 110-111 27.255615510101645 22.738110176935624 22.336554147320868 27.669720165641863 112-113 27.247509771781615 23.099230866221156 22.695750851090658 26.95750851090657 114-115 26.61816357250376 22.629202207727044 22.466131460110386 28.286502759658806 116-117 26.637499999999996 22.7625 22.1 28.499999999999996 118-119 28.9125 22.175 22.5875 26.325 120-121 28.675 22.0 23.25 26.075 122-123 27.5875 22.75 22.400000000000002 27.2625 124-125 27.275 23.4875 22.0 27.237499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.0 27 0.5 28 1.0 29 1.5 30 4.0 31 9.0 32 7.5 33 8.5 34 14.0 35 18.0 36 29.5 37 44.5 38 52.5 39 68.0 40 82.0 41 101.5 42 113.5 43 126.0 44 128.5 45 129.0 46 147.0 47 144.0 48 152.0 49 150.0 50 139.0 51 126.0 52 109.5 53 103.5 54 104.5 55 102.5 56 96.5 57 89.0 58 87.5 59 98.0 60 93.0 61 88.0 62 91.0 63 91.5 64 94.5 65 96.0 66 87.0 67 83.5 68 92.5 69 84.0 70 72.5 71 78.5 72 71.0 73 57.5 74 45.5 75 41.0 76 35.5 77 22.5 78 22.5 79 19.0 80 14.5 81 13.0 82 8.0 83 3.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.025 54-55 0.0 56-57 0.0375 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.075 66-67 0.0375 68-69 0.0 70-71 0.0 72-73 0.0375 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.44999999999999996 110-111 0.3875 112-113 0.8625 114-115 0.35000000000000003 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTCAG 15 0.0041033677 59.431248 28-29 >>END_MODULE Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649417 spots for SRR13662576.sra Written 649417 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra Read 649409 spots for SRR13662576.sra Written 649409 spots for SRR13662576.sra SRR ids: ['SRR13662576.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xhilk4wg SRR13662576.sra spots: 12988188 blocks: [[1, 649409], [649410, 1298818], [1298819, 1948227], [1948228, 2597636], [2597637, 3247045], [3247046, 3896454], [3896455, 4545863], [4545864, 5195272], [5195273, 5844681], [5844682, 6494090], [6494091, 7143499], [7143500, 7792908], [7792909, 8442317], [8442318, 9091726], [9091727, 9741135], [9741136, 10390544], [10390545, 11039953], [11039954, 11689362], [11689363, 12338771], [12338772, 12988188]] SRR13662576 file size 3732697 SRR13662576 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662576 SRR13662576_1.fastq SRR13662576_2.fastq Input file: SRR13662576_1.fastq Paired file: SRR13662576_2.fastq trimmed: SRR13662576-trimmed-pair1.fastq, SRR13662576-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:15:39 2024 >> started Tue Dec 10 07:15:52 2024 >> done (12.300s) 12988188 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 226 ( 0.00%) empty read pairs filtered out after trimming by size control 12987962 (100.00%) read pairs available; of these: 1667640 (12.84%) trimmed read pairs available after processing 11320322 (87.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 0 0.00% 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 2 0.00% 40 2 0.00% 41 0 0.00% 42 0 0.00% 43 1 0.00% 44 1 0.00% 45 1 0.00% 46 0 0.00% 47 1 0.00% 48 2 0.00% 49 0 0.00% 50 2 0.00% 51 2 0.00% 52 1 0.00% 53 3 0.00% 54 4 0.00% 55 4 0.00% 56 3 0.00% 57 2 0.00% 58 4 0.00% 59 11 0.00% 60 6 0.00% 61 4 0.00% 62 7 0.00% 63 30 0.00% 64 47 0.00% 65 69 0.00% 66 96 0.00% 67 110 0.00% 68 131 0.00% 69 145 0.00% 70 172 0.00% 71 218 0.00% 72 209 0.00% 73 250 0.00% 74 286 0.00% 75 322 0.00% 76 339 0.00% 77 378 0.00% 78 409 0.00% 79 488 0.00% 80 479 0.00% 81 538 0.00% 82 554 0.00% 83 674 0.01% 84 736 0.01% 85 706 0.01% 86 884 0.01% 87 945 0.01% 88 1021 0.01% 89 1131 0.01% 90 1305 0.01% 91 1497 0.01% 92 1706 0.01% 93 2228 0.02% 94 5617 0.04% 95 5751 0.04% 96 6137 0.05% 97 6514 0.05% 98 6826 0.05% 99 7198 0.06% 100 7552 0.06% 101 7837 0.06% 102 8278 0.06% 103 8639 0.07% 104 8980 0.07% 105 9526 0.07% 106 10178 0.08% 107 10781 0.08% 108 11677 0.09% 109 12273 0.09% 110 13530 0.10% 111 14764 0.11% 112 15985 0.12% 113 18164 0.14% 114 20383 0.16% 115 23780 0.18% 116 45093 0.35% 117 48232 0.37% 118 55378 0.43% 119 66627 0.51% 120 81697 0.63% 121 106121 0.82% 122 153263 1.18% 123 250744 1.93% 124 601944 4.63% 125 11320322 87.16% 12987962 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.57 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.9 sequence=CATCATCTGTGCTCCACCTGTCCCTGGCCGTGCTGGCCCTGGTGGCCGCATTGTCGGAGGCCGGGTTCTACGACCAGTTCGACGTGGGCGGCTCCGGCCAGCACGTCCGCGTGATCGAGGACGGCAAGACCCAGCAGGTGGCCCTCACGATGGACCAACGCTCCGGCGGTGCAGGGTTCACCTCCAAGGCCATGTACCTCTACGGCGAGTTCAGCGTCCAGATGAAGCTCGTCAGCGGCAACTCCGCTGGCACTGTCACCTCCTTCTACTTGAAGTCCGGGGAAGGCGAGGGCCATGACGAGATCGACATCGAGTTCATGGGCAACCTGAGCGGCAACCCCTACGTGATGAACACCAACGTCTGGGCCAACGGCGACGGCAAGAAGGAGCACCAGTTCTACCTCTGGTTCGACCCCTCCGCCGACTTCCACACCTACAAGATCGTCTGGAACCCCACGAACATCATATTCCAGGTGGACGACGTGCCGGTGAGGACGTTCAGGAAGTACGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=470.41 fanout-score-rank=1 prefix-density=1.24 prefix-fanout=28.2 sequence=CGCCGCCGCCGTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=3.0 sequence=CATCATCTGTGCTCCACCTGTCCCTGGCCGTGCTGGCCCTGGTGGCCGCATTGTCGGAGGCCGGGTTCTACGACCAGTTCGACGTGGGCGGCTCCGGCCAGCACGTCCGCGTGATCGAGGACGGCAAGACCCAGCAGGTGGCCCTCACGATGGACCAACGCTCCGGCGGTGCAGGGTTCACCTCCAAGGCCATGTACCTCTACGGCGAGTTCAGCGTCCAGATGAAGCTCGTCAGCGGCAACTCCGCTGGCACTGTCACCTCCTTCTACTTGAAGTCCGGGGAAGGCGAGGGCCATGACGAGATCGACATCGAGTTCATGGGCAACCTGAGCGGCAACCCCTACGTGATGAACACCAACGTCTGGGCCAACGGCGACGGCAAGAAGGAGCACCAGTTCTACCTCTGGTTCGACCCCTCCGCCGACTTCCACACCTACAAGATCGTCTGGAACCCCACGAACATCATATTCCAGGTGGACGACGTGCCGGTGAGGACGTTCAGGAAGTACGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=447.33 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=28.3 sequence=CGCCGCCGCCGA SRR13662576 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 10 07:22:37 Started mapping on | Dec 10 07:22:40 Finished on | Dec 10 07:23:28 Mapping speed, Million of reads per hour | 974.10 Number of input reads | 12987957 Average input read length | 228 UNIQUE READS: Uniquely mapped reads number | 11322472 Uniquely mapped reads % | 87.18% Average mapped length | 226.02 Number of splices: Total | 7938137 Number of splices: Annotated (sjdb) | 7481172 Number of splices: GT/AG | 7823531 Number of splices: GC/AG | 87067 Number of splices: AT/AC | 5075 Number of splices: Non-canonical | 22464 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.20 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453738 % of reads mapped to multiple loci | 3.49% Number of reads mapped to too many loci | 22380 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.03% % of reads unmapped: other | 1.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1217245 1217245 1217245 N_multimapping 453738 453738 453738 N_noFeature 319404 5731511 5709144 N_ambiguous 274229 38784 39077 UnstrandedReadsAssigned:10728839 PositiveStrandReadsAssigned:5552177 NegativeStrandReadsAssigned:5574251 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662576 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662576-trimmed-pair1.fastq SRR13662576-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,987,957 reads, 11,970,937 reads pseudoaligned [quant] estimated average fragment length: 183.725 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52973 SRR13662576.ke.tsv 35125 SRR13662576.se.tsv 88098 total ==> SRR13662576.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 753.496 0 0 PNS24247 1044 861.275 32.0238 4.23631 PNS24249 1928 1745.27 208.812 13.6316 PNS24246 1044 861.275 32.0238 4.23631 PNS24248 1044 861.275 32.0238 4.23631 PNS24244 1471 1288.27 43.117 3.81326 PNS24243 293 116.507 4 3.91168 KQK14069 1603 1420.27 4340.76 348.217 KQK14071 474 293.089 472.439 183.655 ==> SRR13662576.se.tsv <== BRADI_1g14170v3 4769 BRADI_1g53295v3 47 BRADI_1g59795v3 160 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 432 BRADI_1g74790v3 234 BRADI_1g09890v3 5 BRADI_1g77505v3 184 BRADI_1g48960v3 0 SRR13662576 completed mapping pipeline successfully