Starting /dee2/code/volunteer_pipeline.sh SRR13662577 current disk space = 1526519865344 free memory = 1407103748 SRR13662577 SRAfilesize d1632360f30226b37dfee69e2297c1f9 SRR13662577.sra SRR13662577.sra file validated SRR13662577 is paired end SRR13662577 is conventional basespace SRR13662577 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662577_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.33625 33.0 33.0 34.0 31.0 34.0 2 32.4355 33.0 33.0 34.0 31.0 34.0 3 32.121 33.0 33.0 34.0 28.0 34.0 4 32.25275 33.0 33.0 34.0 31.0 34.0 5 32.347 33.0 33.0 34.0 31.0 34.0 6 35.87275 38.0 36.0 38.0 31.0 38.0 7 36.60525 38.0 37.0 38.0 34.0 38.0 8 36.5955 38.0 38.0 38.0 34.0 38.0 9 36.6465 38.0 38.0 38.0 34.0 38.0 10-11 36.49725 38.0 38.0 38.0 34.0 38.0 12-13 36.44075 38.0 38.0 38.0 33.5 38.0 14-15 36.622 38.0 38.0 38.0 34.0 38.0 16-17 36.638999999999996 38.0 38.0 38.0 34.0 38.0 18-19 36.76725 38.0 38.0 38.0 34.0 38.0 20-21 36.746125 38.0 38.0 38.0 34.0 38.0 22-23 36.767125 38.0 38.0 38.0 35.0 38.0 24-25 36.77175 38.0 38.0 38.0 34.5 38.0 26-27 36.643375 38.0 38.0 38.0 34.0 38.0 28-29 36.676375 38.0 38.0 38.0 34.0 38.0 30-31 36.65625 38.0 38.0 38.0 34.0 38.0 32-33 36.561499999999995 38.0 38.0 38.0 34.0 38.0 34-35 36.595375000000004 38.0 38.0 38.0 34.0 38.0 36-37 36.63325 38.0 38.0 38.0 34.0 38.0 38-39 36.612375 38.0 38.0 38.0 34.0 38.0 40-41 36.606875 38.0 38.0 38.0 34.0 38.0 42-43 36.477625 38.0 38.0 38.0 33.5 38.0 44-45 36.441375 38.0 38.0 38.0 33.5 38.0 46-47 36.528499999999994 38.0 38.0 38.0 34.0 38.0 48-49 36.489625000000004 38.0 38.0 38.0 34.0 38.0 50-51 36.373625000000004 38.0 38.0 38.0 33.0 38.0 52-53 36.2265 38.0 38.0 38.0 33.0 38.0 54-55 36.514624999999995 38.0 38.0 38.0 34.0 38.0 56-57 36.408 38.0 38.0 38.0 33.5 38.0 58-59 36.490875 38.0 38.0 38.0 34.0 38.0 60-61 36.618875 38.0 38.0 38.0 34.0 38.0 62-63 36.446625 38.0 38.0 38.0 33.5 38.0 64-65 36.284499999999994 38.0 38.0 38.0 33.0 38.0 66-67 36.389250000000004 38.0 38.0 38.0 33.5 38.0 68-69 36.480875 38.0 38.0 38.0 34.0 38.0 70-71 36.32625 38.0 38.0 38.0 33.5 38.0 72-73 36.094375 38.0 37.5 38.0 32.5 38.0 74-75 36.18775 38.0 38.0 38.0 33.0 38.0 76-77 36.425625 38.0 38.0 38.0 34.0 38.0 78-79 36.12375 38.0 37.5 38.0 33.0 38.0 80-81 36.114000000000004 38.0 37.5 38.0 32.5 38.0 82-83 36.042249999999996 38.0 37.0 38.0 32.0 38.0 84-85 36.238375 38.0 38.0 38.0 33.0 38.0 86-87 35.81375 38.0 37.0 38.0 31.0 38.0 88-89 35.798 38.0 37.0 38.0 32.0 38.0 90-91 35.927875 38.0 37.0 38.0 32.0 38.0 92-93 35.735125 38.0 37.0 38.0 30.5 38.0 94-95 35.775875 38.0 37.0 38.0 31.5 38.0 96-97 35.719125 38.0 37.0 38.0 30.5 38.0 98-99 35.93 38.0 37.0 38.0 32.5 38.0 100-101 35.69375 38.0 37.0 38.0 31.0 38.0 102-103 35.490875 38.0 36.5 38.0 29.5 38.0 104-105 35.604124999999996 38.0 37.0 38.0 31.0 38.0 106-107 35.132 38.0 36.0 38.0 28.0 38.0 108-109 35.4755 38.0 36.5 38.0 30.0 38.0 110-111 35.54275 38.0 36.5 38.0 30.0 38.0 112-113 35.570375 38.0 36.0 38.0 31.0 38.0 114-115 35.11025 38.0 35.5 38.0 28.5 38.0 116-117 35.104124999999996 38.0 36.0 38.0 28.5 38.0 118-119 34.886125 38.0 35.5 38.0 27.0 38.0 120-121 34.554249999999996 38.0 35.0 38.0 25.5 38.0 122-123 34.19925 38.0 35.0 38.0 24.5 38.0 124-125 33.876374999999996 38.0 35.0 38.0 23.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 4.0 15 5.0 16 1.0 17 2.0 18 1.0 19 0.0 20 2.0 21 3.0 22 7.0 23 7.0 24 17.0 25 20.0 26 19.0 27 32.0 28 40.0 29 63.0 30 82.0 31 99.0 32 117.0 33 163.0 34 186.0 35 285.0 36 544.0 37 2301.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.975 12.4 9.75 37.875 2 30.0 17.599999999999998 29.599999999999998 22.8 3 27.675 23.25 20.025000000000002 29.049999999999997 4 29.775000000000002 29.225 16.2 24.8 5 30.049999999999997 30.075000000000003 18.224999999999998 21.65 6 23.1 35.199999999999996 19.35 22.35 7 21.425 15.225 38.224999999999994 25.124999999999996 8 23.549999999999997 19.975 25.624999999999996 30.85 9 25.074999999999996 19.225 26.8 28.9 10-11 27.0875 28.8375 18.9 25.174999999999997 12-13 25.2875 22.8875 25.35 26.474999999999998 14-15 26.25 23.200000000000003 23.8875 26.6625 16-17 25.9875 23.2625 24.2375 26.5125 18-19 25.912499999999998 23.0 23.8625 27.224999999999998 20-21 27.0875 23.7375 23.375 25.8 22-23 26.1 24.675 22.85 26.375 24-25 25.7 23.525 22.85 27.925 26-27 25.8625 25.025 22.2125 26.900000000000002 28-29 26.0 23.724999999999998 23.1875 27.0875 30-31 25.650000000000002 23.8625 23.7375 26.75 32-33 25.4875 23.962500000000002 23.9125 26.637499999999996 34-35 27.1625 22.537499999999998 23.9375 26.3625 36-37 26.724999999999998 22.650000000000002 24.125 26.5 38-39 26.3125 23.7625 23.125 26.8 40-41 26.5375 23.2125 23.1375 27.1125 42-43 25.174999999999997 23.3625 23.75 27.712500000000002 44-45 25.775 23.599999999999998 23.7625 26.8625 46-47 26.900000000000002 24.087500000000002 22.7375 26.275 48-49 26.25 23.6125 23.6625 26.474999999999998 50-51 27.0625 24.125 22.900000000000002 25.912499999999998 52-53 26.387500000000003 23.7125 23.400000000000002 26.5 54-55 26.825 23.1125 22.8125 27.250000000000004 56-57 26.2625 22.975 23.2875 27.474999999999998 58-59 25.587500000000002 23.6375 23.599999999999998 27.175 60-61 26.775 23.3875 23.2875 26.55 62-63 26.237500000000004 22.725 24.275 26.7625 64-65 27.037499999999998 23.1875 23.150000000000002 26.625 66-67 26.7625 23.5125 22.775000000000002 26.950000000000003 68-69 26.5625 23.225 23.25 26.9625 70-71 26.450000000000003 22.825 23.625 27.1 72-73 26.200000000000003 23.3 22.9625 27.537499999999998 74-75 26.174999999999997 23.2875 23.400000000000002 27.1375 76-77 26.85 23.849999999999998 23.0375 26.2625 78-79 26.400000000000002 23.1125 23.1125 27.375 80-81 25.650000000000002 24.175 23.575 26.6 82-83 28.012500000000003 22.5625 23.5125 25.912499999999998 84-85 26.724999999999998 23.724999999999998 23.175 26.375 86-87 27.625 22.675 22.9625 26.737499999999997 88-89 26.625 24.025 22.7 26.650000000000002 90-91 26.375 23.025000000000002 24.1875 26.4125 92-93 26.337500000000002 22.7375 22.725 28.199999999999996 94-95 25.7 22.8375 23.799999999999997 27.6625 96-97 26.4625 23.849999999999998 23.025000000000002 26.6625 98-99 26.6 23.225 23.2875 26.887499999999996 100-101 27.150000000000002 23.075000000000003 23.65 26.125 102-103 26.187500000000004 22.8375 23.325000000000003 27.650000000000002 104-105 26.8625 23.575 23.599999999999998 25.9625 106-107 27.200000000000003 23.0125 23.525 26.2625 108-109 26.1625 23.849999999999998 23.575 26.4125 110-111 26.487500000000004 23.1625 23.65 26.700000000000003 112-113 26.5875 23.4125 22.725 27.275 114-115 26.787499999999998 23.1125 23.425 26.674999999999997 116-117 25.525 24.125 23.5375 26.8125 118-119 27.775 23.65 22.55 26.025 120-121 26.674999999999997 22.7 23.575 27.05 122-123 26.05 23.625 23.1875 27.1375 124-125 28.199999999999996 23.3625 22.3125 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.5 26 1.0 27 0.5 28 1.0 29 3.0 30 5.0 31 6.0 32 6.0 33 9.5 34 14.0 35 19.5 36 24.5 37 44.0 38 65.5 39 72.0 40 81.5 41 108.0 42 135.0 43 154.0 44 159.5 45 149.5 46 148.5 47 152.0 48 150.5 49 152.0 50 146.0 51 130.0 52 120.0 53 114.0 54 100.0 55 96.0 56 105.5 57 97.0 58 91.0 59 98.5 60 96.0 61 88.5 62 84.5 63 81.0 64 75.5 65 79.0 66 76.5 67 70.0 68 75.0 69 69.5 70 65.0 71 62.5 72 53.0 73 51.0 74 43.5 75 35.5 76 36.0 77 27.0 78 14.5 79 10.5 80 12.5 81 12.5 82 9.0 83 2.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662577 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662577_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.35675 33.0 32.0 34.0 25.0 34.0 2 31.1705 33.0 32.0 34.0 18.0 34.0 3 31.3185 33.0 32.0 34.0 25.0 34.0 4 31.23225 33.0 32.0 34.0 25.0 34.0 5 30.85575 33.0 32.0 34.0 15.0 34.0 6 34.80675 38.0 35.0 38.0 26.0 38.0 7 34.64625 38.0 36.0 38.0 26.0 38.0 8 34.9105 38.0 36.0 38.0 26.0 38.0 9 34.244 38.0 35.0 38.0 16.0 38.0 10-11 34.8445 38.0 36.0 38.0 26.0 38.0 12-13 35.056 38.0 36.0 38.0 27.0 38.0 14-15 34.887625 38.0 36.0 38.0 26.5 38.0 16-17 34.986999999999995 38.0 36.0 38.0 27.0 38.0 18-19 34.4525 38.0 35.0 38.0 20.5 38.0 20-21 34.824 38.0 36.0 38.0 26.0 38.0 22-23 35.102999999999994 38.0 36.0 38.0 27.0 38.0 24-25 34.948 38.0 36.0 38.0 26.0 38.0 26-27 35.032624999999996 38.0 36.0 38.0 26.0 38.0 28-29 34.79425 38.0 35.5 38.0 26.0 38.0 30-31 34.60525 38.0 35.5 38.0 24.5 38.0 32-33 34.88775 38.0 35.5 38.0 26.0 38.0 34-35 35.126374999999996 38.0 36.0 38.0 27.0 38.0 36-37 34.668875 38.0 35.5 38.0 24.5 38.0 38-39 34.524375 38.0 35.5 38.0 24.5 38.0 40-41 35.07275 38.0 36.0 38.0 26.0 38.0 42-43 35.1565 38.0 36.0 38.0 27.0 38.0 44-45 35.1415 38.0 36.0 38.0 27.0 38.0 46-47 34.9565 38.0 36.0 38.0 26.0 38.0 48-49 34.804 38.0 35.5 38.0 25.0 38.0 50-51 34.556 38.0 35.0 38.0 25.0 38.0 52-53 35.16875 38.0 36.0 38.0 27.0 38.0 54-55 35.379875 38.0 36.0 38.0 28.5 38.0 56-57 35.2845 38.0 36.0 38.0 27.5 38.0 58-59 35.351124999999996 38.0 36.0 38.0 28.0 38.0 60-61 35.468500000000006 38.0 36.0 38.0 29.0 38.0 62-63 35.045500000000004 38.0 36.0 38.0 27.0 38.0 64-65 35.042125 38.0 36.0 38.0 26.0 38.0 66-67 34.661125 38.0 35.5 38.0 24.5 38.0 68-69 35.472125 38.0 36.5 38.0 28.5 38.0 70-71 35.376999999999995 38.0 36.0 38.0 28.5 38.0 72-73 35.101749999999996 38.0 36.0 38.0 27.5 38.0 74-75 35.05200000000001 38.0 36.0 38.0 26.5 38.0 76-77 35.44725 38.0 36.5 38.0 28.5 38.0 78-79 34.950874999999996 38.0 35.5 38.0 26.0 38.0 80-81 35.069375 38.0 36.0 38.0 27.5 38.0 82-83 34.85425 38.0 36.0 38.0 26.0 38.0 84-85 35.221875 38.0 36.0 38.0 28.0 38.0 86-87 34.984125 38.0 36.0 38.0 26.5 38.0 88-89 34.748875 38.0 35.5 38.0 25.5 38.0 90-91 35.148875000000004 38.0 36.0 38.0 27.5 38.0 92-93 35.107875 38.0 36.0 38.0 28.0 38.0 94-95 35.301125 38.0 36.0 38.0 29.0 38.0 96-97 34.966375 38.0 35.5 38.0 27.0 38.0 98-99 34.892125 38.0 35.5 38.0 27.0 38.0 100-101 34.448499999999996 38.0 35.5 38.0 20.5 38.0 102-103 34.530625 38.0 35.0 38.0 24.0 38.0 104-105 34.4815 38.0 35.0 38.0 24.5 38.0 106-107 34.521875 38.0 35.0 38.0 24.0 38.0 108-109 34.334625 38.0 35.0 38.0 24.0 38.0 110-111 34.727125 38.0 35.0 38.0 27.0 38.0 112-113 34.562 38.0 35.5 38.0 24.5 38.0 114-115 33.990375 38.0 35.0 38.0 22.0 38.0 116-117 34.51925 38.0 35.0 38.0 26.0 38.0 118-119 34.095375000000004 38.0 35.0 38.0 24.0 38.0 120-121 33.914625 38.0 35.0 38.0 23.0 38.0 122-123 33.702625 38.0 35.0 38.0 22.0 38.0 124-125 32.877250000000004 38.0 34.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 5.0 15 5.0 16 9.0 17 7.0 18 9.0 19 14.0 20 12.0 21 17.0 22 31.0 23 51.0 24 49.0 25 48.0 26 74.0 27 61.0 28 98.0 29 97.0 30 104.0 31 119.0 32 127.0 33 180.0 34 191.0 35 294.0 36 506.0 37 1888.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.375 11.0 11.4 38.224999999999994 2 30.575000000000003 17.325 29.675 22.425 3 26.900000000000002 22.675 20.025000000000002 30.4 4 29.65 28.1 16.85 25.4 5 29.425 30.25 19.7 20.625 6 22.575 33.35 21.224999999999998 22.85 7 20.8 15.625 37.35 26.224999999999998 8 24.0 21.25 25.525 29.225 9 23.849999999999998 19.875 28.075 28.199999999999996 10-11 26.7125 28.799999999999997 19.9875 24.5 12-13 26.137500000000003 21.625 25.4375 26.8 14-15 26.137500000000003 22.325 24.6625 26.875 16-17 26.825 23.65 23.2875 26.237500000000004 18-19 26.737499999999997 23.1375 23.8125 26.3125 20-21 26.0375 23.3875 23.4625 27.1125 22-23 26.5375 24.637500000000003 22.55 26.275 24-25 26.05 23.925 23.7875 26.237500000000004 26-27 26.05 24.587500000000002 23.400000000000002 25.9625 28-29 26.1 23.875 23.5 26.525 30-31 25.5 24.099999999999998 24.025 26.375 32-33 26.2875 24.4125 23.2375 26.0625 34-35 26.400000000000002 24.6875 22.475 26.437500000000004 36-37 25.85 24.925 23.3375 25.887500000000003 38-39 26.0625 23.0875 23.599999999999998 27.250000000000004 40-41 25.825 23.849999999999998 23.9 26.424999999999997 42-43 26.7125 23.125 23.35 26.8125 44-45 26.1625 23.275000000000002 24.15 26.4125 46-47 26.150000000000002 24.0 23.875 25.974999999999998 48-49 26.937499999999996 23.625 23.400000000000002 26.0375 50-51 26.85 23.95 23.0 26.200000000000003 52-53 27.1125 23.974999999999998 23.425 25.4875 54-55 26.85 22.875 24.1375 26.137500000000003 56-57 26.200000000000003 23.5625 23.525 26.7125 58-59 26.224999999999998 23.275000000000002 23.1625 27.3375 60-61 26.3125 23.325000000000003 23.125 27.237499999999997 62-63 26.35 23.275000000000002 23.400000000000002 26.974999999999998 64-65 26.737499999999997 22.7125 23.9375 26.6125 66-67 26.637499999999996 23.2625 23.45 26.650000000000002 68-69 26.5125 23.7625 23.625 26.1 70-71 27.125 23.4625 23.05 26.3625 72-73 27.212500000000002 23.2125 23.025000000000002 26.55 74-75 26.525 23.5 23.575 26.400000000000002 76-77 26.224999999999998 23.95 22.675 27.150000000000002 78-79 25.924999999999997 22.912499999999998 23.674999999999997 27.487499999999997 80-81 27.037499999999998 23.75 23.1625 26.05 82-83 26.8125 23.8875 23.1125 26.187500000000004 84-85 26.55 23.0 23.674999999999997 26.775 86-87 26.424999999999997 23.2125 23.0 27.3625 88-89 26.224999999999998 23.25 23.525 27.0 90-91 26.337500000000002 23.75 22.725 27.187499999999996 92-93 26.924999999999997 22.5875 23.65 26.8375 94-95 27.150000000000002 23.025000000000002 22.9875 26.8375 96-97 25.650000000000002 22.775000000000002 23.9875 27.5875 98-99 26.974999999999998 22.412499999999998 23.8875 26.724999999999998 100-101 26.900000000000002 22.775000000000002 23.425 26.900000000000002 102-103 26.525 23.525 23.3875 26.5625 104-105 26.4625 24.0625 22.925 26.55 106-107 26.400000000000002 23.3875 23.474999999999998 26.737499999999997 108-109 26.5875 22.8625 23.6875 26.8625 110-111 25.525 23.9875 23.8875 26.6 112-113 27.05 22.825 23.599999999999998 26.525 114-115 26.75 23.1875 23.075000000000003 26.987499999999997 116-117 26.5625 23.4375 24.3125 25.687500000000004 118-119 27.425 22.775000000000002 22.85 26.950000000000003 120-121 26.325 23.225 23.425 27.025 122-123 26.3625 23.0 23.799999999999997 26.8375 124-125 27.3125 23.150000000000002 23.0 26.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 1.5 27 3.0 28 3.0 29 2.5 30 4.5 31 7.5 32 8.5 33 13.5 34 18.5 35 24.0 36 34.5 37 41.0 38 54.5 39 76.5 40 98.0 41 115.0 42 132.5 43 150.0 44 148.0 45 153.5 46 162.0 47 152.5 48 144.0 49 131.0 50 132.5 51 141.0 52 128.0 53 111.0 54 109.5 55 113.5 56 100.0 57 94.0 58 88.0 59 79.5 60 81.0 61 82.0 62 81.5 63 83.5 64 87.0 65 80.5 66 84.5 67 82.5 68 69.5 69 68.0 70 64.0 71 56.5 72 51.0 73 48.5 74 50.0 75 39.5 76 29.5 77 26.0 78 19.5 79 14.0 80 10.0 81 6.5 82 3.5 83 2.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654576 spots for SRR13662577.sra Written 654576 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra Read 654570 spots for SRR13662577.sra Written 654570 spots for SRR13662577.sra SRR ids: ['SRR13662577.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_if3hogdf SRR13662577.sra spots: 13091406 blocks: [[1, 654570], [654571, 1309140], [1309141, 1963710], [1963711, 2618280], [2618281, 3272850], [3272851, 3927420], [3927421, 4581990], [4581991, 5236560], [5236561, 5891130], [5891131, 6545700], [6545701, 7200270], [7200271, 7854840], [7854841, 8509410], [8509411, 9163980], [9163981, 9818550], [9818551, 10473120], [10473121, 11127690], [11127691, 11782260], [11782261, 12436830], [12436831, 13091406]] SRR13662577 file size 3762534 SRR13662577 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662577 SRR13662577_1.fastq SRR13662577_2.fastq Input file: SRR13662577_1.fastq Paired file: SRR13662577_2.fastq trimmed: SRR13662577-trimmed-pair1.fastq, SRR13662577-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:23:48 2024 >> started Tue Dec 10 07:24:03 2024 >> done (14.217s) 13091406 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 359 ( 0.00%) empty read pairs filtered out after trimming by size control 13091047 (100.00%) read pairs available; of these: 1614797 (12.34%) trimmed read pairs available after processing 11476250 (87.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 2 0.00% 35 3 0.00% 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 2 0.00% 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 1 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 0 0.00% 51 3 0.00% 52 1 0.00% 53 1 0.00% 54 1 0.00% 55 1 0.00% 56 5 0.00% 57 5 0.00% 58 5 0.00% 59 3 0.00% 60 8 0.00% 61 1 0.00% 62 9 0.00% 63 19 0.00% 64 64 0.00% 65 49 0.00% 66 73 0.00% 67 99 0.00% 68 115 0.00% 69 124 0.00% 70 161 0.00% 71 173 0.00% 72 197 0.00% 73 223 0.00% 74 249 0.00% 75 280 0.00% 76 309 0.00% 77 337 0.00% 78 370 0.00% 79 457 0.00% 80 455 0.00% 81 467 0.00% 82 509 0.00% 83 556 0.00% 84 589 0.00% 85 691 0.01% 86 735 0.01% 87 846 0.01% 88 930 0.01% 89 1028 0.01% 90 1150 0.01% 91 1366 0.01% 92 1572 0.01% 93 2050 0.02% 94 5501 0.04% 95 5692 0.04% 96 6040 0.05% 97 6135 0.05% 98 6581 0.05% 99 6902 0.05% 100 7220 0.06% 101 7627 0.06% 102 7936 0.06% 103 8418 0.06% 104 8719 0.07% 105 9009 0.07% 106 9652 0.07% 107 10021 0.08% 108 10806 0.08% 109 11534 0.09% 110 12651 0.10% 111 13931 0.11% 112 15726 0.12% 113 17040 0.13% 114 18907 0.14% 115 21358 0.16% 116 37584 0.29% 117 43374 0.33% 118 50593 0.39% 119 61350 0.47% 120 76518 0.58% 121 101721 0.78% 122 147458 1.13% 123 247744 1.89% 124 604748 4.62% 125 11476250 87.66% 13091047 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.87 fanout-score-rank=32 prefix-density=0.18 prefix-fanout=3.0 sequence=CATCATCTGTGCTCCACCTGTCCCTGGCCGTGCTGGCCCTGGTGGCCGCATTGTCGGAGGCCGGGTTCTACGACCAGTTCGACGTGGGCGGCTCCGGCCAGCACGTCCGCGTGATCGAGGACGGCAAGACCCAGCAGGTGGCCCTCACGATGGACCAACGCTCCGGCGGTGCAGGGTTCACCTCCAAGGCCATGTACCTCTACGGCGAGTTCAGCGTCCAGATGAAGCTCGTCAGCGGCAACTCCGCTGGCACTGTCACCTCCTTCTACTTGAAGTCCGGGGAAGGCGAGGGCCATGACGAGATCGACATCGAGTTCATGGGCAACCTGAGCGGCAACCCCTACGTGATGAACACCAACGTCTGGGCCAACGGCGACGGCAAGAAGGAGCACCAGTTCTACCTCTGGTTCGACCCCTCCGCCGACTTCCACACCTACAAGATCGTCTGGAACCCCACGAACATCATATTCCAGGTGGACGACGTGCCGGTGAGGACGTTCAGGAAGTACGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=457.64 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=27.6 sequence=CGCCGCCGCCATC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.03 fanout-score-rank=35 prefix-density=0.17 prefix-fanout=3.1 sequence=CATCATCTGTGCTCCACCTGTCCCTGGCCGTGCTGGCCCTGGTGGCCGCATTGTCGGAGGCCGGGTTCTACGACCAGTTCGACGTGGGCGGCTCCGGCCAGCACGTCCGCGTGATCGAGGACGGCAAGACCCAGCAGGTGGCCCTCACGATGGACCAACGCTCCGGCGGTGCAGGGTTCACCTCCAAGGCCATGTACCTCTACGGCGAGTTCAGCGTCCAGATGAAGCTCGTCAGCGGCAACTCCGCTGGCACTGTCACCTCCTTCTACTTGAAGTCCGGGGAAGGCGAGGGCCATGACGAGATCGACATCGAGTTCATGGGCAACCTGAGCGGCAACCCCTACGTGATGAACACCAACGTCTGGGCCAACGGCGACGGCAAGAAGGAGCACCAGTTCTACCTCTGGTTCGACCCCTCCGCCGACTTCCACACCTACAAGATCGTCTGGAACCCCACGAACATCATATTCCAGGTGGACGACGTGCCGGTGAGGACGTTCAGGAAGTACGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=479.04 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=28.6 sequence=CGCCGCCGCCATC SRR13662577 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:24:55 Started mapping on | Dec 10 07:25:06 Finished on | Dec 10 07:26:05 Mapping speed, Million of reads per hour | 798.78 Number of input reads | 13091047 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 12153102 Uniquely mapped reads % | 92.84% Average mapped length | 246.70 Number of splices: Total | 9130187 Number of splices: Annotated (sjdb) | 8615208 Number of splices: GT/AG | 9000558 Number of splices: GC/AG | 98910 Number of splices: AT/AC | 5644 Number of splices: Non-canonical | 25075 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454160 % of reads mapped to multiple loci | 3.47% Number of reads mapped to too many loci | 18148 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.75% % of reads unmapped: other | 0.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 483862 483862 483862 N_multimapping 454160 454160 454160 N_noFeature 362986 6154089 6147644 N_ambiguous 260029 25262 25362 UnstrandedReadsAssigned:11530087 PositiveStrandReadsAssigned:5973751 NegativeStrandReadsAssigned:5980096 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662577 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662577-trimmed-pair1.fastq SRR13662577-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,091,047 reads, 12,084,815 reads pseudoaligned [quant] estimated average fragment length: 207.161 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52973 SRR13662577.ke.tsv 35125 SRR13662577.se.tsv 88098 total ==> SRR13662577.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 730.177 0 0 PNS24247 1044 837.839 35.5597 4.81762 PNS24249 1928 1721.84 201.058 13.2545 PNS24246 1044 837.839 35.5597 4.81762 PNS24248 1044 837.839 35.5597 4.81762 PNS24244 1471 1264.84 37.2625 3.34404 PNS24243 293 96.8744 9 10.5455 KQK14069 1603 1396.84 4607.05 374.379 KQK14071 474 270.041 204.79 86.0826 ==> SRR13662577.se.tsv <== BRADI_1g14170v3 5060 BRADI_1g53295v3 49 BRADI_1g59795v3 190 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 361 BRADI_1g74790v3 310 BRADI_1g09890v3 5 BRADI_1g77505v3 193 BRADI_1g48960v3 0 SRR13662577 completed mapping pipeline successfully