Starting /dee2/code/volunteer_pipeline.sh SRR13662578 current disk space = 1526523043840 free memory = 1550992488 SRR13662578 SRAfilesize 506b624aac8f2e212c34a7890534f0f7 SRR13662578.sra SRR13662578.sra file validated SRR13662578 is paired end SRR13662578 is conventional basespace SRR13662578 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662578_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39975 33.0 33.0 34.0 31.0 34.0 2 32.40275 33.0 33.0 34.0 31.0 34.0 3 32.354 33.0 33.0 34.0 30.0 34.0 4 32.36375 33.0 33.0 34.0 31.0 34.0 5 32.3885 33.0 33.0 34.0 31.0 34.0 6 35.8855 38.0 36.0 38.0 31.0 38.0 7 36.32525 38.0 37.0 38.0 33.0 38.0 8 36.4935 38.0 38.0 38.0 34.0 38.0 9 36.58525 38.0 38.0 38.0 34.0 38.0 10-11 36.558375 38.0 38.0 38.0 34.0 38.0 12-13 36.629374999999996 38.0 38.0 38.0 34.0 38.0 14-15 36.696875000000006 38.0 38.0 38.0 34.5 38.0 16-17 36.649875 38.0 38.0 38.0 34.0 38.0 18-19 36.71787500000001 38.0 38.0 38.0 34.0 38.0 20-21 36.707750000000004 38.0 38.0 38.0 34.5 38.0 22-23 36.650125 38.0 38.0 38.0 34.0 38.0 24-25 36.637 38.0 38.0 38.0 34.0 38.0 26-27 36.639624999999995 38.0 38.0 38.0 34.0 38.0 28-29 36.52225 38.0 38.0 38.0 34.0 38.0 30-31 36.598749999999995 38.0 38.0 38.0 34.0 38.0 32-33 36.491 38.0 38.0 38.0 33.5 38.0 34-35 36.646 38.0 38.0 38.0 34.0 38.0 36-37 36.509875 38.0 38.0 38.0 33.5 38.0 38-39 36.468875 38.0 38.0 38.0 34.0 38.0 40-41 36.454 38.0 38.0 38.0 33.5 38.0 42-43 36.47475 38.0 38.0 38.0 34.0 38.0 44-45 36.445875 38.0 38.0 38.0 33.5 38.0 46-47 36.478 38.0 38.0 38.0 34.0 38.0 48-49 36.38975 38.0 38.0 38.0 33.5 38.0 50-51 36.470125 38.0 38.0 38.0 34.0 38.0 52-53 36.551625 38.0 38.0 38.0 34.0 38.0 54-55 36.360625 38.0 38.0 38.0 33.5 38.0 56-57 36.440875 38.0 38.0 38.0 34.0 38.0 58-59 36.4895 38.0 38.0 38.0 34.0 38.0 60-61 36.327375 38.0 38.0 38.0 33.0 38.0 62-63 36.364000000000004 38.0 38.0 38.0 33.0 38.0 64-65 36.547375 38.0 38.0 38.0 34.0 38.0 66-67 36.53975 38.0 38.0 38.0 34.0 38.0 68-69 36.54375 38.0 38.0 38.0 34.0 38.0 70-71 36.3945 38.0 38.0 38.0 33.5 38.0 72-73 35.80875 38.0 37.0 38.0 31.0 38.0 74-75 36.18575 38.0 37.5 38.0 33.0 38.0 76-77 36.288624999999996 38.0 38.0 38.0 33.5 38.0 78-79 36.17975 38.0 37.5 38.0 32.5 38.0 80-81 36.174125000000004 38.0 38.0 38.0 33.0 38.0 82-83 35.88312500000001 38.0 37.0 38.0 31.5 38.0 84-85 36.189750000000004 38.0 38.0 38.0 33.0 38.0 86-87 36.047125 38.0 37.5 38.0 33.0 38.0 88-89 35.984875 38.0 37.0 38.0 31.5 38.0 90-91 36.04275 38.0 37.0 38.0 32.5 38.0 92-93 35.863625 38.0 37.0 38.0 31.5 38.0 94-95 35.556625 38.0 36.5 38.0 30.0 38.0 96-97 35.68325 38.0 37.0 38.0 31.0 38.0 98-99 35.611000000000004 38.0 36.5 38.0 30.0 38.0 100-101 35.940875000000005 38.0 37.0 38.0 32.5 38.0 102-103 35.458 38.0 36.0 38.0 30.0 38.0 104-105 35.461875 38.0 36.0 38.0 30.0 38.0 106-107 35.392375 38.0 36.0 38.0 29.0 38.0 108-109 35.518 38.0 36.5 38.0 31.0 38.0 110-111 35.399125 38.0 36.0 38.0 30.0 38.0 112-113 35.298874999999995 38.0 36.0 38.0 29.5 38.0 114-115 35.42075 38.0 36.0 38.0 30.0 38.0 116-117 35.481 38.0 36.0 38.0 31.0 38.0 118-119 34.797124999999994 38.0 35.5 38.0 27.5 38.0 120-121 34.582750000000004 38.0 35.0 38.0 26.0 38.0 122-123 34.27525 38.0 35.0 38.0 24.0 38.0 124-125 33.8005 38.0 35.0 38.0 23.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 4.0 18 2.0 19 2.0 20 5.0 21 3.0 22 6.0 23 6.0 24 20.0 25 17.0 26 30.0 27 27.0 28 51.0 29 61.0 30 75.0 31 98.0 32 135.0 33 153.0 34 184.0 35 291.0 36 488.0 37 2341.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.225 11.325000000000001 10.775 37.675 2 31.35 16.825000000000003 29.625 22.2 3 26.674999999999997 22.15 19.925 31.25 4 31.075000000000003 28.825 16.225 23.875 5 31.175000000000004 29.75 18.425 20.65 6 23.75 34.725 19.0 22.525000000000002 7 21.275 16.675 37.574999999999996 24.474999999999998 8 24.025 20.775 24.525 30.675 9 23.525 19.55 27.224999999999998 29.7 10-11 26.8 28.749999999999996 19.5125 24.9375 12-13 24.7875 22.0125 25.4625 27.737499999999997 14-15 25.624999999999996 24.15 24.05 26.174999999999997 16-17 27.125 23.549999999999997 23.1 26.224999999999998 18-19 26.1625 24.15 23.4125 26.275 20-21 26.224999999999998 24.325 23.8625 25.587500000000002 22-23 26.0 24.3875 22.9875 26.625 24-25 26.075 24.1875 23.1125 26.625 26-27 26.3125 24.05 23.7375 25.900000000000002 28-29 26.5375 23.75 23.0375 26.674999999999997 30-31 26.487500000000004 23.9375 23.1125 26.4625 32-33 26.9625 24.1625 22.6 26.275 34-35 26.1125 24.587500000000002 22.8 26.5 36-37 25.924999999999997 23.775 23.35 26.950000000000003 38-39 27.187499999999996 24.375 22.5 25.937500000000004 40-41 27.2625 23.95 23.200000000000003 25.587500000000002 42-43 26.5875 22.8125 24.1625 26.437500000000004 44-45 26.625 24.65 22.0625 26.6625 46-47 26.450000000000003 24.075 23.075000000000003 26.400000000000002 48-49 26.0375 23.9875 23.3 26.674999999999997 50-51 26.5875 23.375 23.775 26.2625 52-53 27.325 23.25 23.125 26.3 54-55 26.474999999999998 23.7 22.9375 26.887499999999996 56-57 25.6125 24.025 24.0 26.3625 58-59 26.275 23.05 23.625 27.05 60-61 26.575 23.9125 22.3875 27.125 62-63 26.8625 23.6125 23.3875 26.137500000000003 64-65 27.6125 22.9625 23.7875 25.637500000000003 66-67 26.55 23.3875 23.400000000000002 26.6625 68-69 26.35 24.212500000000002 23.1875 26.25 70-71 26.174999999999997 24.9125 23.125 25.7875 72-73 26.9625 22.900000000000002 23.724999999999998 26.4125 74-75 27.3375 23.3625 23.375 25.924999999999997 76-77 26.85 23.0375 23.925 26.187500000000004 78-79 27.0 23.150000000000002 23.1 26.75 80-81 26.650000000000002 23.5 22.8125 27.037499999999998 82-83 27.037499999999998 23.4125 23.65 25.900000000000002 84-85 27.237499999999997 23.35 22.775000000000002 26.637499999999996 86-87 28.1125 22.875 22.45 26.5625 88-89 26.237500000000004 23.8375 23.400000000000002 26.525 90-91 26.687499999999996 24.525 22.2 26.5875 92-93 25.900000000000002 24.1625 23.3625 26.575 94-95 26.674999999999997 23.05 22.95 27.325 96-97 26.5 23.674999999999997 23.2375 26.5875 98-99 26.7625 23.8375 23.0375 26.3625 100-101 26.7125 23.7375 23.0 26.55 102-103 26.125 24.224999999999998 22.8375 26.8125 104-105 26.625 23.35 24.3 25.724999999999998 106-107 26.6625 23.200000000000003 23.225 26.9125 108-109 26.25 23.5875 24.05 26.1125 110-111 26.55 23.575 24.4375 25.4375 112-113 27.275 23.1875 22.5125 27.025 114-115 26.437500000000004 22.725 24.075 26.7625 116-117 26.5375 23.9375 23.674999999999997 25.85 118-119 26.987499999999997 23.525 23.5625 25.924999999999997 120-121 26.375 23.6375 23.474999999999998 26.5125 122-123 26.275 23.150000000000002 24.275 26.3 124-125 27.3375 23.175 22.8125 26.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.5 28 2.5 29 1.5 30 6.0 31 10.0 32 7.5 33 13.0 34 19.5 35 24.0 36 33.0 37 39.0 38 50.0 39 74.0 40 87.5 41 91.5 42 112.0 43 138.0 44 152.5 45 163.0 46 167.0 47 174.5 48 174.0 49 149.5 50 142.0 51 142.0 52 116.5 53 111.0 54 120.0 55 110.0 56 95.5 57 86.0 58 85.5 59 91.0 60 96.0 61 88.5 62 73.0 63 69.0 64 79.5 65 90.0 66 84.5 67 76.0 68 69.0 69 62.0 70 58.0 71 50.0 72 55.0 73 59.5 74 49.0 75 40.5 76 33.0 77 25.0 78 17.0 79 10.0 80 8.5 81 6.5 82 3.5 83 1.5 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662578 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662578_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.90675 33.0 32.0 34.0 18.0 34.0 2 30.997 33.0 32.0 34.0 18.0 34.0 3 30.7475 33.0 31.0 34.0 18.0 34.0 4 31.18025 33.0 32.0 34.0 25.0 34.0 5 31.12675 33.0 32.0 34.0 25.0 34.0 6 34.8065 38.0 36.0 38.0 26.0 38.0 7 34.98375 38.0 36.0 38.0 27.0 38.0 8 35.33 38.0 36.0 38.0 28.0 38.0 9 35.18075 38.0 36.0 38.0 28.0 38.0 10-11 35.29975 38.0 36.0 38.0 28.0 38.0 12-13 34.856375 38.0 36.0 38.0 26.5 38.0 14-15 34.852875 38.0 35.5 38.0 27.0 38.0 16-17 35.047625 38.0 36.0 38.0 26.5 38.0 18-19 35.27025 38.0 36.0 38.0 28.0 38.0 20-21 34.668875 38.0 35.0 38.0 25.0 38.0 22-23 35.124625 38.0 36.0 38.0 27.0 38.0 24-25 35.14475 38.0 36.5 38.0 26.5 38.0 26-27 34.785250000000005 38.0 35.5 38.0 25.0 38.0 28-29 34.891999999999996 38.0 36.0 38.0 26.0 38.0 30-31 34.94 38.0 36.0 38.0 26.0 38.0 32-33 34.782875000000004 38.0 35.5 38.0 25.0 38.0 34-35 34.6485 38.0 35.5 38.0 25.0 38.0 36-37 34.925375 38.0 36.0 38.0 26.0 38.0 38-39 35.22975 38.0 36.0 38.0 27.0 38.0 40-41 34.769125 38.0 35.5 38.0 25.0 38.0 42-43 35.203125 38.0 36.0 38.0 27.0 38.0 44-45 34.897625 38.0 36.0 38.0 26.0 38.0 46-47 34.74925 38.0 35.5 38.0 25.0 38.0 48-49 34.90112499999999 38.0 36.0 38.0 26.0 38.0 50-51 35.2415 38.0 36.0 38.0 27.0 38.0 52-53 34.999375 38.0 36.0 38.0 26.0 38.0 54-55 35.34875 38.0 36.5 38.0 28.0 38.0 56-57 35.426875 38.0 36.5 38.0 28.5 38.0 58-59 35.21062499999999 38.0 36.0 38.0 26.5 38.0 60-61 35.1195 38.0 36.0 38.0 26.0 38.0 62-63 35.406625 38.0 36.0 38.0 28.5 38.0 64-65 35.535375 38.0 36.5 38.0 28.5 38.0 66-67 35.20225 38.0 36.0 38.0 27.5 38.0 68-69 35.143874999999994 38.0 36.0 38.0 27.0 38.0 70-71 35.446 38.0 36.0 38.0 28.5 38.0 72-73 34.992374999999996 38.0 36.0 38.0 26.5 38.0 74-75 35.319 38.0 36.0 38.0 28.5 38.0 76-77 35.35825 38.0 36.0 38.0 28.5 38.0 78-79 35.300125 38.0 36.0 38.0 28.0 38.0 80-81 35.12425 38.0 36.0 38.0 27.0 38.0 82-83 35.00675 38.0 36.0 38.0 27.0 38.0 84-85 34.760875 38.0 35.0 38.0 25.0 38.0 86-87 34.954625 38.0 35.5 38.0 26.0 38.0 88-89 35.22225 38.0 36.0 38.0 28.0 38.0 90-91 35.348 38.0 36.0 38.0 28.5 38.0 92-93 34.5 38.0 35.0 38.0 23.5 38.0 94-95 34.761624999999995 38.0 35.5 38.0 25.0 38.0 96-97 34.634375 38.0 35.5 38.0 24.5 38.0 98-99 34.775 38.0 35.0 38.0 25.5 38.0 100-101 34.3475 38.0 35.0 38.0 23.0 38.0 102-103 34.6185 38.0 35.0 38.0 24.5 38.0 104-105 34.48625 38.0 35.0 38.0 24.0 38.0 106-107 34.439499999999995 38.0 35.0 38.0 23.5 38.0 108-109 34.657125 38.0 35.0 38.0 26.0 38.0 110-111 34.566 38.0 35.0 38.0 24.5 38.0 112-113 34.487624999999994 38.0 35.0 38.0 25.0 38.0 114-115 34.2395 38.0 35.0 38.0 23.5 38.0 116-117 34.147375 38.0 35.0 38.0 22.5 38.0 118-119 33.8635 38.0 35.0 38.0 21.0 38.0 120-121 34.052499999999995 38.0 35.0 38.0 23.0 38.0 122-123 33.509625 38.0 34.5 38.0 18.0 38.0 124-125 33.029624999999996 38.0 34.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 5.0 15 6.0 16 12.0 17 7.0 18 8.0 19 9.0 20 19.0 21 16.0 22 27.0 23 46.0 24 38.0 25 51.0 26 63.0 27 78.0 28 95.0 29 86.0 30 111.0 31 131.0 32 126.0 33 176.0 34 223.0 35 292.0 36 463.0 37 1909.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.5 11.575000000000001 11.899999999999999 37.025000000000006 2 31.825 16.8 28.975 22.400000000000002 3 27.450000000000003 23.150000000000002 20.375 29.025000000000002 4 30.325000000000003 28.575 15.325 25.775 5 28.95 31.1 20.0 19.950000000000003 6 22.025 34.675 20.95 22.35 7 21.125 16.55 37.574999999999996 24.75 8 25.1 19.075 26.150000000000002 29.675 9 24.25 19.525000000000002 27.275 28.95 10-11 27.0875 29.7375 19.375 23.799999999999997 12-13 25.637500000000003 22.2125 25.112499999999997 27.037499999999998 14-15 25.775 23.7 24.4 26.125 16-17 26.974999999999998 23.200000000000003 24.224999999999998 25.6 18-19 24.8625 24.525 23.2625 27.35 20-21 26.3 23.7375 23.9875 25.974999999999998 22-23 26.150000000000002 24.9 22.425 26.525 24-25 26.575 24.4875 23.8875 25.05 26-27 26.5625 24.875 22.525000000000002 26.0375 28-29 26.0125 23.5375 23.474999999999998 26.974999999999998 30-31 26.325 23.599999999999998 24.0 26.075 32-33 26.375 23.962500000000002 23.8125 25.85 34-35 27.875 23.8625 21.8625 26.400000000000002 36-37 25.275 23.95 24.337500000000002 26.437500000000004 38-39 25.874999999999996 24.0625 22.9875 27.075 40-41 26.9125 23.7 23.7375 25.650000000000002 42-43 26.575 23.0 23.7625 26.6625 44-45 25.974999999999998 23.9375 23.8875 26.200000000000003 46-47 26.0625 23.7625 22.9875 27.187499999999996 48-49 26.187500000000004 23.65 23.549999999999997 26.6125 50-51 26.187500000000004 23.5375 22.8875 27.3875 52-53 26.85 23.35 23.1375 26.6625 54-55 26.450000000000003 23.7 23.974999999999998 25.874999999999996 56-57 26.1625 23.7375 23.3125 26.787499999999998 58-59 26.5875 23.65 23.35 26.4125 60-61 26.5875 23.125 23.525 26.7625 62-63 25.7125 23.375 24.4375 26.474999999999998 64-65 26.85 23.275000000000002 23.3 26.575 66-67 25.874999999999996 23.35 24.1875 26.5875 68-69 26.6125 23.9875 23.1125 26.2875 70-71 26.674999999999997 24.2375 22.662499999999998 26.424999999999997 72-73 25.5125 23.5 23.775 27.212500000000002 74-75 26.487500000000004 23.5625 24.099999999999998 25.85 76-77 26.35 23.025000000000002 24.3 26.325 78-79 25.650000000000002 23.6375 23.45 27.2625 80-81 27.212500000000002 22.9875 23.6875 26.1125 82-83 26.5625 22.975 24.224999999999998 26.237500000000004 84-85 25.674999999999997 24.4 23.3 26.625 86-87 26.525 23.5 23.549999999999997 26.424999999999997 88-89 26.55 24.5625 23.125 25.7625 90-91 27.1 23.1625 23.1125 26.625 92-93 26.637499999999996 22.7625 23.962500000000002 26.637499999999996 94-95 26.1125 23.425 23.025000000000002 27.437499999999996 96-97 26.3625 24.1125 23.3875 26.137500000000003 98-99 27.500000000000004 22.5625 23.0375 26.900000000000002 100-101 26.724999999999998 23.325000000000003 22.95 27.0 102-103 26.375 22.7625 24.175 26.687499999999996 104-105 26.450000000000003 23.0375 23.3375 27.175 106-107 26.875 21.9375 23.75 27.437499999999996 108-109 26.4125 22.25 23.8625 27.474999999999998 110-111 26.9125 22.5625 24.1375 26.387500000000003 112-113 26.7625 23.7 22.9875 26.55 114-115 26.400000000000002 23.1 23.0375 27.462500000000002 116-117 25.9875 23.7875 23.7375 26.487500000000004 118-119 27.0125 23.7125 22.787499999999998 26.487500000000004 120-121 27.05 23.799999999999997 23.1875 25.9625 122-123 26.35 23.8875 23.400000000000002 26.3625 124-125 27.5625 22.725 23.3875 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 3.0 28 3.5 29 2.5 30 5.5 31 6.0 32 5.5 33 10.0 34 17.5 35 28.0 36 39.0 37 48.0 38 59.5 39 69.5 40 92.0 41 114.0 42 124.5 43 147.5 44 161.5 45 160.5 46 152.0 47 164.0 48 159.0 49 141.5 50 149.0 51 143.5 52 123.0 53 114.0 54 112.0 55 103.0 56 101.5 57 89.0 58 77.5 59 83.0 60 85.5 61 82.5 62 87.0 63 77.0 64 69.5 65 77.5 66 79.0 67 76.0 68 73.5 69 67.0 70 59.0 71 59.5 72 56.0 73 48.0 74 39.0 75 34.0 76 33.5 77 27.0 78 17.5 79 11.5 80 6.5 81 5.5 82 5.0 83 3.5 84 3.0 85 2.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574615 spots for SRR13662578.sra Written 574615 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra Read 574600 spots for SRR13662578.sra Written 574600 spots for SRR13662578.sra SRR ids: ['SRR13662578.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_33rkky79 SRR13662578.sra spots: 11492015 blocks: [[1, 574600], [574601, 1149200], [1149201, 1723800], [1723801, 2298400], [2298401, 2873000], [2873001, 3447600], [3447601, 4022200], [4022201, 4596800], [4596801, 5171400], [5171401, 5746000], [5746001, 6320600], [6320601, 6895200], [6895201, 7469800], [7469801, 8044400], [8044401, 8619000], [8619001, 9193600], [9193601, 9768200], [9768201, 10342800], [10342801, 10917400], [10917401, 11492015]] SRR13662578 file size 3300210 SRR13662578 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662578 SRR13662578_1.fastq SRR13662578_2.fastq Input file: SRR13662578_1.fastq Paired file: SRR13662578_2.fastq trimmed: SRR13662578-trimmed-pair1.fastq, SRR13662578-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:24:18 2024 >> started Tue Dec 10 07:24:30 2024 >> done (11.680s) 11492015 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 233 ( 0.00%) empty read pairs filtered out after trimming by size control 11491781 (100.00%) read pairs available; of these: 1440292 (12.53%) trimmed read pairs available after processing 10051489 (87.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 2 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 0 0.00% 51 1 0.00% 52 3 0.00% 53 1 0.00% 54 0 0.00% 55 1 0.00% 56 0 0.00% 57 3 0.00% 58 4 0.00% 59 4 0.00% 60 4 0.00% 61 3 0.00% 62 5 0.00% 63 25 0.00% 64 45 0.00% 65 60 0.00% 66 72 0.00% 67 78 0.00% 68 90 0.00% 69 104 0.00% 70 129 0.00% 71 144 0.00% 72 170 0.00% 73 202 0.00% 74 208 0.00% 75 204 0.00% 76 240 0.00% 77 291 0.00% 78 339 0.00% 79 360 0.00% 80 399 0.00% 81 475 0.00% 82 459 0.00% 83 470 0.00% 84 559 0.00% 85 621 0.01% 86 652 0.01% 87 772 0.01% 88 843 0.01% 89 964 0.01% 90 1090 0.01% 91 1180 0.01% 92 1462 0.01% 93 1716 0.01% 94 4372 0.04% 95 4485 0.04% 96 4758 0.04% 97 5053 0.04% 98 5232 0.05% 99 5512 0.05% 100 5758 0.05% 101 6081 0.05% 102 6334 0.06% 103 6683 0.06% 104 6907 0.06% 105 7539 0.07% 106 7649 0.07% 107 8246 0.07% 108 8945 0.08% 109 9569 0.08% 110 10374 0.09% 111 11383 0.10% 112 12549 0.11% 113 14149 0.12% 114 15890 0.14% 115 17840 0.16% 116 38489 0.33% 117 43464 0.38% 118 50649 0.44% 119 60062 0.52% 120 74325 0.65% 121 94245 0.82% 122 134520 1.17% 123 218992 1.91% 124 525780 4.58% 125 10051489 87.47% 11491781 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.14 fanout-score-rank=34 prefix-density=0.17 prefix-fanout=3.2 sequence=CATCATCTGTGCTCCACCTGTCCCTGGCCGTGCTGGCCCTGGTGGCCGCATTGTCGGAGGCCGGGTTCTACGACCAGTTCGACGTGGGCGGCTCCGGCCAGCACGTCCGCGTGATCGAGGACGGCAAGACCCAGCAGGTGGCCCTCACGATGGACCAACGCTCCGGCGGTGCAGGGTTCACCTCCAAGGCCATGTACCTCTACGGCGAGTTCAGCGTCCAGATGAAGCTCGTCAGCGGCAACTCCGCTGGCACTGTCACCTCCTTCTACTTGAAGTCCGGGGAAGGCGAGGGCCATGACGAGATCGACATCGAGTTCATGGGCAACCTGAGCGGCAACCCCTACGTGATGAACACCAACGTCTGGGCCAACGGCGACGGCAAGAAGGAGCACCAGTTCTACCTCTGGTTCGACCCCTCCGCCGACTTCCACACCTACAAGATCGTCTGGAACCCCACGAACATCATATTCCAGGTGGACGACGTGCCGGTGAGGACGTTCAGGAAGTACGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=468.48 fanout-score-rank=1 prefix-density=1.11 prefix-fanout=28.3 sequence=CGCCGCCGCCATC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=33 prefix-density=0.17 prefix-fanout=3.1 sequence=CATCATCTGTGCTCCACCTGTCCCTGGCCGTGCTGGCCCTGGTGGCCGCATTGTCGGAGGCCGGGTTCTACGACCAGTTCGACGTGGGCGGCTCCGGCCAGCACGTCCGCGTGATCGAGGACGGCAAGACCCAGCAGGTGGCCCTCACGATGGACCAACGCTCCGGCGGTGCAGGGTTCACCTCCAAGGCCATGTACCTCTACGGCGAGTTCAGCGTCCAGATGAAGCTCGTCAGCGGCAACTCCGCTGGCACTGTCACCTCCTTCTACTTGAAGTCCGGGGAAGGCGAGGGCCATGACGAGATCGACATCGAGTTCATGGGCAACCTGAGCGGCAACCCCTACGTGATGAACACCAACGTCTGGGCCAACGGCGACGGCAAGAAGGAGCACCAGTTCTACCTCTGGTTCGACCCCTCCGCCGACTTCCACACCTACAAGATCGTCTGGAACCCCACGAACATCATATTCCAGGTGGACGACGTGCCGGTGAGGACGTTCAGGAAGTACGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=475.69 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=28.4 sequence=GCGGCGGCGGCC SRR13662578 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:25:39 Started mapping on | Dec 10 07:25:42 Finished on | Dec 10 07:26:40 Mapping speed, Million of reads per hour | 713.28 Number of input reads | 11491781 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 10323414 Uniquely mapped reads % | 89.83% Average mapped length | 238.65 Number of splices: Total | 7547797 Number of splices: Annotated (sjdb) | 7113942 Number of splices: GT/AG | 7439475 Number of splices: GC/AG | 82275 Number of splices: AT/AC | 4438 Number of splices: Non-canonical | 21609 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 365008 % of reads mapped to multiple loci | 3.18% Number of reads mapped to too many loci | 16067 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.04% % of reads unmapped: other | 0.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 804280 804280 804280 N_multimapping 365008 365008 365008 N_noFeature 307128 5227162 5215620 N_ambiguous 237123 26786 26791 UnstrandedReadsAssigned:9779163 PositiveStrandReadsAssigned:5069466 NegativeStrandReadsAssigned:5081003 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662578 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662578-trimmed-pair1.fastq SRR13662578-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,491,781 reads, 10,574,318 reads pseudoaligned [quant] estimated average fragment length: 188.374 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,150 rounds 52973 SRR13662578.ke.tsv 35125 SRR13662578.se.tsv 88098 total ==> SRR13662578.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 748.821 0 0 PNS24247 1044 856.626 39.9795 6.15215 PNS24249 1928 1740.63 179.04 13.5589 PNS24246 1044 856.626 39.9795 6.15215 PNS24248 1044 856.626 39.9795 6.15215 PNS24244 1471 1283.63 44.0219 4.52076 PNS24243 293 111.704 9 10.6207 KQK14069 1603 1415.63 3925.46 365.53 KQK14071 474 288.37 186.838 85.4076 ==> SRR13662578.se.tsv <== BRADI_1g14170v3 4158 BRADI_1g53295v3 47 BRADI_1g59795v3 140 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 270 BRADI_1g74790v3 288 BRADI_1g09890v3 1 BRADI_1g77505v3 165 BRADI_1g48960v3 0 SRR13662578 completed mapping pipeline successfully