Starting /dee2/code/volunteer_pipeline.sh SRR13662579 current disk space = 1526521782272 free memory = 1602356548 SRR13662579 SRAfilesize 8fc3e52488207f9220895aadde5ce8c6 SRR13662579.sra SRR13662579.sra file validated SRR13662579 is paired end SRR13662579 is conventional basespace SRR13662579 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662579_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46925 33.0 33.0 34.0 31.0 34.0 2 32.30275 33.0 33.0 34.0 30.0 34.0 3 32.37425 33.0 33.0 34.0 31.0 34.0 4 32.426 33.0 33.0 34.0 31.0 34.0 5 32.438 33.0 33.0 34.0 31.0 34.0 6 36.117 38.0 37.0 38.0 33.0 38.0 7 36.564 38.0 37.0 38.0 34.0 38.0 8 36.75 38.0 38.0 38.0 34.0 38.0 9 36.80125 38.0 38.0 38.0 35.0 38.0 10-11 36.7705 38.0 38.0 38.0 35.0 38.0 12-13 36.661 38.0 38.0 38.0 34.0 38.0 14-15 36.722125000000005 38.0 38.0 38.0 34.0 38.0 16-17 36.694874999999996 38.0 38.0 38.0 34.0 38.0 18-19 36.73675 38.0 38.0 38.0 35.0 38.0 20-21 36.675124999999994 38.0 38.0 38.0 34.0 38.0 22-23 36.68775 38.0 38.0 38.0 34.0 38.0 24-25 36.756249999999994 38.0 38.0 38.0 34.0 38.0 26-27 36.692875 38.0 38.0 38.0 34.5 38.0 28-29 36.671 38.0 38.0 38.0 34.0 38.0 30-31 36.709375 38.0 38.0 38.0 34.0 38.0 32-33 36.57275 38.0 38.0 38.0 34.0 38.0 34-35 36.569374999999994 38.0 38.0 38.0 34.0 38.0 36-37 36.57125 38.0 38.0 38.0 34.0 38.0 38-39 36.514125 38.0 38.0 38.0 34.0 38.0 40-41 36.564750000000004 38.0 38.0 38.0 34.0 38.0 42-43 36.638125 38.0 38.0 38.0 34.0 38.0 44-45 36.634375 38.0 38.0 38.0 34.0 38.0 46-47 36.478624999999994 38.0 38.0 38.0 33.5 38.0 48-49 36.61475 38.0 38.0 38.0 34.0 38.0 50-51 36.712500000000006 38.0 38.0 38.0 34.0 38.0 52-53 36.6095 38.0 38.0 38.0 34.0 38.0 54-55 36.512375000000006 38.0 38.0 38.0 34.0 38.0 56-57 36.649375 38.0 38.0 38.0 34.0 38.0 58-59 36.424625000000006 38.0 38.0 38.0 33.5 38.0 60-61 36.5075 38.0 38.0 38.0 34.0 38.0 62-63 36.522999999999996 38.0 38.0 38.0 34.0 38.0 64-65 36.356375 38.0 38.0 38.0 33.0 38.0 66-67 36.403999999999996 38.0 38.0 38.0 33.5 38.0 68-69 36.604625 38.0 38.0 38.0 34.0 38.0 70-71 36.451875 38.0 38.0 38.0 34.0 38.0 72-73 36.442125000000004 38.0 38.0 38.0 34.0 38.0 74-75 36.300875000000005 38.0 38.0 38.0 33.5 38.0 76-77 36.414125 38.0 38.0 38.0 34.0 38.0 78-79 36.369875 38.0 38.0 38.0 33.5 38.0 80-81 36.414125 38.0 38.0 38.0 33.5 38.0 82-83 36.163375 38.0 38.0 38.0 33.0 38.0 84-85 36.210625 38.0 38.0 38.0 33.5 38.0 86-87 35.992000000000004 38.0 37.0 38.0 32.0 38.0 88-89 36.051 38.0 37.5 38.0 32.5 38.0 90-91 36.190625 38.0 38.0 38.0 33.5 38.0 92-93 35.810125 38.0 37.0 38.0 31.5 38.0 94-95 35.844375 38.0 37.5 38.0 32.0 38.0 96-97 35.962875 38.0 37.0 38.0 32.5 38.0 98-99 35.479124999999996 38.0 37.0 38.0 30.0 38.0 100-101 35.778875 38.0 37.0 38.0 32.0 38.0 102-103 35.642875000000004 38.0 37.0 38.0 31.0 38.0 104-105 35.871750000000006 38.0 37.0 38.0 32.5 38.0 106-107 35.667 38.0 37.0 38.0 31.0 38.0 108-109 35.493625 38.0 36.5 38.0 31.0 38.0 110-111 35.36175 38.0 36.0 38.0 29.0 38.0 112-113 35.325625 38.0 36.5 38.0 30.0 38.0 114-115 35.182625 38.0 36.5 38.0 29.5 38.0 116-117 34.963875 38.0 36.0 38.0 28.0 38.0 118-119 35.201750000000004 38.0 36.0 38.0 30.0 38.0 120-121 34.813 38.0 36.0 38.0 27.5 38.0 122-123 35.038875000000004 38.0 36.0 38.0 31.0 38.0 124-125 34.5215 38.0 35.5 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 3.0 16 1.0 17 4.0 18 3.0 19 5.0 20 4.0 21 8.0 22 4.0 23 14.0 24 12.0 25 12.0 26 22.0 27 30.0 28 47.0 29 45.0 30 67.0 31 90.0 32 104.0 33 135.0 34 202.0 35 270.0 36 507.0 37 2410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.25 12.925 10.100000000000001 35.725 2 32.300000000000004 18.0 28.425 21.275 3 28.199999999999996 23.599999999999998 19.575 28.625 4 30.125 30.225 16.400000000000002 23.25 5 30.175 30.45 18.925 20.45 6 23.25 33.375 19.6 23.775 7 21.775 14.000000000000002 37.7 26.525 8 23.225 20.4 22.900000000000002 33.475 9 24.0 19.625 26.375 30.0 10-11 28.199999999999996 27.8625 18.8875 25.05 12-13 25.474999999999998 21.8875 25.074999999999996 27.5625 14-15 26.1 23.0125 24.337500000000002 26.55 16-17 27.775 21.8625 23.4125 26.950000000000003 18-19 26.75 22.6875 23.2375 27.325 20-21 26.7125 23.525 23.5375 26.224999999999998 22-23 27.2625 23.3625 22.4875 26.887499999999996 24-25 26.474999999999998 23.3125 22.7625 27.450000000000003 26-27 26.875 23.3625 23.3375 26.424999999999997 28-29 27.450000000000003 23.1125 22.275 27.1625 30-31 27.187499999999996 22.5625 22.9625 27.287499999999998 32-33 26.05 24.349999999999998 23.5125 26.087500000000002 34-35 26.5875 23.799999999999997 22.1375 27.474999999999998 36-37 27.462500000000002 24.025 22.15 26.3625 38-39 26.637499999999996 23.5375 22.925 26.900000000000002 40-41 26.487500000000004 23.5375 22.7375 27.237499999999997 42-43 26.4625 22.9875 23.0625 27.487499999999997 44-45 25.937500000000004 24.075 22.6875 27.3 46-47 27.2625 22.575 22.8 27.3625 48-49 26.1125 23.974999999999998 22.8875 27.025 50-51 26.237500000000004 23.525 23.175 27.0625 52-53 27.675 23.3 21.9375 27.0875 54-55 26.35 23.35 22.6 27.700000000000003 56-57 26.687499999999996 23.325000000000003 22.575 27.4125 58-59 27.5875 23.075000000000003 21.6 27.737499999999997 60-61 27.625 22.75 21.9 27.725 62-63 28.3625 22.425 22.2 27.0125 64-65 27.025 23.6375 22.2625 27.075 66-67 25.974999999999998 23.075000000000003 23.45 27.500000000000004 68-69 26.8125 23.0 23.275000000000002 26.9125 70-71 27.625 22.375 22.575 27.425 72-73 27.224999999999998 22.5 22.925 27.35 74-75 27.200000000000003 22.3 23.0125 27.487499999999997 76-77 26.625 23.375 22.35 27.650000000000002 78-79 27.462500000000002 22.425 23.200000000000003 26.9125 80-81 26.924999999999997 22.5875 23.7125 26.775 82-83 27.200000000000003 22.85 22.875 27.075 84-85 25.55 22.525000000000002 23.1625 28.762500000000003 86-87 26.8 22.9625 23.7625 26.474999999999998 88-89 28.050000000000004 22.45 22.0 27.500000000000004 90-91 26.5625 23.6375 22.6125 27.187499999999996 92-93 26.5125 22.825 23.200000000000003 27.462500000000002 94-95 27.212500000000002 22.400000000000002 23.0375 27.35 96-97 27.275 21.9375 23.025000000000002 27.762500000000003 98-99 27.950000000000003 22.400000000000002 22.825 26.825 100-101 26.85 23.5625 21.9375 27.650000000000002 102-103 26.275 22.5875 23.6875 27.450000000000003 104-105 26.5375 23.5375 23.1375 26.787499999999998 106-107 27.975 22.825 22.775000000000002 26.424999999999997 108-109 27.650000000000002 21.837500000000002 23.1125 27.400000000000002 110-111 27.175 23.425 22.4625 26.937499999999996 112-113 27.537499999999998 22.275 22.8 27.3875 114-115 26.8625 22.15 22.575 28.4125 116-117 26.5625 23.1875 22.912499999999998 27.3375 118-119 26.55 23.6875 22.05 27.712500000000002 120-121 27.125 23.425 22.95 26.5 122-123 26.7125 22.9875 23.0375 27.2625 124-125 26.625 23.3125 22.5125 27.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.0 26 0.0 27 1.0 28 1.5 29 1.0 30 3.5 31 10.0 32 11.0 33 7.5 34 11.5 35 21.5 36 29.5 37 35.5 38 45.0 39 67.5 40 81.0 41 99.5 42 127.5 43 127.0 44 137.5 45 155.0 46 148.5 47 153.5 48 158.5 49 146.5 50 133.5 51 121.0 52 115.0 53 115.5 54 105.5 55 93.5 56 88.0 57 82.5 58 90.5 59 100.0 60 85.5 61 83.0 62 95.0 63 84.5 64 84.0 65 96.5 66 92.0 67 89.5 68 87.5 69 79.5 70 75.0 71 64.5 72 64.0 73 61.0 74 48.5 75 44.5 76 35.0 77 24.0 78 21.0 79 16.0 80 13.5 81 12.5 82 5.5 83 2.5 84 3.5 85 2.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0 0.0 0.0 0.0 0.025 92-93 0.0 0.0 0.0 0.0 0.025 94-95 0.0 0.0 0.0 0.0 0.025 96-97 0.0 0.0 0.0 0.0 0.025 98-99 0.0 0.0 0.0 0.0 0.025 100-101 0.0 0.0 0.0 0.0 0.025 102-103 0.0 0.0 0.0 0.0 0.025 104-105 0.0 0.0 0.0 0.0 0.025 106-107 0.0 0.0 0.0 0.0 0.025 108-109 0.0 0.0 0.0 0.0 0.025 110-111 0.0 0.0 0.0 0.0 0.025 112-113 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662579 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662579_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.26825 33.0 32.0 34.0 25.0 34.0 2 31.43475 33.0 32.0 34.0 25.0 34.0 3 31.376 33.0 32.0 34.0 25.0 34.0 4 31.237 33.0 32.0 34.0 25.0 34.0 5 31.4435 33.0 32.0 34.0 27.0 34.0 6 35.154 38.0 36.0 38.0 28.0 38.0 7 35.2685 38.0 36.0 38.0 28.0 38.0 8 34.9735 38.0 36.0 38.0 26.0 38.0 9 35.55075 38.0 37.0 38.0 29.0 38.0 10-11 35.3085 38.0 36.5 38.0 28.0 38.0 12-13 35.432500000000005 38.0 36.5 38.0 28.5 38.0 14-15 35.010374999999996 38.0 36.0 38.0 27.0 38.0 16-17 35.450125 38.0 36.5 38.0 28.5 38.0 18-19 35.312 38.0 36.5 38.0 28.0 38.0 20-21 34.779375 38.0 36.0 38.0 26.0 38.0 22-23 35.282375 38.0 36.5 38.0 27.5 38.0 24-25 35.409375 38.0 36.5 38.0 28.0 38.0 26-27 34.935375 38.0 36.0 38.0 26.0 38.0 28-29 35.462 38.0 37.0 38.0 28.5 38.0 30-31 35.20075 38.0 36.5 38.0 27.5 38.0 32-33 35.1125 38.0 36.0 38.0 26.5 38.0 34-35 35.031875 38.0 36.0 38.0 27.0 38.0 36-37 35.303625 38.0 36.5 38.0 27.5 38.0 38-39 34.537000000000006 38.0 35.0 38.0 24.5 38.0 40-41 35.034875 38.0 36.0 38.0 26.0 38.0 42-43 35.306625 38.0 36.0 38.0 27.0 38.0 44-45 35.062375 38.0 36.0 38.0 26.5 38.0 46-47 35.6065 38.0 37.0 38.0 28.5 38.0 48-49 35.618125000000006 38.0 37.0 38.0 29.0 38.0 50-51 35.622125 38.0 37.0 38.0 29.0 38.0 52-53 35.71625 38.0 37.0 38.0 29.5 38.0 54-55 35.718374999999995 38.0 37.0 38.0 30.0 38.0 56-57 35.790625 38.0 37.0 38.0 30.0 38.0 58-59 35.608999999999995 38.0 37.0 38.0 29.0 38.0 60-61 35.634125 38.0 37.0 38.0 29.5 38.0 62-63 35.67375 38.0 36.5 38.0 30.5 38.0 64-65 35.402375 38.0 36.5 38.0 28.0 38.0 66-67 35.55225 38.0 37.0 38.0 29.0 38.0 68-69 35.632875 38.0 37.0 38.0 29.0 38.0 70-71 35.603625 38.0 37.0 38.0 29.0 38.0 72-73 35.704375 38.0 37.0 38.0 30.0 38.0 74-75 35.266875 38.0 36.0 38.0 27.5 38.0 76-77 35.428 38.0 36.5 38.0 29.0 38.0 78-79 35.564 38.0 36.5 38.0 29.5 38.0 80-81 35.469125 38.0 36.5 38.0 29.0 38.0 82-83 35.439750000000004 38.0 36.5 38.0 28.5 38.0 84-85 35.749875 38.0 37.0 38.0 31.5 38.0 86-87 35.444 38.0 36.5 38.0 29.5 38.0 88-89 35.56925 38.0 37.0 38.0 30.0 38.0 90-91 35.247875 38.0 36.0 38.0 28.0 38.0 92-93 35.54775 38.0 37.0 38.0 31.0 38.0 94-95 35.321 38.0 36.0 38.0 29.5 38.0 96-97 35.334875 38.0 36.5 38.0 29.0 38.0 98-99 35.054125 38.0 35.5 38.0 27.0 38.0 100-101 35.19425 38.0 36.0 38.0 28.0 38.0 102-103 35.179500000000004 38.0 36.0 38.0 28.5 38.0 104-105 35.053 38.0 36.0 38.0 27.5 38.0 106-107 34.975125 38.0 36.0 38.0 27.5 38.0 108-109 34.903375 38.0 35.5 38.0 27.0 38.0 110-111 35.051500000000004 38.0 36.0 38.0 28.5 38.0 112-113 34.87375 38.0 36.0 38.0 27.0 38.0 114-115 35.040625000000006 38.0 36.0 38.0 28.0 38.0 116-117 34.682375 38.0 36.0 38.0 26.0 38.0 118-119 34.72925 38.0 36.0 38.0 27.0 38.0 120-121 34.408249999999995 38.0 35.5 38.0 25.5 38.0 122-123 34.388875 38.0 35.0 38.0 26.0 38.0 124-125 34.036875 38.0 35.0 38.0 25.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 3.0 14 5.0 15 5.0 16 6.0 17 5.0 18 5.0 19 11.0 20 14.0 21 16.0 22 26.0 23 31.0 24 27.0 25 55.0 26 59.0 27 52.0 28 66.0 29 86.0 30 86.0 31 118.0 32 135.0 33 140.0 34 205.0 35 267.0 36 481.0 37 2093.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.075 11.774999999999999 12.425 35.725 2 32.525 17.224999999999998 28.000000000000004 22.25 3 27.575 23.35 20.375 28.7 4 30.15 30.025000000000002 16.35 23.474999999999998 5 30.225 31.2 18.675 19.900000000000002 6 23.200000000000003 32.775 19.7 24.325 7 21.65 15.625 37.875 24.85 8 24.575 19.475 24.25 31.7 9 24.0 20.150000000000002 26.275 29.575000000000003 10-11 27.537499999999998 28.3125 19.537499999999998 24.6125 12-13 25.174999999999997 20.9125 25.85 28.0625 14-15 26.5625 21.8875 24.55 27.0 16-17 27.8125 22.2625 23.0 26.924999999999997 18-19 26.787499999999998 22.650000000000002 23.0375 27.525 20-21 27.1375 24.05 22.2125 26.6 22-23 27.5125 23.8625 22.75 25.874999999999996 24-25 26.55 23.1875 23.225 27.037499999999998 26-27 26.974999999999998 24.2375 22.75 26.0375 28-29 26.987499999999997 23.0625 22.75 27.200000000000003 30-31 25.687500000000004 22.9875 23.7 27.625 32-33 27.212500000000002 23.474999999999998 22.9875 26.325 34-35 27.1375 23.5375 22.85 26.474999999999998 36-37 26.8625 23.6875 22.3125 27.1375 38-39 26.900000000000002 22.775000000000002 22.9625 27.3625 40-41 26.275 23.35 23.2875 27.0875 42-43 26.775 23.0 22.900000000000002 27.325 44-45 27.1 23.075000000000003 23.4125 26.4125 46-47 27.287499999999998 22.975 22.975 26.7625 48-49 26.8375 22.7375 23.150000000000002 27.275 50-51 27.700000000000003 22.975 22.825 26.5 52-53 27.575 22.875 22.5125 27.037499999999998 54-55 26.8625 23.5875 22.4375 27.1125 56-57 27.187499999999996 22.925 23.2625 26.625 58-59 27.125 23.0875 22.662499999999998 27.125 60-61 26.687499999999996 23.25 22.525000000000002 27.537499999999998 62-63 27.487499999999997 23.275000000000002 22.9625 26.275 64-65 26.5375 22.5125 23.200000000000003 27.750000000000004 66-67 27.675 22.912499999999998 22.2 27.212500000000002 68-69 26.400000000000002 23.474999999999998 22.7625 27.3625 70-71 27.8125 22.45 22.7375 27.0 72-73 27.0125 22.9875 22.8625 27.1375 74-75 27.8375 22.4875 22.7375 26.937499999999996 76-77 26.724999999999998 22.912499999999998 22.8125 27.55 78-79 27.737499999999997 22.4625 21.837500000000002 27.962500000000002 80-81 26.9125 23.3375 22.287499999999998 27.462500000000002 82-83 26.05 23.5375 23.6875 26.724999999999998 84-85 26.5625 23.0 23.4375 27.0 86-87 27.474999999999998 22.45 22.9375 27.1375 88-89 26.474999999999998 23.0 23.1 27.425 90-91 26.8 22.8625 23.175 27.1625 92-93 26.924999999999997 23.0625 22.3875 27.625 94-95 28.1 22.6375 22.875 26.387500000000003 96-97 26.575 22.7375 21.987499999999997 28.7 98-99 27.525 22.0875 23.5625 26.825 100-101 26.85 23.200000000000003 22.6375 27.3125 102-103 26.4625 23.125 22.6125 27.800000000000004 104-105 27.0 22.3125 23.325000000000003 27.3625 106-107 26.85 23.175 23.125 26.85 108-109 26.7125 22.025 23.599999999999998 27.6625 110-111 27.075 22.900000000000002 23.225 26.8 112-113 28.3625 22.825 21.825 26.987499999999997 114-115 26.775 23.3625 22.575 27.287499999999998 116-117 27.900000000000002 23.275000000000002 22.8875 25.937500000000004 118-119 27.224999999999998 23.1125 22.537499999999998 27.125 120-121 27.0125 23.1375 22.7 27.150000000000002 122-123 26.85 22.7 23.962500000000002 26.487500000000004 124-125 28.025 22.575 22.675 26.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.0 26 1.0 27 1.0 28 1.5 29 2.0 30 5.0 31 8.0 32 8.5 33 11.0 34 18.0 35 20.5 36 24.0 37 37.0 38 45.0 39 63.5 40 90.5 41 108.0 42 113.5 43 117.0 44 141.0 45 153.5 46 149.0 47 140.0 48 142.5 49 148.5 50 141.5 51 134.0 52 111.5 53 110.5 54 113.0 55 105.5 56 101.5 57 92.5 58 93.5 59 91.5 60 90.0 61 97.5 62 79.5 63 73.5 64 96.5 65 95.0 66 85.5 67 86.5 68 81.5 69 72.5 70 74.0 71 77.0 72 68.5 73 56.5 74 52.0 75 44.0 76 34.0 77 26.0 78 17.0 79 12.5 80 8.5 81 8.0 82 8.5 83 3.5 84 1.5 85 1.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0125 100-101 0.0 0.0 0.0 0.0 0.025 102-103 0.0 0.0 0.0 0.0 0.025 104-105 0.0 0.0 0.0 0.0 0.025 106-107 0.0 0.0 0.0 0.0 0.025 108-109 0.0 0.0 0.0 0.0 0.025 110-111 0.0 0.0 0.0 0.0 0.025 112-113 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606595 spots for SRR13662579.sra Written 606595 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra Read 606579 spots for SRR13662579.sra Written 606579 spots for SRR13662579.sra SRR ids: ['SRR13662579.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_26nbxt4i SRR13662579.sra spots: 12131596 blocks: [[1, 606579], [606580, 1213158], [1213159, 1819737], [1819738, 2426316], [2426317, 3032895], [3032896, 3639474], [3639475, 4246053], [4246054, 4852632], [4852633, 5459211], [5459212, 6065790], [6065791, 6672369], [6672370, 7278948], [7278949, 7885527], [7885528, 8492106], [8492107, 9098685], [9098686, 9705264], [9705265, 10311843], [10311844, 10918422], [10918423, 11525001], [11525002, 12131596]] SRR13662579 file size 3485089 SRR13662579 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662579 SRR13662579_1.fastq SRR13662579_2.fastq Input file: SRR13662579_1.fastq Paired file: SRR13662579_2.fastq trimmed: SRR13662579-trimmed-pair1.fastq, SRR13662579-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:26:30 2024 >> started Tue Dec 10 07:26:42 2024 >> done (12.149s) 12131596 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 114 ( 0.00%) empty read pairs filtered out after trimming by size control 12131482 (100.00%) read pairs available; of these: 1431211 (11.80%) trimmed read pairs available after processing 10700271 (88.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 3 0.00% 38 1 0.00% 39 1 0.00% 40 1 0.00% 41 1 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 2 0.00% 48 0 0.00% 49 1 0.00% 50 2 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 0 0.00% 55 1 0.00% 56 1 0.00% 57 0 0.00% 58 5 0.00% 59 5 0.00% 60 6 0.00% 61 2 0.00% 62 4 0.00% 63 29 0.00% 64 52 0.00% 65 77 0.00% 66 93 0.00% 67 79 0.00% 68 136 0.00% 69 152 0.00% 70 161 0.00% 71 200 0.00% 72 242 0.00% 73 224 0.00% 74 293 0.00% 75 302 0.00% 76 328 0.00% 77 342 0.00% 78 360 0.00% 79 446 0.00% 80 428 0.00% 81 479 0.00% 82 518 0.00% 83 586 0.00% 84 684 0.01% 85 684 0.01% 86 809 0.01% 87 851 0.01% 88 905 0.01% 89 1073 0.01% 90 1190 0.01% 91 1385 0.01% 92 1524 0.01% 93 1866 0.02% 94 4941 0.04% 95 5132 0.04% 96 5213 0.04% 97 5635 0.05% 98 5869 0.05% 99 6163 0.05% 100 6432 0.05% 101 6636 0.05% 102 6924 0.06% 103 7108 0.06% 104 7524 0.06% 105 7929 0.07% 106 8564 0.07% 107 8998 0.07% 108 9586 0.08% 109 10330 0.09% 110 11215 0.09% 111 12064 0.10% 112 13065 0.11% 113 14986 0.12% 114 16357 0.13% 115 18646 0.15% 116 33179 0.27% 117 37879 0.31% 118 44559 0.37% 119 54693 0.45% 120 67485 0.56% 121 88299 0.73% 122 131893 1.09% 123 217690 1.79% 124 539681 4.45% 125 10700271 88.20% 12131482 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=5.85 fanout-score-rank=20 prefix-density=0.16 prefix-fanout=5.2 sequence=TGCCGCACTTGCAGGTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=390.92 fanout-score-rank=1 prefix-density=1.16 prefix-fanout=28.7 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=5.66 fanout-score-rank=25 prefix-density=0.16 prefix-fanout=5.1 sequence=TGCCGCACTTGCAGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=438.58 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=29.3 sequence=CGCCGCCGCCATCCCCTCCAAGTGCGGCGTCAGCATCCCTTACACCATCAGCCCCTCCGTCGACTGCTCCAGGGTCAACTAGAGAGATCGAGAGATCGGCCGTCTTCTCC SRR13662579 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:27:29 Started mapping on | Dec 10 07:27:29 Finished on | Dec 10 07:28:20 Mapping speed, Million of reads per hour | 856.34 Number of input reads | 12131482 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 11489295 Uniquely mapped reads % | 94.71% Average mapped length | 246.75 Number of splices: Total | 8744894 Number of splices: Annotated (sjdb) | 8240246 Number of splices: GT/AG | 8622022 Number of splices: GC/AG | 100137 Number of splices: AT/AC | 5160 Number of splices: Non-canonical | 17575 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 277460 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 14773 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.21% % of reads unmapped: other | 0.67% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 364782 364782 364782 N_multimapping 277460 277460 277460 N_noFeature 317681 5772362 5780985 N_ambiguous 296279 22556 22615 UnstrandedReadsAssigned:10875335 PositiveStrandReadsAssigned:5694377 NegativeStrandReadsAssigned:5685695 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662579 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662579-trimmed-pair1.fastq SRR13662579-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,131,482 reads, 11,324,628 reads pseudoaligned [quant] estimated average fragment length: 203.322 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52973 SRR13662579.ke.tsv 35125 SRR13662579.se.tsv 88098 total ==> SRR13662579.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 733.993 0 0 PNS24247 1044 841.678 22.2743 3.12047 PNS24249 1928 1725.68 159.503 10.8986 PNS24246 1044 841.678 22.2743 3.12047 PNS24248 1044 841.678 22.2743 3.12047 PNS24244 1471 1268.68 30.6742 2.85091 PNS24243 293 99.0029 3 3.57301 KQK14069 1603 1400.68 4676.94 393.718 KQK14071 474 273.828 516.733 222.51 ==> SRR13662579.se.tsv <== BRADI_1g14170v3 5458 BRADI_1g53295v3 72 BRADI_1g59795v3 186 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 610 BRADI_1g74790v3 115 BRADI_1g09890v3 20 BRADI_1g77505v3 214 BRADI_1g48960v3 1 SRR13662579 completed mapping pipeline successfully