Starting /dee2/code/volunteer_pipeline.sh SRR13662580 current disk space = 1526521475072 free memory = 1602347800 SRR13662580 SRAfilesize 915d548d79b8bbdd37027115fd30b7a4 SRR13662580.sra SRR13662580.sra file validated SRR13662580 is paired end SRR13662580 is conventional basespace SRR13662580 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662580_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43925 33.0 33.0 34.0 31.0 34.0 2 32.521 34.0 33.0 34.0 31.0 34.0 3 32.4925 34.0 33.0 34.0 31.0 34.0 4 32.40975 34.0 33.0 34.0 31.0 34.0 5 32.55975 34.0 33.0 34.0 31.0 34.0 6 36.09025 38.0 36.0 38.0 32.0 38.0 7 36.63475 38.0 37.0 38.0 34.0 38.0 8 36.802 38.0 38.0 38.0 35.0 38.0 9 36.7655 38.0 38.0 38.0 35.0 38.0 10-11 36.8885 38.0 38.0 38.0 35.0 38.0 12-13 36.90775 38.0 38.0 38.0 35.0 38.0 14-15 36.91 38.0 38.0 38.0 35.0 38.0 16-17 36.855875 38.0 38.0 38.0 35.0 38.0 18-19 36.896249999999995 38.0 38.0 38.0 35.0 38.0 20-21 36.98525 38.0 38.0 38.0 35.0 38.0 22-23 36.839625 38.0 38.0 38.0 35.0 38.0 24-25 36.7685 38.0 38.0 38.0 34.5 38.0 26-27 36.892 38.0 38.0 38.0 35.0 38.0 28-29 36.789500000000004 38.0 38.0 38.0 35.0 38.0 30-31 36.83925 38.0 38.0 38.0 35.0 38.0 32-33 36.799125000000004 38.0 38.0 38.0 34.5 38.0 34-35 36.7575 38.0 38.0 38.0 34.0 38.0 36-37 36.747625 38.0 38.0 38.0 34.0 38.0 38-39 36.778375 38.0 38.0 38.0 35.0 38.0 40-41 36.751875 38.0 38.0 38.0 34.0 38.0 42-43 36.757000000000005 38.0 38.0 38.0 34.5 38.0 44-45 36.71525 38.0 38.0 38.0 34.0 38.0 46-47 36.65075 38.0 38.0 38.0 34.0 38.0 48-49 36.784 38.0 38.0 38.0 35.0 38.0 50-51 36.753249999999994 38.0 38.0 38.0 34.0 38.0 52-53 36.711125 38.0 38.0 38.0 34.0 38.0 54-55 36.645250000000004 38.0 38.0 38.0 34.0 38.0 56-57 36.589875 38.0 38.0 38.0 34.0 38.0 58-59 36.591499999999996 38.0 38.0 38.0 34.0 38.0 60-61 36.532 38.0 38.0 38.0 34.0 38.0 62-63 36.565625 38.0 38.0 38.0 34.0 38.0 64-65 36.537375 38.0 38.0 38.0 34.0 38.0 66-67 36.642250000000004 38.0 38.0 38.0 34.0 38.0 68-69 36.586 38.0 38.0 38.0 34.0 38.0 70-71 36.53575 38.0 38.0 38.0 34.0 38.0 72-73 36.5165 38.0 38.0 38.0 34.0 38.0 74-75 36.554625 38.0 38.0 38.0 34.0 38.0 76-77 36.54925 38.0 38.0 38.0 34.0 38.0 78-79 36.393125 38.0 38.0 38.0 33.0 38.0 80-81 36.30625 38.0 38.0 38.0 33.0 38.0 82-83 36.334375 38.0 38.0 38.0 34.0 38.0 84-85 36.369625 38.0 38.0 38.0 34.0 38.0 86-87 36.368125 38.0 38.0 38.0 34.0 38.0 88-89 36.291624999999996 38.0 38.0 38.0 33.5 38.0 90-91 36.22825 38.0 37.5 38.0 33.0 38.0 92-93 36.26325 38.0 38.0 38.0 33.5 38.0 94-95 36.144999999999996 38.0 38.0 38.0 33.0 38.0 96-97 36.037 38.0 37.0 38.0 33.0 38.0 98-99 36.115125 38.0 37.5 38.0 33.0 38.0 100-101 36.017624999999995 38.0 37.0 38.0 33.0 38.0 102-103 36.005250000000004 38.0 37.0 38.0 33.0 38.0 104-105 35.992374999999996 38.0 37.0 38.0 32.5 38.0 106-107 36.030375 38.0 37.0 38.0 33.0 38.0 108-109 35.900999999999996 38.0 37.0 38.0 32.0 38.0 110-111 35.807125 38.0 36.5 38.0 31.5 38.0 112-113 35.667125 38.0 36.0 38.0 31.0 38.0 114-115 35.74625 38.0 36.5 38.0 31.5 38.0 116-117 35.567375 38.0 36.0 38.0 31.0 38.0 118-119 35.420125 38.0 36.0 38.0 31.0 38.0 120-121 35.48975 38.0 36.0 38.0 31.0 38.0 122-123 35.398624999999996 38.0 36.0 38.0 31.0 38.0 124-125 35.10025 38.0 36.0 38.0 31.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 3.0 18 1.0 19 0.0 20 2.0 21 2.0 22 3.0 23 6.0 24 8.0 25 15.0 26 20.0 27 27.0 28 34.0 29 42.0 30 68.0 31 89.0 32 113.0 33 137.0 34 162.0 35 253.0 36 492.0 37 2521.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.65 12.325 11.450000000000001 36.575 2 30.049999999999997 17.575 29.45 22.925 3 28.15 22.975 19.825 29.049999999999997 4 29.575000000000003 29.2 17.075000000000003 24.15 5 30.099999999999998 29.225 18.925 21.75 6 23.45 34.699999999999996 18.425 23.425 7 21.725 15.925 36.95 25.4 8 23.5 19.7 23.925 32.875 9 25.124999999999996 18.725 26.525 29.625 10-11 28.000000000000004 27.0 18.862499999999997 26.137500000000003 12-13 25.6 21.224999999999998 24.837500000000002 28.3375 14-15 26.387500000000003 22.3 23.6375 27.675 16-17 27.05 21.9 23.7625 27.287499999999998 18-19 26.687499999999996 22.537499999999998 23.6375 27.1375 20-21 27.537499999999998 22.975 22.725 26.7625 22-23 26.987499999999997 24.099999999999998 22.6125 26.3 24-25 26.25 23.7125 22.8875 27.150000000000002 26-27 27.1125 23.05 22.2625 27.575 28-29 26.3 22.875 23.1875 27.6375 30-31 27.025 21.987499999999997 23.3875 27.6 32-33 27.05 24.5 21.987499999999997 26.4625 34-35 27.0625 23.400000000000002 23.0 26.5375 36-37 26.9125 23.25 22.05 27.787499999999998 38-39 26.737499999999997 23.1625 23.5625 26.5375 40-41 27.450000000000003 23.1 22.5 26.950000000000003 42-43 27.05 23.0375 21.8875 28.025 44-45 26.737499999999997 23.5 22.287499999999998 27.474999999999998 46-47 27.575 23.4125 22.725 26.2875 48-49 26.400000000000002 22.912499999999998 22.5875 28.1 50-51 27.5125 22.2125 23.7625 26.5125 52-53 27.55 23.4125 21.4875 27.55 54-55 27.125 22.675 22.25 27.950000000000003 56-57 27.175 22.55 22.7625 27.5125 58-59 27.2625 23.45 22.1 27.187499999999996 60-61 26.55 23.6125 22.6875 27.150000000000002 62-63 28.3625 22.412499999999998 22.45 26.775 64-65 27.3875 24.1375 21.675 26.8 66-67 26.487500000000004 23.1875 22.975 27.35 68-69 25.937500000000004 23.5375 23.5375 26.987499999999997 70-71 27.1125 23.175 22.412499999999998 27.3 72-73 26.787499999999998 23.1375 23.075000000000003 27.0 74-75 26.825 23.275000000000002 22.5125 27.3875 76-77 27.237499999999997 22.8625 22.7375 27.1625 78-79 27.025 22.662499999999998 23.1375 27.175 80-81 26.8375 22.4875 23.3625 27.3125 82-83 27.825 23.1875 21.6875 27.3 84-85 26.9125 23.175 22.6125 27.3 86-87 26.375 22.975 23.2875 27.3625 88-89 27.3625 22.4875 21.9 28.249999999999996 90-91 27.025 22.8125 22.3125 27.85 92-93 27.375 22.8 22.675 27.150000000000002 94-95 27.4125 23.4375 22.0 27.150000000000002 96-97 27.200000000000003 23.575 21.775 27.450000000000003 98-99 26.700000000000003 22.6125 22.8375 27.85 100-101 27.487499999999997 22.4625 22.8125 27.237499999999997 102-103 27.275 22.425 23.3375 26.9625 104-105 27.762500000000003 22.537499999999998 23.1875 26.5125 106-107 26.9125 22.6375 22.325 28.125 108-109 27.4125 22.725 22.725 27.1375 110-111 27.9375 22.675 22.425 26.9625 112-113 26.650000000000002 22.875 22.7625 27.712500000000002 114-115 27.224999999999998 22.412499999999998 22.75 27.6125 116-117 26.974999999999998 22.95 22.675 27.400000000000002 118-119 27.474999999999998 22.925 22.3125 27.287499999999998 120-121 26.924999999999997 23.0875 23.200000000000003 26.787499999999998 122-123 26.0125 23.6625 22.625 27.700000000000003 124-125 26.787499999999998 23.3125 22.400000000000002 27.500000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 2.5 29 2.5 30 3.0 31 7.5 32 8.0 33 7.5 34 16.5 35 28.0 36 30.5 37 38.0 38 48.5 39 68.0 40 91.0 41 101.0 42 112.5 43 135.0 44 147.0 45 141.5 46 142.0 47 148.5 48 141.5 49 127.5 50 128.5 51 128.0 52 120.0 53 116.0 54 108.5 55 96.0 56 87.5 57 78.0 58 80.0 59 90.5 60 90.5 61 88.5 62 88.5 63 84.0 64 88.5 65 97.0 66 90.0 67 79.0 68 81.0 69 90.5 70 84.0 71 70.0 72 66.5 73 67.0 74 59.0 75 43.0 76 33.5 77 32.5 78 26.0 79 19.5 80 15.0 81 10.0 82 6.5 83 2.0 84 1.0 85 1.0 86 1.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662580 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662580_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.20275 33.0 33.0 34.0 30.0 34.0 2 32.363 33.0 33.0 34.0 31.0 34.0 3 32.32575 33.0 33.0 34.0 31.0 34.0 4 32.19825 33.0 33.0 34.0 31.0 34.0 5 32.15475 33.0 33.0 34.0 31.0 34.0 6 36.176 38.0 37.0 38.0 33.0 38.0 7 36.3215 38.0 38.0 38.0 33.0 38.0 8 36.112 38.0 38.0 38.0 33.0 38.0 9 36.185 38.0 38.0 38.0 33.0 38.0 10-11 36.20675 38.0 38.0 38.0 33.0 38.0 12-13 36.232625 38.0 38.0 38.0 33.0 38.0 14-15 36.200125 38.0 38.0 38.0 33.0 38.0 16-17 36.301125 38.0 38.0 38.0 33.0 38.0 18-19 36.125625 38.0 38.0 38.0 33.0 38.0 20-21 36.083124999999995 38.0 37.5 38.0 32.0 38.0 22-23 36.048874999999995 38.0 37.0 38.0 32.0 38.0 24-25 36.205375000000004 38.0 38.0 38.0 33.0 38.0 26-27 36.3245 38.0 38.0 38.0 33.0 38.0 28-29 36.297 38.0 38.0 38.0 33.0 38.0 30-31 36.257999999999996 38.0 38.0 38.0 33.0 38.0 32-33 36.246125 38.0 38.0 38.0 33.0 38.0 34-35 36.193625 38.0 38.0 38.0 33.0 38.0 36-37 36.176375 38.0 38.0 38.0 33.0 38.0 38-39 36.096625 38.0 38.0 38.0 33.0 38.0 40-41 36.270125 38.0 38.0 38.0 33.0 38.0 42-43 36.15775 38.0 37.5 38.0 33.0 38.0 44-45 36.115875 38.0 38.0 38.0 33.0 38.0 46-47 36.142875000000004 38.0 37.5 38.0 32.5 38.0 48-49 36.257374999999996 38.0 38.0 38.0 33.5 38.0 50-51 36.20225 38.0 37.5 38.0 33.0 38.0 52-53 36.152375000000006 38.0 38.0 38.0 32.5 38.0 54-55 36.193 38.0 38.0 38.0 33.0 38.0 56-57 36.120625000000004 38.0 37.0 38.0 33.0 38.0 58-59 36.115625 38.0 37.5 38.0 32.5 38.0 60-61 36.08625 38.0 37.5 38.0 32.5 38.0 62-63 36.033500000000004 38.0 37.0 38.0 31.5 38.0 64-65 35.903999999999996 38.0 37.0 38.0 31.0 38.0 66-67 36.042125 38.0 37.0 38.0 32.5 38.0 68-69 35.974625 38.0 37.0 38.0 31.0 38.0 70-71 36.020875000000004 38.0 37.5 38.0 31.0 38.0 72-73 35.94775 38.0 37.0 38.0 31.5 38.0 74-75 36.037 38.0 37.5 38.0 33.0 38.0 76-77 35.832125000000005 38.0 37.0 38.0 31.0 38.0 78-79 35.9165 38.0 37.0 38.0 31.0 38.0 80-81 35.69725 38.0 37.0 38.0 31.0 38.0 82-83 35.60875 38.0 37.0 38.0 30.5 38.0 84-85 35.66975 38.0 37.0 38.0 30.5 38.0 86-87 35.70925 38.0 37.0 38.0 30.5 38.0 88-89 35.62775 38.0 37.0 38.0 31.0 38.0 90-91 35.494375 38.0 36.5 38.0 30.5 38.0 92-93 35.528625000000005 38.0 36.5 38.0 30.0 38.0 94-95 35.4995 38.0 36.5 38.0 30.0 38.0 96-97 35.543875 38.0 36.5 38.0 31.0 38.0 98-99 35.380250000000004 38.0 36.0 38.0 30.0 38.0 100-101 35.303124999999994 38.0 36.0 38.0 29.0 38.0 102-103 35.327875 38.0 36.0 38.0 29.0 38.0 104-105 35.169375 38.0 36.0 38.0 28.0 38.0 106-107 35.072625 38.0 36.0 38.0 27.5 38.0 108-109 35.079125 38.0 36.0 38.0 28.0 38.0 110-111 34.98325 38.0 36.0 38.0 27.5 38.0 112-113 34.815875000000005 38.0 35.5 38.0 27.5 38.0 114-115 34.69825 38.0 35.0 38.0 26.5 38.0 116-117 34.708 38.0 35.0 38.0 26.5 38.0 118-119 34.561 38.0 35.0 38.0 25.0 38.0 120-121 34.485375 38.0 35.5 38.0 26.0 38.0 122-123 34.069874999999996 38.0 35.0 38.0 23.5 38.0 124-125 33.631375000000006 38.0 35.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 2.0 15 2.0 16 6.0 17 3.0 18 2.0 19 11.0 20 8.0 21 10.0 22 15.0 23 17.0 24 30.0 25 31.0 26 43.0 27 46.0 28 50.0 29 71.0 30 84.0 31 94.0 32 128.0 33 147.0 34 182.0 35 254.0 36 460.0 37 2302.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.625 11.675 10.6 37.1 2 32.625 17.974999999999998 28.299999999999997 21.099999999999998 3 28.749999999999996 25.224999999999998 19.25 26.775 4 29.725 30.375000000000004 16.025 23.875 5 31.25 30.325000000000003 17.75 20.674999999999997 6 22.3 35.4 19.325 22.975 7 22.650000000000002 15.6 36.025 25.724999999999998 8 25.374999999999996 19.825 24.025 30.775000000000002 9 23.9 19.975 25.825 30.3 10-11 27.8625 27.9375 18.987499999999997 25.2125 12-13 25.7 21.0625 25.8 27.437499999999996 14-15 26.325 22.95 24.637500000000003 26.087500000000002 16-17 26.8 23.175 22.725 27.3 18-19 26.950000000000003 22.975 22.8 27.275 20-21 26.875 23.95 22.787499999999998 26.387500000000003 22-23 27.212500000000002 23.549999999999997 22.475 26.7625 24-25 26.8125 24.4 21.975 26.8125 26-27 27.287499999999998 23.5 22.5625 26.650000000000002 28-29 26.2875 23.95 22.237499999999997 27.525 30-31 27.3625 22.9375 22.425 27.275 32-33 26.625 24.125 22.475 26.775 34-35 27.6875 23.1125 23.0625 26.137500000000003 36-37 27.750000000000004 22.875 22.4375 26.937499999999996 38-39 26.950000000000003 24.0125 22.4375 26.6 40-41 27.9125 23.0625 22.275 26.75 42-43 26.8125 22.875 23.325000000000003 26.987499999999997 44-45 27.075 23.6875 23.225 26.0125 46-47 27.0625 23.200000000000003 23.25 26.487500000000004 48-49 27.1625 23.05 22.6 27.187499999999996 50-51 26.974999999999998 23.375 22.975 26.674999999999997 52-53 27.125 22.912499999999998 23.3625 26.6 54-55 26.5625 22.975 23.7125 26.75 56-57 26.690836354544317 22.715339417427177 22.940367545943243 27.65345668208526 58-59 27.900000000000002 23.1375 22.125 26.8375 60-61 26.375 23.3875 22.912499999999998 27.325 62-63 27.2625 23.962500000000002 22.275 26.5 64-65 27.74443610902726 23.068267066766694 21.9679919979995 27.219304826206553 66-67 27.1 22.900000000000002 22.8 27.200000000000003 68-69 26.8625 23.400000000000002 22.3 27.437499999999996 70-71 27.025 22.95 22.8625 27.1625 72-73 26.6625 22.537499999999998 23.05 27.750000000000004 74-75 26.900000000000002 23.2875 22.85 26.9625 76-77 26.275 23.5375 22.4625 27.725 78-79 26.637499999999996 23.2875 22.8375 27.237499999999997 80-81 27.525 23.0875 23.1375 26.25 82-83 27.250000000000004 22.45 22.8375 27.462500000000002 84-85 26.6125 23.05 22.55 27.787499999999998 86-87 27.0625 22.5125 23.6625 26.7625 88-89 27.725 22.95 21.9625 27.3625 90-91 26.8375 22.8 23.5375 26.825 92-93 26.950000000000003 22.475 23.7625 26.8125 94-95 27.625 22.0875 22.925 27.3625 96-97 26.8625 22.925 22.875 27.3375 98-99 26.724999999999998 22.925 23.3 27.05 100-101 27.525 22.5125 22.900000000000002 27.0625 102-103 27.400000000000002 21.85 23.3875 27.3625 104-105 26.687499999999996 22.725 23.6125 26.974999999999998 106-107 26.85 23.2625 22.6125 27.275 108-109 28.09326814591952 22.37683339601354 22.37683339601354 27.153065062053404 110-111 27.248809822099723 22.613380105236782 23.076923076923077 27.060886995740418 112-113 27.935069837674593 23.11564112243614 22.549389706807602 26.399899333081667 114-115 27.42541990473803 22.93807971922788 22.486838806718477 27.14966156931562 116-117 27.1375 22.7375 22.7625 27.3625 118-119 26.775 22.8 23.7375 26.687499999999996 120-121 27.175 22.45 23.4375 26.937499999999996 122-123 27.675 22.8375 23.025000000000002 26.4625 124-125 28.1 22.912499999999998 22.3 26.687499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 2.0 29 2.0 30 4.5 31 9.0 32 11.0 33 11.0 34 12.5 35 23.0 36 31.0 37 36.0 38 48.5 39 61.0 40 79.0 41 100.5 42 130.5 43 141.5 44 134.0 45 148.0 46 163.5 47 161.5 48 144.5 49 129.5 50 133.5 51 133.0 52 128.5 53 112.5 54 95.0 55 97.5 56 98.0 57 94.0 58 84.5 59 83.5 60 88.5 61 89.5 62 80.5 63 80.0 64 83.5 65 88.0 66 94.0 67 83.0 68 81.5 69 77.0 70 77.0 71 72.5 72 70.5 73 64.5 74 43.5 75 39.0 76 38.0 77 29.5 78 19.5 79 19.0 80 14.0 81 7.5 82 6.5 83 4.5 84 2.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0125 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.2875 110-111 0.22499999999999998 112-113 0.6625 114-115 0.27499999999999997 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690796 spots for SRR13662580.sra Written 690796 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra Read 690784 spots for SRR13662580.sra Written 690784 spots for SRR13662580.sra SRR ids: ['SRR13662580.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_37ufmq9y SRR13662580.sra spots: 13815692 blocks: [[1, 690784], [690785, 1381568], [1381569, 2072352], [2072353, 2763136], [2763137, 3453920], [3453921, 4144704], [4144705, 4835488], [4835489, 5526272], [5526273, 6217056], [6217057, 6907840], [6907841, 7598624], [7598625, 8289408], [8289409, 8980192], [8980193, 9670976], [9670977, 10361760], [10361761, 11052544], [11052545, 11743328], [11743329, 12434112], [12434113, 13124896], [13124897, 13815692]] SRR13662580 file size 3971898 SRR13662580 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662580 SRR13662580_1.fastq SRR13662580_2.fastq Input file: SRR13662580_1.fastq Paired file: SRR13662580_2.fastq trimmed: SRR13662580-trimmed-pair1.fastq, SRR13662580-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:25:34 2024 >> started Tue Dec 10 07:25:48 2024 >> done (14.255s) 13815692 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 131 ( 0.00%) empty read pairs filtered out after trimming by size control 13815560 (100.00%) read pairs available; of these: 1734969 (12.56%) trimmed read pairs available after processing 12080591 (87.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 2 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 1 0.00% 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 0 0.00% 41 2 0.00% 42 0 0.00% 43 1 0.00% 44 0 0.00% 45 1 0.00% 46 2 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 0 0.00% 53 1 0.00% 54 1 0.00% 55 0 0.00% 56 1 0.00% 57 2 0.00% 58 2 0.00% 59 4 0.00% 60 4 0.00% 61 4 0.00% 62 6 0.00% 63 28 0.00% 64 53 0.00% 65 55 0.00% 66 88 0.00% 67 108 0.00% 68 99 0.00% 69 127 0.00% 70 169 0.00% 71 192 0.00% 72 251 0.00% 73 238 0.00% 74 246 0.00% 75 319 0.00% 76 326 0.00% 77 379 0.00% 78 387 0.00% 79 456 0.00% 80 487 0.00% 81 531 0.00% 82 561 0.00% 83 653 0.00% 84 669 0.00% 85 758 0.01% 86 821 0.01% 87 923 0.01% 88 1019 0.01% 89 1082 0.01% 90 1269 0.01% 91 1502 0.01% 92 1783 0.01% 93 2138 0.02% 94 5949 0.04% 95 5876 0.04% 96 6282 0.05% 97 6632 0.05% 98 6853 0.05% 99 7291 0.05% 100 7765 0.06% 101 8105 0.06% 102 8548 0.06% 103 8983 0.07% 104 9307 0.07% 105 9587 0.07% 106 10253 0.07% 107 10977 0.08% 108 11508 0.08% 109 12698 0.09% 110 13883 0.10% 111 15363 0.11% 112 16995 0.12% 113 18730 0.14% 114 21153 0.15% 115 24129 0.17% 116 43133 0.31% 117 47238 0.34% 118 55317 0.40% 119 66513 0.48% 120 83103 0.60% 121 109626 0.79% 122 158176 1.14% 123 265152 1.92% 124 642088 4.65% 125 12080591 87.44% 13815560 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=35 prefix-density=0.14 prefix-fanout=2.5 sequence=TCTGGATGTTGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=451.18 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=28.2 sequence=CGCCGCCGCCGT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=35 prefix-density=0.13 prefix-fanout=2.3 sequence=TCTGGATGTTGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=469.01 fanout-score-rank=1 prefix-density=1.16 prefix-fanout=28.4 sequence=CGCCGCCGCCGTC SRR13662580 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:26:45 Started mapping on | Dec 10 07:26:45 Finished on | Dec 10 07:27:42 Mapping speed, Million of reads per hour | 872.56 Number of input reads | 13815560 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 13088463 Uniquely mapped reads % | 94.74% Average mapped length | 246.74 Number of splices: Total | 10110059 Number of splices: Annotated (sjdb) | 9521812 Number of splices: GT/AG | 9967977 Number of splices: GC/AG | 114396 Number of splices: AT/AC | 6576 Number of splices: Non-canonical | 21110 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 305163 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 17817 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.24% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 422019 422019 422019 N_multimapping 305163 305163 305163 N_noFeature 375123 6585985 6588519 N_ambiguous 337758 25658 26153 UnstrandedReadsAssigned:12375582 PositiveStrandReadsAssigned:6476820 NegativeStrandReadsAssigned:6473791 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662580 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662580-trimmed-pair1.fastq SRR13662580-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,815,560 reads, 12,860,778 reads pseudoaligned [quant] estimated average fragment length: 202.027 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52973 SRR13662580.ke.tsv 35125 SRR13662580.se.tsv 88098 total ==> SRR13662580.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 735.139 0 0 PNS24247 1044 842.973 20.0777 2.47083 PNS24249 1928 1726.97 170.509 10.2424 PNS24246 1044 842.973 20.0777 2.47083 PNS24248 1044 842.973 20.0777 2.47083 PNS24244 1471 1269.97 47.2583 3.86035 PNS24243 293 99.9291 4 4.15251 KQK14069 1603 1401.97 4319.66 319.634 KQK14071 474 274.963 316.587 119.443 ==> SRR13662580.se.tsv <== BRADI_1g14170v3 4909 BRADI_1g53295v3 74 BRADI_1g59795v3 252 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 675 BRADI_1g74790v3 152 BRADI_1g09890v3 20 BRADI_1g77505v3 255 BRADI_1g48960v3 1 SRR13662580 completed mapping pipeline successfully