Starting /dee2/code/volunteer_pipeline.sh SRR13662581 current disk space = 1526519144448 free memory = 1550328336 SRR13662581 SRAfilesize 5cf138daba2ea2174540aff872dd93cd SRR13662581.sra SRR13662581.sra file validated SRR13662581 is paired end SRR13662581 is conventional basespace SRR13662581 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662581_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50625 33.0 33.0 34.0 31.0 34.0 2 32.51925 33.0 33.0 34.0 31.0 34.0 3 32.41125 33.0 33.0 34.0 31.0 34.0 4 32.41975 33.0 33.0 34.0 31.0 34.0 5 32.4525 33.0 33.0 34.0 31.0 34.0 6 35.93625 38.0 36.0 38.0 31.0 38.0 7 36.374 38.0 37.0 38.0 34.0 38.0 8 36.617 38.0 38.0 38.0 34.0 38.0 9 36.73725 38.0 38.0 38.0 34.0 38.0 10-11 36.622125 38.0 38.0 38.0 34.0 38.0 12-13 36.6995 38.0 38.0 38.0 34.0 38.0 14-15 36.725625 38.0 38.0 38.0 34.5 38.0 16-17 36.7525 38.0 38.0 38.0 34.5 38.0 18-19 36.740375 38.0 38.0 38.0 34.0 38.0 20-21 36.712125 38.0 38.0 38.0 34.5 38.0 22-23 36.694874999999996 38.0 38.0 38.0 34.0 38.0 24-25 36.708749999999995 38.0 38.0 38.0 34.5 38.0 26-27 36.723625 38.0 38.0 38.0 34.5 38.0 28-29 36.573375 38.0 38.0 38.0 34.0 38.0 30-31 36.7405 38.0 38.0 38.0 34.0 38.0 32-33 36.691125 38.0 38.0 38.0 34.0 38.0 34-35 36.749875 38.0 38.0 38.0 34.5 38.0 36-37 36.725125000000006 38.0 38.0 38.0 34.0 38.0 38-39 36.643875 38.0 38.0 38.0 34.0 38.0 40-41 36.523875000000004 38.0 38.0 38.0 33.5 38.0 42-43 36.586749999999995 38.0 38.0 38.0 34.0 38.0 44-45 36.523375 38.0 38.0 38.0 33.5 38.0 46-47 36.54625 38.0 38.0 38.0 34.0 38.0 48-49 36.61325 38.0 38.0 38.0 34.0 38.0 50-51 36.56225 38.0 38.0 38.0 34.0 38.0 52-53 36.61525 38.0 38.0 38.0 34.0 38.0 54-55 36.494375 38.0 38.0 38.0 34.0 38.0 56-57 36.445875 38.0 38.0 38.0 34.0 38.0 58-59 36.456375 38.0 38.0 38.0 34.0 38.0 60-61 36.44725 38.0 38.0 38.0 34.0 38.0 62-63 36.500625 38.0 38.0 38.0 34.0 38.0 64-65 36.573750000000004 38.0 38.0 38.0 34.0 38.0 66-67 36.58025 38.0 38.0 38.0 34.0 38.0 68-69 36.551625 38.0 38.0 38.0 34.0 38.0 70-71 36.548500000000004 38.0 38.0 38.0 34.0 38.0 72-73 35.996375 38.0 37.0 38.0 31.0 38.0 74-75 36.277375 38.0 38.0 38.0 33.0 38.0 76-77 36.339375000000004 38.0 38.0 38.0 34.0 38.0 78-79 36.30775 38.0 38.0 38.0 33.5 38.0 80-81 36.295125 38.0 38.0 38.0 33.0 38.0 82-83 35.941 38.0 37.0 38.0 32.0 38.0 84-85 36.327875000000006 38.0 38.0 38.0 33.5 38.0 86-87 36.156125 38.0 38.0 38.0 33.0 38.0 88-89 36.17075 38.0 38.0 38.0 33.0 38.0 90-91 36.206 38.0 38.0 38.0 33.0 38.0 92-93 35.979375 38.0 37.5 38.0 32.5 38.0 94-95 35.82925 38.0 37.0 38.0 31.5 38.0 96-97 35.882374999999996 38.0 37.0 38.0 31.5 38.0 98-99 35.899249999999995 38.0 37.0 38.0 32.0 38.0 100-101 35.9875 38.0 37.0 38.0 32.0 38.0 102-103 35.607124999999996 38.0 36.5 38.0 30.5 38.0 104-105 35.599125 38.0 37.0 38.0 31.0 38.0 106-107 35.576750000000004 38.0 36.0 38.0 31.0 38.0 108-109 35.715125 38.0 37.0 38.0 31.0 38.0 110-111 35.644000000000005 38.0 37.0 38.0 31.0 38.0 112-113 35.487375 38.0 36.5 38.0 31.0 38.0 114-115 35.501875 38.0 36.0 38.0 31.0 38.0 116-117 35.60975 38.0 36.5 38.0 31.0 38.0 118-119 34.985875 38.0 36.0 38.0 28.5 38.0 120-121 34.77225 38.0 35.5 38.0 27.5 38.0 122-123 34.47 38.0 35.0 38.0 27.0 38.0 124-125 34.023625 38.0 35.0 38.0 25.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 8.0 20 3.0 21 4.0 22 5.0 23 7.0 24 8.0 25 19.0 26 24.0 27 30.0 28 42.0 29 62.0 30 68.0 31 101.0 32 110.0 33 136.0 34 196.0 35 270.0 36 529.0 37 2376.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.5 12.675 10.549999999999999 37.275000000000006 2 33.35 17.95 27.500000000000004 21.2 3 28.625 23.25 20.825 27.3 4 30.075000000000003 29.375 16.35 24.2 5 28.825 29.5 19.175 22.5 6 23.425 34.025 19.825 22.725 7 21.45 15.325 36.3 26.924999999999997 8 24.224999999999998 20.5 23.724999999999998 31.55 9 24.375 19.025 26.875 29.725 10-11 27.85 27.700000000000003 18.65 25.8 12-13 25.35 21.987499999999997 25.5 27.1625 14-15 26.8 21.4875 24.224999999999998 27.487499999999997 16-17 27.0125 22.9875 23.4875 26.5125 18-19 26.450000000000003 22.8125 23.599999999999998 27.1375 20-21 26.8375 22.5625 22.787499999999998 27.8125 22-23 27.6875 23.175 22.537499999999998 26.6 24-25 27.0125 22.925 22.875 27.187499999999996 26-27 26.775 23.3125 22.825 27.0875 28-29 26.9625 22.787499999999998 22.912499999999998 27.3375 30-31 26.787499999999998 23.25 23.8375 26.125 32-33 25.7875 23.724999999999998 23.125 27.3625 34-35 27.3 23.075000000000003 22.2 27.425 36-37 26.4625 23.6625 22.6375 27.237499999999997 38-39 27.825 22.875 22.537499999999998 26.7625 40-41 27.037499999999998 23.4625 21.8625 27.6375 42-43 26.9125 23.8625 22.650000000000002 26.575 44-45 26.674999999999997 23.5125 23.5625 26.25 46-47 27.6125 22.7125 23.1125 26.5625 48-49 26.6125 23.3375 23.025000000000002 27.025 50-51 27.1125 22.8875 22.825 27.175 52-53 26.637499999999996 23.575 22.650000000000002 27.1375 54-55 27.575 22.912499999999998 22.787499999999998 26.724999999999998 56-57 27.6125 23.1625 22.5875 26.637499999999996 58-59 27.2625 23.150000000000002 22.35 27.237499999999997 60-61 26.4625 23.025000000000002 23.5375 26.974999999999998 62-63 27.6875 22.175 23.45 26.687499999999996 64-65 26.5 23.95 22.7375 26.8125 66-67 25.9875 22.825 23.4125 27.775 68-69 27.037499999999998 23.025000000000002 23.25 26.687499999999996 70-71 27.3375 23.474999999999998 22.4375 26.75 72-73 26.125 22.6125 23.4875 27.775 74-75 27.462500000000002 24.025 21.512500000000003 27.0 76-77 27.200000000000003 22.8125 22.475 27.5125 78-79 26.025 23.175 23.2375 27.5625 80-81 27.375 23.2875 23.2125 26.125 82-83 27.0875 22.9375 23.400000000000002 26.575 84-85 26.787499999999998 22.7375 22.9875 27.487499999999997 86-87 27.700000000000003 22.2125 23.0625 27.025 88-89 27.150000000000002 22.3125 23.175 27.3625 90-91 27.0 23.3625 22.875 26.7625 92-93 27.224999999999998 23.4875 22.475 26.8125 94-95 25.6125 23.225 23.0125 28.15 96-97 28.037499999999998 23.0875 22.05 26.825 98-99 28.1875 22.9875 22.5125 26.3125 100-101 27.5125 22.112499999999997 23.5375 26.8375 102-103 27.1 23.5625 22.325 27.0125 104-105 26.924999999999997 23.1625 23.0125 26.900000000000002 106-107 26.6 23.05 22.75 27.6 108-109 27.237499999999997 22.625 22.662499999999998 27.474999999999998 110-111 27.55 22.3875 23.549999999999997 26.5125 112-113 27.025 22.2625 23.7875 26.924999999999997 114-115 26.5125 21.912499999999998 22.8 28.775000000000002 116-117 27.925 22.1 23.75 26.224999999999998 118-119 26.237500000000004 22.9375 23.150000000000002 27.675 120-121 27.35 22.1375 23.35 27.1625 122-123 27.4125 22.5125 23.5 26.575 124-125 28.499999999999996 22.662499999999998 22.662499999999998 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.0 28 0.0 29 1.0 30 4.0 31 9.0 32 9.5 33 10.0 34 13.5 35 21.0 36 31.0 37 38.5 38 55.0 39 73.0 40 84.0 41 98.0 42 110.5 43 123.5 44 138.0 45 148.5 46 157.0 47 147.0 48 140.5 49 149.0 50 137.5 51 115.5 52 124.5 53 125.5 54 105.0 55 104.5 56 101.0 57 91.0 58 95.0 59 97.0 60 89.5 61 90.0 62 89.5 63 79.0 64 77.0 65 91.5 66 99.0 67 87.0 68 74.0 69 72.5 70 79.0 71 69.0 72 57.0 73 60.0 74 58.5 75 46.5 76 29.0 77 22.5 78 18.5 79 12.0 80 10.5 81 9.0 82 4.5 83 3.0 84 4.0 85 4.0 86 2.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662581 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662581_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.08275 33.0 32.0 34.0 18.0 34.0 2 31.251 33.0 32.0 34.0 25.0 34.0 3 31.067 33.0 32.0 34.0 18.0 34.0 4 31.41675 33.0 32.0 34.0 27.0 34.0 5 31.307 33.0 32.0 34.0 27.0 34.0 6 35.005 38.0 36.0 38.0 27.0 38.0 7 35.01 38.0 36.0 38.0 26.0 38.0 8 35.36675 38.0 36.0 38.0 29.0 38.0 9 35.451 38.0 37.0 38.0 29.0 38.0 10-11 35.508875 38.0 37.0 38.0 29.0 38.0 12-13 35.116 38.0 36.0 38.0 27.5 38.0 14-15 35.088375 38.0 36.0 38.0 27.0 38.0 16-17 35.147999999999996 38.0 36.0 38.0 27.0 38.0 18-19 35.498875 38.0 37.0 38.0 28.0 38.0 20-21 34.91225 38.0 36.0 38.0 26.0 38.0 22-23 35.316625 38.0 36.0 38.0 28.0 38.0 24-25 35.30025 38.0 36.5 38.0 27.5 38.0 26-27 35.02275 38.0 36.0 38.0 27.0 38.0 28-29 35.104 38.0 36.0 38.0 27.0 38.0 30-31 35.063874999999996 38.0 36.0 38.0 26.5 38.0 32-33 35.010374999999996 38.0 36.0 38.0 27.0 38.0 34-35 34.807375 38.0 35.5 38.0 25.0 38.0 36-37 35.166250000000005 38.0 36.0 38.0 27.5 38.0 38-39 35.47925 38.0 36.5 38.0 28.5 38.0 40-41 35.031000000000006 38.0 36.0 38.0 26.5 38.0 42-43 35.274 38.0 36.0 38.0 27.5 38.0 44-45 35.073625 38.0 36.0 38.0 26.0 38.0 46-47 34.9775 38.0 36.0 38.0 26.0 38.0 48-49 35.073750000000004 38.0 36.0 38.0 27.0 38.0 50-51 35.40975 38.0 36.5 38.0 28.5 38.0 52-53 35.307500000000005 38.0 36.0 38.0 27.5 38.0 54-55 35.48725 38.0 36.5 38.0 28.5 38.0 56-57 35.38075 38.0 36.5 38.0 28.0 38.0 58-59 35.430375 38.0 36.5 38.0 28.5 38.0 60-61 35.4105 38.0 36.0 38.0 28.0 38.0 62-63 35.63575 38.0 37.0 38.0 29.0 38.0 64-65 35.719750000000005 38.0 37.0 38.0 30.0 38.0 66-67 35.365125 38.0 36.0 38.0 28.0 38.0 68-69 35.403875 38.0 36.5 38.0 28.5 38.0 70-71 35.59825 38.0 37.0 38.0 29.0 38.0 72-73 35.139125 38.0 36.0 38.0 27.5 38.0 74-75 35.361875 38.0 36.5 38.0 28.5 38.0 76-77 35.40875 38.0 36.5 38.0 28.5 38.0 78-79 35.472125000000005 38.0 37.0 38.0 29.0 38.0 80-81 35.400375 38.0 36.5 38.0 29.0 38.0 82-83 35.304125 38.0 36.0 38.0 29.0 38.0 84-85 34.93375 38.0 36.0 38.0 26.5 38.0 86-87 35.21875 38.0 36.0 38.0 27.5 38.0 88-89 35.442 38.0 37.0 38.0 30.0 38.0 90-91 35.4875 38.0 36.5 38.0 29.0 38.0 92-93 34.794375 38.0 35.5 38.0 25.5 38.0 94-95 35.042375 38.0 36.0 38.0 27.5 38.0 96-97 34.7805 38.0 35.5 38.0 25.5 38.0 98-99 34.94525 38.0 35.5 38.0 27.0 38.0 100-101 34.602000000000004 38.0 35.0 38.0 24.0 38.0 102-103 34.91875 38.0 35.5 38.0 26.5 38.0 104-105 34.57475 38.0 35.0 38.0 24.0 38.0 106-107 34.653625 38.0 35.0 38.0 25.0 38.0 108-109 34.8495 38.0 35.0 38.0 27.0 38.0 110-111 34.842625 38.0 35.5 38.0 27.0 38.0 112-113 34.635999999999996 38.0 35.0 38.0 25.0 38.0 114-115 34.583375000000004 38.0 35.0 38.0 25.0 38.0 116-117 34.510000000000005 38.0 35.0 38.0 25.0 38.0 118-119 34.31675 38.0 35.0 38.0 23.0 38.0 120-121 34.315875000000005 38.0 35.0 38.0 24.0 38.0 122-123 33.852625 38.0 35.0 38.0 22.0 38.0 124-125 33.552499999999995 38.0 35.0 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 2.0 14 5.0 15 7.0 16 6.0 17 4.0 18 10.0 19 6.0 20 11.0 21 19.0 22 29.0 23 33.0 24 50.0 25 46.0 26 57.0 27 69.0 28 77.0 29 81.0 30 103.0 31 124.0 32 145.0 33 161.0 34 184.0 35 299.0 36 467.0 37 2003.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.925 11.75 10.975 37.35 2 30.4 18.375 28.599999999999998 22.625 3 28.1 23.375 21.6 26.924999999999997 4 30.525000000000002 29.9 16.45 23.125 5 29.099999999999998 31.724999999999998 18.475 20.7 6 22.625 32.9 21.075 23.400000000000002 7 19.950000000000003 15.325 37.85 26.875 8 23.599999999999998 19.1 24.7 32.6 9 24.55 19.3 26.275 29.875 10-11 26.9125 27.762500000000003 19.1 26.224999999999998 12-13 24.337500000000002 20.7125 26.325 28.625 14-15 26.1 22.625 24.2875 26.987499999999997 16-17 27.075 22.787499999999998 23.2875 26.85 18-19 26.400000000000002 22.125 23.962500000000002 27.5125 20-21 26.187500000000004 23.9 23.05 26.8625 22-23 26.55 23.7625 23.5375 26.150000000000002 24-25 26.174999999999997 24.125 23.0875 26.6125 26-27 27.35 24.0 22.475 26.174999999999997 28-29 26.55 23.45 23.1125 26.887499999999996 30-31 26.674999999999997 23.65 22.8375 26.8375 32-33 26.3125 24.3 23.0625 26.325 34-35 27.275 23.5875 23.0 26.137500000000003 36-37 26.75 23.05 22.912499999999998 27.287499999999998 38-39 26.275 23.7 22.787499999999998 27.237499999999997 40-41 27.437499999999996 23.45 22.5875 26.525 42-43 26.737499999999997 23.0625 22.9375 27.2625 44-45 26.674999999999997 24.3125 22.2125 26.8 46-47 27.1 23.65 21.987499999999997 27.2625 48-49 26.5625 23.674999999999997 22.2625 27.500000000000004 50-51 27.375 22.475 23.125 27.025 52-53 26.487500000000004 23.5 23.075000000000003 26.937499999999996 54-55 27.187499999999996 23.0375 22.7625 27.0125 56-57 26.25 23.375 22.650000000000002 27.725 58-59 26.237500000000004 22.9625 23.05 27.750000000000004 60-61 27.437499999999996 22.25 22.6 27.712500000000002 62-63 26.7125 22.05 23.2125 28.025 64-65 27.5875 23.150000000000002 22.2 27.0625 66-67 26.75 23.175 22.2625 27.8125 68-69 26.875 23.3625 23.025000000000002 26.737499999999997 70-71 27.5125 23.175 22.5875 26.724999999999998 72-73 26.1125 22.787499999999998 23.599999999999998 27.500000000000004 74-75 26.974999999999998 22.475 23.225 27.325 76-77 26.8375 23.4125 22.775000000000002 26.974999999999998 78-79 27.1375 22.225 22.8125 27.825 80-81 27.3 23.275000000000002 22.4625 26.9625 82-83 26.7625 23.425 22.7375 27.075 84-85 26.224999999999998 23.375 22.75 27.650000000000002 86-87 26.5375 23.724999999999998 22.8625 26.875 88-89 28.1 22.7125 22.45 26.737499999999997 90-91 27.1625 22.825 22.5625 27.450000000000003 92-93 26.887499999999996 23.125 23.0375 26.950000000000003 94-95 26.75 24.2 22.4375 26.6125 96-97 27.075 22.8 22.875 27.250000000000004 98-99 26.55 24.0375 23.3125 26.1 100-101 27.025 22.662499999999998 22.912499999999998 27.400000000000002 102-103 26.625 23.4875 22.662499999999998 27.224999999999998 104-105 26.85 23.7375 22.5625 26.85 106-107 27.1125 22.6875 22.5875 27.6125 108-109 27.025 22.85 23.05 27.075 110-111 27.0 23.2125 22.7625 27.025 112-113 26.8125 23.2125 22.7 27.275 114-115 26.2875 23.3125 22.2125 28.1875 116-117 26.900000000000002 21.9375 23.200000000000003 27.962500000000002 118-119 27.187499999999996 22.912499999999998 22.55 27.35 120-121 27.275 23.2125 22.775000000000002 26.737499999999997 122-123 26.424999999999997 22.8375 23.549999999999997 27.187499999999996 124-125 27.462500000000002 23.3875 22.375 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 2.0 29 3.0 30 4.0 31 6.5 32 8.5 33 8.5 34 11.0 35 22.5 36 32.5 37 43.5 38 58.5 39 65.0 40 78.5 41 107.0 42 119.0 43 124.5 44 142.0 45 160.0 46 160.0 47 145.0 48 141.0 49 154.5 50 158.5 51 144.0 52 120.5 53 92.5 54 95.5 55 106.0 56 99.5 57 90.0 58 84.5 59 89.5 60 91.0 61 82.0 62 83.5 63 87.5 64 89.0 65 80.5 66 76.5 67 81.0 68 77.0 69 78.5 70 74.0 71 69.0 72 65.5 73 58.5 74 51.5 75 46.0 76 35.0 77 23.0 78 19.5 79 13.5 80 10.5 81 8.0 82 7.5 83 7.5 84 3.0 85 1.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573138 spots for SRR13662581.sra Written 573138 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra Read 573136 spots for SRR13662581.sra Written 573136 spots for SRR13662581.sra SRR ids: ['SRR13662581.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vzpy2utb SRR13662581.sra spots: 11462722 blocks: [[1, 573136], [573137, 1146272], [1146273, 1719408], [1719409, 2292544], [2292545, 2865680], [2865681, 3438816], [3438817, 4011952], [4011953, 4585088], [4585089, 5158224], [5158225, 5731360], [5731361, 6304496], [6304497, 6877632], [6877633, 7450768], [7450769, 8023904], [8023905, 8597040], [8597041, 9170176], [9170177, 9743312], [9743313, 10316448], [10316449, 10889584], [10889585, 11462722]] SRR13662581 file size 3291742 SRR13662581 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662581 SRR13662581_1.fastq SRR13662581_2.fastq Input file: SRR13662581_1.fastq Paired file: SRR13662581_2.fastq trimmed: SRR13662581-trimmed-pair1.fastq, SRR13662581-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:25:08 2024 >> started Tue Dec 10 07:25:21 2024 >> done (12.180s) 11462722 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 47 ( 0.00%) empty read pairs filtered out after trimming by size control 11462675 (100.00%) read pairs available; of these: 1373961 (11.99%) trimmed read pairs available after processing 10088714 (88.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 1 0.00% 34 0 0.00% 35 2 0.00% 36 1 0.00% 37 1 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 1 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 1 0.00% 51 2 0.00% 52 1 0.00% 53 1 0.00% 54 2 0.00% 55 0 0.00% 56 2 0.00% 57 1 0.00% 58 0 0.00% 59 2 0.00% 60 2 0.00% 61 4 0.00% 62 3 0.00% 63 29 0.00% 64 44 0.00% 65 51 0.00% 66 80 0.00% 67 85 0.00% 68 91 0.00% 69 131 0.00% 70 146 0.00% 71 177 0.00% 72 165 0.00% 73 232 0.00% 74 241 0.00% 75 266 0.00% 76 289 0.00% 77 325 0.00% 78 348 0.00% 79 367 0.00% 80 399 0.00% 81 444 0.00% 82 457 0.00% 83 499 0.00% 84 567 0.00% 85 638 0.01% 86 690 0.01% 87 737 0.01% 88 854 0.01% 89 884 0.01% 90 1059 0.01% 91 1142 0.01% 92 1489 0.01% 93 1728 0.02% 94 4369 0.04% 95 4506 0.04% 96 4783 0.04% 97 4942 0.04% 98 5234 0.05% 99 5518 0.05% 100 5618 0.05% 101 6054 0.05% 102 6360 0.06% 103 6629 0.06% 104 7065 0.06% 105 7501 0.07% 106 7666 0.07% 107 8253 0.07% 108 8735 0.08% 109 9459 0.08% 110 10489 0.09% 111 11523 0.10% 112 12585 0.11% 113 14265 0.12% 114 15790 0.14% 115 17758 0.15% 116 29896 0.26% 117 34231 0.30% 118 41204 0.36% 119 49917 0.44% 120 63860 0.56% 121 84823 0.74% 122 125975 1.10% 123 212741 1.86% 124 531527 4.64% 125 10088714 88.01% 11462675 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=5.67 fanout-score-rank=25 prefix-density=0.15 prefix-fanout=5.1 sequence=TGCCGCACTTGCAGGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=407.65 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=28.1 sequence=CGCCGCCGCCATCCCCTCCAAGTGCGGCGTCAGCATCCCTTACACCATCAGCCCCTCCGTCGACTGCTCCAGGGTCAACTAGAGAGATCGAGAGATCGGCCGTCTTCTCC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=5.80 fanout-score-rank=27 prefix-density=0.15 prefix-fanout=5.1 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=462.51 fanout-score-rank=1 prefix-density=1.19 prefix-fanout=28.5 sequence=CGCCGCCGCCGT SRR13662581 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:26:09 Started mapping on | Dec 10 07:26:10 Finished on | Dec 10 07:27:04 Mapping speed, Million of reads per hour | 764.18 Number of input reads | 11462675 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 10851339 Uniquely mapped reads % | 94.67% Average mapped length | 246.81 Number of splices: Total | 8315690 Number of splices: Annotated (sjdb) | 7827028 Number of splices: GT/AG | 8199899 Number of splices: GC/AG | 94267 Number of splices: AT/AC | 5146 Number of splices: Non-canonical | 16378 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262218 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 18047 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 349157 349157 349157 N_multimapping 262218 262218 262218 N_noFeature 307005 5459596 5464321 N_ambiguous 275344 21667 21654 UnstrandedReadsAssigned:10268990 PositiveStrandReadsAssigned:5370076 NegativeStrandReadsAssigned:5365364 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662581 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662581-trimmed-pair1.fastq SRR13662581-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,462,675 reads, 10,670,243 reads pseudoaligned [quant] estimated average fragment length: 205.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52973 SRR13662581.ke.tsv 35125 SRR13662581.se.tsv 88098 total ==> SRR13662581.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.098 0 0 PNS24247 1044 839.915 20.0845 2.90441 PNS24249 1928 1723.91 157.285 11.0816 PNS24246 1044 839.915 20.0845 2.90441 PNS24248 1044 839.915 20.0845 2.90441 PNS24244 1471 1266.91 18.4619 1.76995 PNS24243 293 97.5459 10 12.4515 KQK14069 1603 1398.91 4099.13 355.904 KQK14071 474 271.89 391.854 175.05 ==> SRR13662581.se.tsv <== BRADI_1g14170v3 4726 BRADI_1g53295v3 57 BRADI_1g59795v3 213 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 577 BRADI_1g74790v3 145 BRADI_1g09890v3 15 BRADI_1g77505v3 229 BRADI_1g48960v3 0 SRR13662581 completed mapping pipeline successfully