Starting /dee2/code/volunteer_pipeline.sh SRR13662582 current disk space = 1526570590208 free memory = 1602320348 SRR13662582 SRAfilesize 412530428886b007e017475aaaea87f8 SRR13662582.sra SRR13662582.sra file validated SRR13662582 is paired end SRR13662582 is conventional basespace SRR13662582 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662582_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5605 33.0 33.0 34.0 32.0 34.0 2 32.35125 33.0 33.0 34.0 30.0 34.0 3 32.491 33.0 33.0 34.0 31.0 34.0 4 32.5865 33.0 33.0 34.0 31.0 34.0 5 32.423 33.0 33.0 34.0 31.0 34.0 6 36.08525 38.0 36.0 38.0 31.0 38.0 7 36.58125 38.0 37.0 38.0 34.0 38.0 8 36.7435 38.0 38.0 38.0 34.0 38.0 9 36.81425 38.0 38.0 38.0 35.0 38.0 10-11 36.781625000000005 38.0 38.0 38.0 34.0 38.0 12-13 36.618875 38.0 38.0 38.0 34.0 38.0 14-15 36.753125 38.0 38.0 38.0 34.5 38.0 16-17 36.721625 38.0 38.0 38.0 34.5 38.0 18-19 36.809375 38.0 38.0 38.0 35.0 38.0 20-21 36.738625 38.0 38.0 38.0 34.0 38.0 22-23 36.805 38.0 38.0 38.0 35.0 38.0 24-25 36.647625 38.0 38.0 38.0 34.0 38.0 26-27 36.667 38.0 38.0 38.0 34.0 38.0 28-29 36.8175 38.0 38.0 38.0 35.0 38.0 30-31 36.816874999999996 38.0 38.0 38.0 35.0 38.0 32-33 36.57275 38.0 38.0 38.0 34.0 38.0 34-35 36.598875 38.0 38.0 38.0 34.0 38.0 36-37 36.565124999999995 38.0 38.0 38.0 34.0 38.0 38-39 36.57725 38.0 38.0 38.0 34.0 38.0 40-41 36.710125000000005 38.0 38.0 38.0 34.5 38.0 42-43 36.65925 38.0 38.0 38.0 34.0 38.0 44-45 36.726625 38.0 38.0 38.0 34.0 38.0 46-47 36.5715 38.0 38.0 38.0 34.0 38.0 48-49 36.63525 38.0 38.0 38.0 34.0 38.0 50-51 36.758625 38.0 38.0 38.0 34.5 38.0 52-53 36.63075 38.0 38.0 38.0 34.0 38.0 54-55 36.6845 38.0 38.0 38.0 34.5 38.0 56-57 36.65775 38.0 38.0 38.0 34.0 38.0 58-59 36.41475 38.0 38.0 38.0 33.5 38.0 60-61 36.388000000000005 38.0 38.0 38.0 33.5 38.0 62-63 36.42825 38.0 38.0 38.0 34.0 38.0 64-65 36.380875 38.0 38.0 38.0 33.0 38.0 66-67 36.34375 38.0 37.5 38.0 33.5 38.0 68-69 36.580375000000004 38.0 38.0 38.0 34.0 38.0 70-71 36.401250000000005 38.0 38.0 38.0 34.0 38.0 72-73 36.44475 38.0 38.0 38.0 34.0 38.0 74-75 36.129999999999995 38.0 37.5 38.0 32.5 38.0 76-77 36.41075 38.0 38.0 38.0 34.0 38.0 78-79 36.383875 38.0 38.0 38.0 33.5 38.0 80-81 36.425625 38.0 38.0 38.0 34.0 38.0 82-83 36.1555 38.0 38.0 38.0 33.0 38.0 84-85 36.160250000000005 38.0 38.0 38.0 33.0 38.0 86-87 35.945625 38.0 37.0 38.0 31.5 38.0 88-89 36.173125 38.0 38.0 38.0 33.0 38.0 90-91 36.289625 38.0 38.0 38.0 34.0 38.0 92-93 35.917375 38.0 37.5 38.0 32.0 38.0 94-95 35.96025 38.0 37.5 38.0 32.0 38.0 96-97 35.946125 38.0 37.0 38.0 32.0 38.0 98-99 35.57025 38.0 37.0 38.0 30.0 38.0 100-101 35.82125 38.0 37.0 38.0 31.0 38.0 102-103 35.656 38.0 37.0 38.0 30.5 38.0 104-105 35.896 38.0 37.0 38.0 32.5 38.0 106-107 35.568375 38.0 37.0 38.0 30.5 38.0 108-109 35.538375 38.0 36.0 38.0 31.0 38.0 110-111 35.473375000000004 38.0 36.0 38.0 31.0 38.0 112-113 35.371 38.0 36.0 38.0 29.5 38.0 114-115 35.3185 38.0 36.0 38.0 29.5 38.0 116-117 35.069500000000005 38.0 35.5 38.0 27.5 38.0 118-119 35.19125 38.0 36.0 38.0 29.5 38.0 120-121 34.951499999999996 38.0 35.5 38.0 28.0 38.0 122-123 35.265625 38.0 36.0 38.0 31.0 38.0 124-125 34.66225 38.0 36.0 38.0 29.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 3.0 19 1.0 20 7.0 21 8.0 22 5.0 23 2.0 24 11.0 25 19.0 26 17.0 27 30.0 28 46.0 29 55.0 30 75.0 31 83.0 32 134.0 33 151.0 34 168.0 35 275.0 36 475.0 37 2434.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.400000000000006 13.15 9.375 37.075 2 31.3 18.5 28.025 22.175 3 28.4 23.65 20.65 27.3 4 28.9 29.099999999999998 17.65 24.349999999999998 5 29.225 30.975 19.1 20.7 6 21.55 36.325 19.925 22.2 7 22.0 15.174999999999999 36.725 26.1 8 22.7 21.175 24.175 31.95 9 24.575 19.5 26.775 29.15 10-11 27.1375 27.287499999999998 19.425 26.150000000000002 12-13 24.637500000000003 21.575 26.087500000000002 27.700000000000003 14-15 24.75 22.9375 24.6125 27.700000000000003 16-17 26.174999999999997 22.900000000000002 23.45 27.474999999999998 18-19 26.487500000000004 23.75 23.075000000000003 26.687499999999996 20-21 26.1125 23.2875 23.05 27.55 22-23 26.650000000000002 23.5875 23.575 26.187500000000004 24-25 25.525 24.837500000000002 23.0125 26.625 26-27 26.5625 24.0125 22.7625 26.6625 28-29 25.3 24.1375 23.5 27.0625 30-31 26.9125 22.8625 23.5 26.724999999999998 32-33 26.5 24.175 23.075000000000003 26.25 34-35 26.4625 23.525 23.0375 26.974999999999998 36-37 26.825 23.5875 23.35 26.237500000000004 38-39 25.974999999999998 24.275 23.375 26.375 40-41 27.0 23.0 22.6125 27.3875 42-43 26.8375 22.625 23.6875 26.85 44-45 25.775 23.575 23.200000000000003 27.450000000000003 46-47 27.05 23.125 23.45 26.375 48-49 27.3875 22.55 23.325000000000003 26.737499999999997 50-51 26.187500000000004 24.05 23.05 26.7125 52-53 25.4625 24.4375 22.475 27.625 54-55 26.2125 24.125 22.925 26.737499999999997 56-57 27.187499999999996 23.200000000000003 23.674999999999997 25.937500000000004 58-59 26.6625 23.7625 22.9375 26.637499999999996 60-61 26.85 22.95 23.3125 26.887499999999996 62-63 26.924999999999997 22.725 23.275000000000002 27.075 64-65 27.6125 23.05 22.45 26.887499999999996 66-67 26.5375 23.175 23.2625 27.025 68-69 26.187500000000004 24.0125 23.275000000000002 26.525 70-71 26.387500000000003 23.849999999999998 22.475 27.287499999999998 72-73 27.5875 23.5375 22.95 25.924999999999997 74-75 26.6625 23.8375 22.925 26.575 76-77 26.8 23.9125 22.275 27.0125 78-79 25.8125 23.775 23.45 26.9625 80-81 26.35 22.8125 23.4375 27.400000000000002 82-83 26.650000000000002 23.875 22.9625 26.5125 84-85 25.9875 23.7125 23.5 26.8 86-87 26.450000000000003 23.3875 23.2625 26.900000000000002 88-89 26.9125 23.175 23.150000000000002 26.7625 90-91 26.875 23.1875 22.912499999999998 27.025 92-93 26.787499999999998 22.7625 23.225 27.224999999999998 94-95 27.3125 23.200000000000003 23.3375 26.150000000000002 96-97 27.0625 23.0125 23.35 26.575 98-99 26.7125 23.8875 23.1 26.3 100-101 27.175 22.85 22.975 27.0 102-103 27.0 24.25 22.725 26.025 104-105 26.5125 24.0625 22.8125 26.6125 106-107 26.337500000000002 22.9375 23.674999999999997 27.05 108-109 26.3125 22.5125 24.0375 27.1375 110-111 26.187500000000004 23.35 23.3625 27.1 112-113 26.0125 23.025000000000002 24.375 26.5875 114-115 26.174999999999997 23.5 23.8125 26.5125 116-117 25.924999999999997 24.3625 23.4125 26.3 118-119 26.637499999999996 23.1125 23.0625 27.187499999999996 120-121 26.375 23.05 23.1375 27.437499999999996 122-123 26.575 23.425 24.025 25.974999999999998 124-125 26.5 23.425 23.425 26.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 2.0 29 3.5 30 4.0 31 6.0 32 12.0 33 17.5 34 21.5 35 23.5 36 32.5 37 41.5 38 47.0 39 72.5 40 81.5 41 81.0 42 108.5 43 137.5 44 149.5 45 152.0 46 149.0 47 149.0 48 151.5 49 145.0 50 136.0 51 122.5 52 125.5 53 122.0 54 117.5 55 119.0 56 109.0 57 110.5 58 107.0 59 103.5 60 90.5 61 94.5 62 94.5 63 92.0 64 95.5 65 87.5 66 88.5 67 84.5 68 77.5 69 63.0 70 54.5 71 47.5 72 34.5 73 33.5 74 40.5 75 37.0 76 31.0 77 22.0 78 15.5 79 14.5 80 11.5 81 9.0 82 6.5 83 4.0 84 2.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662582 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662582_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.34375 33.0 32.0 34.0 25.0 34.0 2 31.62075 33.0 32.0 34.0 27.0 34.0 3 31.44125 33.0 32.0 34.0 25.0 34.0 4 31.323 33.0 32.0 34.0 25.0 34.0 5 31.5295 33.0 32.0 34.0 27.0 34.0 6 35.08775 38.0 36.0 38.0 27.0 38.0 7 35.43 38.0 36.0 38.0 29.0 38.0 8 35.09325 38.0 36.0 38.0 28.0 38.0 9 35.62725 38.0 37.0 38.0 29.0 38.0 10-11 35.31975 38.0 36.5 38.0 28.0 38.0 12-13 35.624875 38.0 37.0 38.0 29.0 38.0 14-15 35.220625 38.0 36.0 38.0 27.5 38.0 16-17 35.627875 38.0 37.0 38.0 29.0 38.0 18-19 35.30525 38.0 36.0 38.0 28.0 38.0 20-21 35.002125 38.0 36.0 38.0 26.0 38.0 22-23 35.594 38.0 37.0 38.0 29.0 38.0 24-25 35.60925 38.0 37.0 38.0 28.5 38.0 26-27 35.108125 38.0 36.0 38.0 27.5 38.0 28-29 35.607124999999996 38.0 37.0 38.0 29.0 38.0 30-31 35.196625 38.0 36.5 38.0 27.0 38.0 32-33 35.126125 38.0 36.0 38.0 27.0 38.0 34-35 35.051 38.0 36.0 38.0 27.0 38.0 36-37 35.2025 38.0 36.0 38.0 27.5 38.0 38-39 34.680875 38.0 35.5 38.0 24.5 38.0 40-41 35.03525 38.0 36.0 38.0 26.0 38.0 42-43 35.403375 38.0 36.5 38.0 28.0 38.0 44-45 35.09875 38.0 36.0 38.0 26.5 38.0 46-47 35.617999999999995 38.0 37.0 38.0 29.0 38.0 48-49 35.618375 38.0 37.0 38.0 29.0 38.0 50-51 35.67625 38.0 37.0 38.0 29.0 38.0 52-53 35.70425 38.0 37.0 38.0 30.0 38.0 54-55 35.78525 38.0 37.0 38.0 30.5 38.0 56-57 35.861875 38.0 37.0 38.0 31.0 38.0 58-59 35.605999999999995 38.0 37.0 38.0 29.0 38.0 60-61 35.7255 38.0 37.0 38.0 30.0 38.0 62-63 35.605125 38.0 36.5 38.0 29.5 38.0 64-65 35.4955 38.0 36.5 38.0 28.5 38.0 66-67 35.501875 38.0 37.0 38.0 29.0 38.0 68-69 35.655375 38.0 37.0 38.0 30.0 38.0 70-71 35.671 38.0 37.0 38.0 29.5 38.0 72-73 35.716 38.0 37.0 38.0 30.0 38.0 74-75 35.342125 38.0 36.0 38.0 28.0 38.0 76-77 35.457499999999996 38.0 37.0 38.0 29.0 38.0 78-79 35.503875 38.0 36.5 38.0 30.0 38.0 80-81 35.492875 38.0 36.5 38.0 29.0 38.0 82-83 35.315125 38.0 36.5 38.0 28.5 38.0 84-85 35.682249999999996 38.0 37.0 38.0 30.5 38.0 86-87 35.44425 38.0 36.5 38.0 29.5 38.0 88-89 35.52075 38.0 37.0 38.0 30.0 38.0 90-91 35.24525 38.0 36.0 38.0 28.5 38.0 92-93 35.347625 38.0 36.0 38.0 29.0 38.0 94-95 35.128625 38.0 35.5 38.0 28.0 38.0 96-97 35.24325 38.0 36.0 38.0 28.0 38.0 98-99 34.997125 38.0 35.5 38.0 27.0 38.0 100-101 35.146875 38.0 36.0 38.0 28.0 38.0 102-103 35.123374999999996 38.0 36.0 38.0 28.5 38.0 104-105 34.90825 38.0 35.0 38.0 27.0 38.0 106-107 34.787625 38.0 35.5 38.0 26.0 38.0 108-109 34.78075 38.0 35.5 38.0 25.5 38.0 110-111 34.911 38.0 35.5 38.0 27.5 38.0 112-113 34.77125 38.0 35.5 38.0 26.0 38.0 114-115 34.848875 38.0 36.0 38.0 27.5 38.0 116-117 34.418875 38.0 35.0 38.0 24.0 38.0 118-119 34.513999999999996 38.0 35.0 38.0 25.5 38.0 120-121 34.311375 38.0 35.0 38.0 24.5 38.0 122-123 34.05775 38.0 35.0 38.0 23.5 38.0 124-125 33.607749999999996 38.0 35.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 7.0 16 4.0 17 5.0 18 8.0 19 14.0 20 17.0 21 19.0 22 27.0 23 29.0 24 27.0 25 39.0 26 67.0 27 60.0 28 68.0 29 94.0 30 94.0 31 96.0 32 115.0 33 165.0 34 219.0 35 287.0 36 456.0 37 2080.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.1 12.45 11.625 36.825 2 31.5 18.325 29.125 21.05 3 26.575 24.075 21.0 28.349999999999998 4 30.25 28.275 16.875 24.6 5 28.225 32.025 19.3 20.45 6 21.725 34.449999999999996 20.65 23.175 7 22.425 15.0 38.074999999999996 24.5 8 23.549999999999997 20.025000000000002 24.325 32.1 9 24.65 17.849999999999998 27.675 29.825000000000003 10-11 27.187499999999996 27.437499999999996 19.725 25.650000000000002 12-13 25.35 21.2875 26.700000000000003 26.6625 14-15 25.05 21.775 26.187500000000004 26.987499999999997 16-17 26.2625 22.125 23.6625 27.950000000000003 18-19 25.474999999999998 23.5875 24.8125 26.125 20-21 26.0625 22.6125 24.3625 26.9625 22-23 26.900000000000002 23.35 22.7625 26.987499999999997 24-25 26.1625 23.2875 24.1125 26.437500000000004 26-27 25.474999999999998 23.962500000000002 23.425 27.1375 28-29 26.75 23.125 22.900000000000002 27.224999999999998 30-31 27.0 22.162499999999998 23.9375 26.900000000000002 32-33 25.75 23.625 24.0125 26.6125 34-35 26.5375 23.4125 23.4625 26.5875 36-37 26.025 24.099999999999998 23.325000000000003 26.55 38-39 26.087500000000002 23.974999999999998 22.725 27.212500000000002 40-41 27.3625 23.5875 23.0875 25.9625 42-43 26.437500000000004 22.85 23.962500000000002 26.75 44-45 26.05 23.6125 23.525 26.8125 46-47 27.4125 24.275 22.175 26.137500000000003 48-49 24.762500000000003 22.35 24.75 28.1375 50-51 25.5625 23.799999999999997 23.1625 27.474999999999998 52-53 27.625 23.9 22.1375 26.337500000000002 54-55 26.4125 23.400000000000002 23.525 26.6625 56-57 26.150000000000002 23.275000000000002 23.474999999999998 27.1 58-59 27.187499999999996 22.912499999999998 22.650000000000002 27.250000000000004 60-61 26.450000000000003 22.975 23.025000000000002 27.55 62-63 25.637500000000003 23.225 24.0625 27.075 64-65 27.450000000000003 22.7 22.625 27.224999999999998 66-67 26.75 23.525 23.5375 26.187500000000004 68-69 26.200000000000003 23.2625 24.425 26.1125 70-71 26.924999999999997 23.05 23.275000000000002 26.75 72-73 27.05 23.225 23.5875 26.137500000000003 74-75 25.837500000000002 23.5875 23.799999999999997 26.775 76-77 26.637499999999996 24.1125 22.95 26.3 78-79 27.200000000000003 23.075000000000003 22.975 26.75 80-81 26.5 23.3625 23.6375 26.5 82-83 26.950000000000003 23.225 23.3 26.525 84-85 26.3 23.5125 23.2625 26.924999999999997 86-87 26.337500000000002 23.95 23.4125 26.3 88-89 26.937499999999996 23.6875 22.6375 26.737499999999997 90-91 25.412499999999998 23.375 24.224999999999998 26.987499999999997 92-93 25.924999999999997 23.175 23.35 27.55 94-95 26.637499999999996 23.3375 23.2125 26.8125 96-97 27.05 22.45 22.8875 27.6125 98-99 26.687499999999996 23.5875 23.2625 26.4625 100-101 26.4625 23.025000000000002 22.8875 27.625 102-103 25.7625 23.0 22.9625 28.275 104-105 26.087500000000002 23.375 24.125 26.4125 106-107 27.925 23.05 23.0375 25.9875 108-109 27.450000000000003 23.1 22.6 26.85 110-111 26.5875 23.7375 22.9625 26.7125 112-113 26.775 23.0125 23.375 26.8375 114-115 26.525 23.0375 23.775 26.6625 116-117 27.450000000000003 22.925 23.9375 25.687500000000004 118-119 27.3625 23.0375 22.7125 26.887499999999996 120-121 26.887499999999996 23.1375 23.7125 26.2625 122-123 27.037499999999998 23.3375 23.1125 26.5125 124-125 27.55 23.1375 22.787499999999998 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.0 28 3.0 29 4.5 30 5.0 31 4.5 32 11.5 33 13.5 34 15.0 35 26.0 36 36.0 37 43.0 38 59.5 39 73.0 40 81.5 41 97.5 42 123.5 43 148.0 44 144.0 45 137.0 46 150.5 47 153.5 48 140.0 49 133.0 50 128.0 51 126.0 52 120.5 53 119.5 54 125.0 55 128.0 56 122.5 57 112.5 58 113.5 59 104.5 60 92.0 61 91.0 62 92.0 63 81.0 64 79.0 65 79.0 66 78.0 67 78.5 68 65.5 69 58.5 70 64.0 71 55.5 72 39.5 73 43.0 74 43.0 75 37.0 76 28.0 77 23.0 78 17.5 79 10.0 80 9.0 81 6.5 82 8.5 83 8.0 84 1.5 85 0.0 86 1.5 87 2.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580943 spots for SRR13662582.sra Written 580943 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra Read 580924 spots for SRR13662582.sra Written 580924 spots for SRR13662582.sra SRR ids: ['SRR13662582.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x_hkzlct SRR13662582.sra spots: 11618499 blocks: [[1, 580924], [580925, 1161848], [1161849, 1742772], [1742773, 2323696], [2323697, 2904620], [2904621, 3485544], [3485545, 4066468], [4066469, 4647392], [4647393, 5228316], [5228317, 5809240], [5809241, 6390164], [6390165, 6971088], [6971089, 7552012], [7552013, 8132936], [8132937, 8713860], [8713861, 9294784], [9294785, 9875708], [9875709, 10456632], [10456633, 11037556], [11037557, 11618499]] SRR13662582 file size 3336771 SRR13662582 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662582 SRR13662582_1.fastq SRR13662582_2.fastq Input file: SRR13662582_1.fastq Paired file: SRR13662582_2.fastq trimmed: SRR13662582-trimmed-pair1.fastq, SRR13662582-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:28:26 2024 >> started Tue Dec 10 07:28:38 2024 >> done (11.122s) 11618499 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 55 ( 0.00%) empty read pairs filtered out after trimming by size control 11618444 (100.00%) read pairs available; of these: 1437136 (12.37%) trimmed read pairs available after processing 10181308 (87.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 1 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 1 0.00% 47 1 0.00% 48 1 0.00% 49 1 0.00% 50 1 0.00% 51 1 0.00% 52 0 0.00% 53 1 0.00% 54 1 0.00% 55 0 0.00% 56 2 0.00% 57 2 0.00% 58 0 0.00% 59 2 0.00% 60 3 0.00% 61 0 0.00% 62 2 0.00% 63 23 0.00% 64 38 0.00% 65 47 0.00% 66 86 0.00% 67 80 0.00% 68 84 0.00% 69 98 0.00% 70 147 0.00% 71 172 0.00% 72 175 0.00% 73 215 0.00% 74 199 0.00% 75 226 0.00% 76 258 0.00% 77 316 0.00% 78 357 0.00% 79 361 0.00% 80 445 0.00% 81 467 0.00% 82 540 0.00% 83 598 0.01% 84 606 0.01% 85 695 0.01% 86 719 0.01% 87 818 0.01% 88 919 0.01% 89 1007 0.01% 90 1141 0.01% 91 1280 0.01% 92 1502 0.01% 93 1911 0.02% 94 4713 0.04% 95 4949 0.04% 96 5221 0.04% 97 5623 0.05% 98 5708 0.05% 99 6068 0.05% 100 6357 0.05% 101 6633 0.06% 102 6912 0.06% 103 7219 0.06% 104 7691 0.07% 105 8072 0.07% 106 8500 0.07% 107 9011 0.08% 108 9913 0.09% 109 10409 0.09% 110 11346 0.10% 111 12360 0.11% 112 13680 0.12% 113 15039 0.13% 114 16981 0.15% 115 19383 0.17% 116 34108 0.29% 117 38485 0.33% 118 45348 0.39% 119 54802 0.47% 120 68422 0.59% 121 89892 0.77% 122 132748 1.14% 123 219064 1.89% 124 536922 4.62% 125 10181308 87.63% 11618444 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=6.33 fanout-score-rank=18 prefix-density=0.17 prefix-fanout=4.3 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=27 fanout-score=442.89 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=27.4 sequence=GCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGG criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=28 prefix-density=0.13 prefix-fanout=2.6 sequence=TGAAGCAGATCGAGTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=313.05 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=28.5 sequence=CGCCGCCGCCGA SRR13662582 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 10 07:35:37 Started mapping on | Dec 10 07:35:39 Finished on | Dec 10 07:38:51 Mapping speed, Million of reads per hour | 217.85 Number of input reads | 11618437 Average input read length | 228 UNIQUE READS: Uniquely mapped reads number | 8816778 Uniquely mapped reads % | 75.89% Average mapped length | 226.60 Number of splices: Total | 6209363 Number of splices: Annotated (sjdb) | 5865813 Number of splices: GT/AG | 6124141 Number of splices: GC/AG | 70789 Number of splices: AT/AC | 2909 Number of splices: Non-canonical | 11524 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 161515 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 16773 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 21.60% % of reads unmapped: other | 0.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2640902 2640902 2640902 N_multimapping 161515 161515 161515 N_noFeature 273289 4464915 4476159 N_ambiguous 189180 21312 21101 UnstrandedReadsAssigned:8354309 PositiveStrandReadsAssigned:4330551 NegativeStrandReadsAssigned:4319518 Dataset is classified unstranded MeadianReadLen=105 20thPercentileLength=105 echo kmer=101 SRR13662582 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662582-trimmed-pair1.fastq SRR13662582-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,618,437 reads, 9,173,854 reads pseudoaligned [quant] estimated average fragment length: 181.572 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52973 SRR13662582.ke.tsv 35125 SRR13662582.se.tsv 88098 total ==> SRR13662582.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 755.593 0 0 PNS24247 1044 863.428 27.4557 4.90901 PNS24249 1928 1747.43 156.662 13.8405 PNS24246 1044 863.428 27.4557 4.90901 PNS24248 1044 863.428 27.4557 4.90901 PNS24244 1471 1290.43 7.97081 0.953577 PNS24243 293 117.61 8 10.5011 KQK14069 1603 1422.43 3760.16 408.097 KQK14071 474 295.05 486.784 254.699 ==> SRR13662582.se.tsv <== BRADI_1g14170v3 4184 BRADI_1g53295v3 29 BRADI_1g59795v3 147 BRADI_1g07683v3 0 BRADI_1g00485v3 9 BRADI_1g20270v3 162 BRADI_1g74790v3 495 BRADI_1g09890v3 0 BRADI_1g77505v3 109 BRADI_1g48960v3 0 SRR13662582 completed mapping pipeline successfully