Starting /dee2/code/volunteer_pipeline.sh SRR13662583 current disk space = 1526687870976 free memory = 1555223868 SRR13662583 SRAfilesize f0e66e1e4f303e7ac2313a72b60d94c2 SRR13662583.sra SRR13662583.sra file validated SRR13662583 is paired end SRR13662583 is conventional basespace SRR13662583 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662583_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37 33.0 33.0 34.0 31.0 34.0 2 32.36875 33.0 33.0 34.0 30.0 34.0 3 32.10125 33.0 32.0 34.0 30.0 34.0 4 32.235 33.0 33.0 34.0 30.0 34.0 5 32.3775 33.0 33.0 34.0 31.0 34.0 6 35.97175 38.0 36.0 38.0 31.0 38.0 7 36.443 38.0 37.0 38.0 34.0 38.0 8 36.621 38.0 38.0 38.0 34.0 38.0 9 36.6605 38.0 38.0 38.0 34.0 38.0 10-11 36.475125 38.0 38.0 38.0 34.0 38.0 12-13 36.48125 38.0 38.0 38.0 33.5 38.0 14-15 36.574625 38.0 38.0 38.0 34.0 38.0 16-17 36.5845 38.0 38.0 38.0 34.0 38.0 18-19 36.723124999999996 38.0 38.0 38.0 34.5 38.0 20-21 36.715125 38.0 38.0 38.0 34.0 38.0 22-23 36.7805 38.0 38.0 38.0 35.0 38.0 24-25 36.819375 38.0 38.0 38.0 35.0 38.0 26-27 36.672625 38.0 38.0 38.0 34.0 38.0 28-29 36.692875 38.0 38.0 38.0 34.0 38.0 30-31 36.57275 38.0 38.0 38.0 34.0 38.0 32-33 36.545375 38.0 38.0 38.0 34.0 38.0 34-35 36.563625 38.0 38.0 38.0 34.0 38.0 36-37 36.686625 38.0 38.0 38.0 34.0 38.0 38-39 36.613125 38.0 38.0 38.0 34.0 38.0 40-41 36.653625000000005 38.0 38.0 38.0 34.0 38.0 42-43 36.498875 38.0 38.0 38.0 34.0 38.0 44-45 36.47 38.0 38.0 38.0 34.0 38.0 46-47 36.558625000000006 38.0 38.0 38.0 34.0 38.0 48-49 36.56 38.0 38.0 38.0 34.0 38.0 50-51 36.387875 38.0 38.0 38.0 34.0 38.0 52-53 36.298249999999996 38.0 38.0 38.0 33.5 38.0 54-55 36.519999999999996 38.0 38.0 38.0 34.0 38.0 56-57 36.505875 38.0 38.0 38.0 33.5 38.0 58-59 36.626000000000005 38.0 38.0 38.0 34.0 38.0 60-61 36.50675 38.0 38.0 38.0 34.0 38.0 62-63 36.31675 38.0 38.0 38.0 33.5 38.0 64-65 36.222875 38.0 38.0 38.0 33.0 38.0 66-67 36.373125 38.0 38.0 38.0 33.5 38.0 68-69 36.506375000000006 38.0 38.0 38.0 34.0 38.0 70-71 36.382125 38.0 38.0 38.0 34.0 38.0 72-73 36.052375 38.0 37.5 38.0 33.0 38.0 74-75 36.334125 38.0 38.0 38.0 33.5 38.0 76-77 36.46575 38.0 38.0 38.0 34.0 38.0 78-79 36.140375 38.0 38.0 38.0 32.5 38.0 80-81 36.198875 38.0 38.0 38.0 33.0 38.0 82-83 36.127375 38.0 37.5 38.0 32.0 38.0 84-85 36.397875 38.0 38.0 38.0 34.0 38.0 86-87 35.941874999999996 38.0 37.0 38.0 31.5 38.0 88-89 35.819500000000005 38.0 37.0 38.0 31.0 38.0 90-91 35.800124999999994 38.0 37.0 38.0 31.0 38.0 92-93 35.676375 38.0 37.0 38.0 30.5 38.0 94-95 35.73925 38.0 37.0 38.0 31.0 38.0 96-97 35.563874999999996 38.0 36.5 38.0 30.5 38.0 98-99 35.83125 38.0 37.0 38.0 31.5 38.0 100-101 35.746375 38.0 37.0 38.0 31.0 38.0 102-103 35.443 38.0 36.5 38.0 29.5 38.0 104-105 35.544125 38.0 37.0 38.0 30.5 38.0 106-107 35.16275 38.0 36.0 38.0 28.5 38.0 108-109 35.626875 38.0 36.5 38.0 31.0 38.0 110-111 35.581 38.0 37.0 38.0 31.0 38.0 112-113 35.574875 38.0 36.0 38.0 31.0 38.0 114-115 35.13775 38.0 36.0 38.0 29.0 38.0 116-117 34.905 38.0 35.5 38.0 28.0 38.0 118-119 34.696 38.0 35.5 38.0 26.0 38.0 120-121 34.43625 38.0 35.0 38.0 25.0 38.0 122-123 34.07525 38.0 35.0 38.0 23.0 38.0 124-125 33.76475 38.0 35.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 2.0 18 2.0 19 6.0 20 6.0 21 4.0 22 3.0 23 15.0 24 10.0 25 26.0 26 30.0 27 34.0 28 45.0 29 60.0 30 63.0 31 99.0 32 103.0 33 160.0 34 209.0 35 280.0 36 529.0 37 2312.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.875 11.899999999999999 11.15 36.075 2 30.65 17.7 30.625000000000004 21.025 3 28.050000000000004 23.5 20.974999999999998 27.474999999999998 4 29.125 30.225 16.7 23.95 5 29.799999999999997 30.4 20.05 19.75 6 22.475 33.675 20.674999999999997 23.175 7 21.3 15.325 37.025000000000006 26.35 8 23.549999999999997 20.25 25.624999999999996 30.575000000000003 9 24.125 18.525 26.174999999999997 31.175000000000004 10-11 26.9625 28.3875 18.8875 25.7625 12-13 25.224999999999998 21.7375 25.55 27.487499999999997 14-15 25.924999999999997 23.724999999999998 24.3875 25.9625 16-17 27.037499999999998 23.125 23.4625 26.375 18-19 26.6625 23.9 23.025000000000002 26.4125 20-21 26.1625 23.200000000000003 23.1875 27.450000000000003 22-23 26.400000000000002 24.349999999999998 23.1 26.150000000000002 24-25 28.1875 23.3125 22.5625 25.937500000000004 26-27 26.687499999999996 23.5125 23.4125 26.387500000000003 28-29 26.637499999999996 23.5625 23.6375 26.1625 30-31 26.25 24.125 22.9375 26.687499999999996 32-33 26.3 23.5375 23.525 26.637499999999996 34-35 26.8 23.425 23.4125 26.3625 36-37 26.650000000000002 23.150000000000002 23.6625 26.5375 38-39 26.575 23.625 23.0875 26.7125 40-41 27.212500000000002 24.087500000000002 22.4375 26.2625 42-43 26.474999999999998 23.2625 24.0 26.2625 44-45 26.6625 23.400000000000002 22.525000000000002 27.4125 46-47 26.5875 22.8625 23.5375 27.0125 48-49 25.7875 23.775 23.05 27.3875 50-51 26.987499999999997 23.7 23.0375 26.275 52-53 26.5875 24.1125 22.475 26.825 54-55 26.224999999999998 22.8375 23.3125 27.625 56-57 27.6875 23.200000000000003 22.8 26.3125 58-59 26.55 22.45 23.075000000000003 27.925 60-61 26.8125 23.125 23.05 27.0125 62-63 26.450000000000003 23.1125 24.325 26.1125 64-65 27.0 23.45 22.8125 26.737499999999997 66-67 26.0125 23.7625 23.962500000000002 26.2625 68-69 27.212500000000002 23.5625 22.725 26.5 70-71 26.85 23.625 22.9625 26.5625 72-73 27.125 23.3375 22.9375 26.6 74-75 26.125 23.3125 23.3875 27.175 76-77 26.187500000000004 23.6875 23.0875 27.037499999999998 78-79 26.7625 23.2125 22.900000000000002 27.125 80-81 26.625 23.7625 22.662499999999998 26.950000000000003 82-83 26.974999999999998 22.95 23.2375 26.8375 84-85 25.474999999999998 23.7375 22.75 28.037499999999998 86-87 26.8125 23.9375 22.7125 26.5375 88-89 27.35 23.4375 22.8375 26.375 90-91 26.8625 23.6375 23.7125 25.7875 92-93 26.8125 23.3125 23.400000000000002 26.474999999999998 94-95 26.775 22.35 24.1125 26.7625 96-97 26.9625 23.1875 23.25 26.6 98-99 27.0875 23.225 23.6125 26.075 100-101 27.075 22.8 23.400000000000002 26.724999999999998 102-103 26.6 22.725 23.325000000000003 27.35 104-105 26.987499999999997 22.85 23.775 26.387500000000003 106-107 27.212500000000002 22.725 22.8875 27.175 108-109 26.224999999999998 23.5375 23.7875 26.450000000000003 110-111 26.224999999999998 23.375 22.8875 27.5125 112-113 27.3 23.8125 23.325000000000003 25.5625 114-115 26.0 23.6625 23.175 27.1625 116-117 26.674999999999997 22.675 23.3 27.35 118-119 26.775 23.6125 23.1 26.5125 120-121 25.8 23.95 22.8875 27.3625 122-123 27.375 23.2375 23.2125 26.174999999999997 124-125 27.187499999999996 24.15 22.537499999999998 26.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 1.0 26 1.0 27 1.0 28 2.0 29 3.5 30 4.5 31 5.5 32 7.5 33 12.5 34 22.5 35 24.0 36 32.5 37 45.0 38 53.5 39 75.5 40 95.5 41 103.0 42 116.5 43 142.0 44 155.5 45 161.5 46 161.5 47 149.5 48 143.0 49 145.5 50 136.5 51 119.5 52 113.5 53 111.0 54 108.5 55 102.0 56 102.0 57 104.5 58 95.5 59 90.5 60 95.0 61 91.0 62 74.0 63 67.5 64 72.5 65 83.5 66 85.0 67 79.0 68 79.5 69 72.5 70 61.0 71 62.5 72 54.0 73 47.5 74 46.5 75 35.5 76 35.5 77 32.5 78 22.5 79 13.0 80 12.0 81 12.0 82 4.5 83 0.5 84 2.0 85 2.5 86 2.5 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCCC 15 0.0040846216 59.5 50-51 >>END_MODULE SRR13662583 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662583_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.54825 33.0 32.0 34.0 27.0 34.0 2 31.27475 33.0 32.0 34.0 25.0 34.0 3 31.4855 33.0 32.0 34.0 25.0 34.0 4 31.20275 33.0 32.0 34.0 25.0 34.0 5 31.06875 33.0 32.0 34.0 25.0 34.0 6 35.0155 38.0 36.0 38.0 27.0 38.0 7 34.77875 38.0 36.0 38.0 26.0 38.0 8 35.012 38.0 36.0 38.0 27.0 38.0 9 34.41825 38.0 35.0 38.0 16.0 38.0 10-11 34.95025 38.0 36.0 38.0 27.0 38.0 12-13 35.190875000000005 38.0 36.0 38.0 27.5 38.0 14-15 35.1295 38.0 36.0 38.0 27.5 38.0 16-17 35.142875000000004 38.0 36.0 38.0 27.5 38.0 18-19 34.704625 38.0 35.0 38.0 26.0 38.0 20-21 34.971999999999994 38.0 36.0 38.0 26.5 38.0 22-23 35.128375 38.0 36.0 38.0 27.0 38.0 24-25 35.0535 38.0 36.0 38.0 26.0 38.0 26-27 35.1575 38.0 36.0 38.0 27.5 38.0 28-29 34.85025 38.0 36.0 38.0 26.0 38.0 30-31 34.675250000000005 38.0 35.5 38.0 24.5 38.0 32-33 34.957125000000005 38.0 36.0 38.0 26.0 38.0 34-35 35.30200000000001 38.0 36.0 38.0 27.5 38.0 36-37 34.735125 38.0 35.5 38.0 25.0 38.0 38-39 34.53475 38.0 35.5 38.0 20.5 38.0 40-41 35.01175 38.0 36.0 38.0 26.0 38.0 42-43 35.120374999999996 38.0 36.0 38.0 26.5 38.0 44-45 35.245625000000004 38.0 36.0 38.0 27.0 38.0 46-47 35.121625 38.0 36.0 38.0 27.0 38.0 48-49 34.934125 38.0 36.0 38.0 25.0 38.0 50-51 34.61775 38.0 35.0 38.0 24.5 38.0 52-53 35.239000000000004 38.0 36.0 38.0 27.5 38.0 54-55 35.421375 38.0 36.5 38.0 28.5 38.0 56-57 35.452124999999995 38.0 36.5 38.0 28.5 38.0 58-59 35.379125 38.0 36.0 38.0 28.5 38.0 60-61 35.445499999999996 38.0 36.0 38.0 28.5 38.0 62-63 35.15275 38.0 36.0 38.0 27.0 38.0 64-65 35.092375000000004 38.0 36.0 38.0 26.5 38.0 66-67 34.571749999999994 38.0 35.0 38.0 20.5 38.0 68-69 35.410124999999994 38.0 36.0 38.0 28.5 38.0 70-71 35.360375000000005 38.0 36.5 38.0 27.5 38.0 72-73 35.108625 38.0 36.0 38.0 27.5 38.0 74-75 35.143125 38.0 36.0 38.0 27.0 38.0 76-77 35.54 38.0 36.5 38.0 29.5 38.0 78-79 35.051249999999996 38.0 36.0 38.0 26.5 38.0 80-81 35.163875000000004 38.0 36.0 38.0 27.5 38.0 82-83 34.96525 38.0 36.0 38.0 26.5 38.0 84-85 35.2105 38.0 36.0 38.0 28.0 38.0 86-87 34.949 38.0 36.0 38.0 26.5 38.0 88-89 34.752875 38.0 36.0 38.0 25.0 38.0 90-91 35.205125 38.0 36.0 38.0 28.0 38.0 92-93 35.19725 38.0 36.0 38.0 28.0 38.0 94-95 35.292249999999996 38.0 36.0 38.0 29.0 38.0 96-97 34.81762500000001 38.0 35.5 38.0 25.0 38.0 98-99 34.712125 38.0 35.0 38.0 25.0 38.0 100-101 34.475 38.0 35.0 38.0 24.5 38.0 102-103 34.6575 38.0 35.0 38.0 25.0 38.0 104-105 34.43025 38.0 35.0 38.0 24.0 38.0 106-107 34.55675 38.0 35.0 38.0 24.5 38.0 108-109 34.26625 38.0 35.0 38.0 23.0 38.0 110-111 34.650125 38.0 35.0 38.0 26.0 38.0 112-113 34.622 38.0 35.0 38.0 26.0 38.0 114-115 34.128 38.0 35.0 38.0 23.0 38.0 116-117 34.50125 38.0 35.0 38.0 25.5 38.0 118-119 34.081875 38.0 35.0 38.0 23.0 38.0 120-121 33.818 38.0 35.0 38.0 22.0 38.0 122-123 33.596625 38.0 35.0 38.0 21.0 38.0 124-125 32.951499999999996 38.0 35.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 2.0 15 6.0 16 6.0 17 9.0 18 10.0 19 12.0 20 14.0 21 29.0 22 39.0 23 32.0 24 49.0 25 56.0 26 49.0 27 64.0 28 79.0 29 95.0 30 114.0 31 128.0 32 119.0 33 159.0 34 222.0 35 300.0 36 477.0 37 1923.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.825 12.475 11.225 35.475 2 31.225 17.849999999999998 30.325000000000003 20.599999999999998 3 29.95 24.125 19.475 26.450000000000003 4 30.55 29.825000000000003 16.55 23.075000000000003 5 28.749999999999996 30.925000000000004 20.05 20.275000000000002 6 23.1 33.15 20.775 22.975 7 20.849999999999998 15.675 38.75 24.725 8 24.025 19.625 25.624999999999996 30.725 9 25.424999999999997 18.425 27.800000000000004 28.349999999999998 10-11 27.3625 28.175 19.6125 24.85 12-13 25.7 21.099999999999998 26.150000000000002 27.05 14-15 26.625 22.175 25.374999999999996 25.825 16-17 26.487500000000004 23.0875 23.5375 26.887499999999996 18-19 25.7 22.825 24.8125 26.6625 20-21 26.724999999999998 23.0875 23.8125 26.375 22-23 26.637499999999996 24.0375 23.5375 25.7875 24-25 26.337500000000002 24.2375 22.6125 26.8125 26-27 26.237500000000004 23.925 23.525 26.3125 28-29 26.85 23.724999999999998 23.075000000000003 26.35 30-31 26.4125 23.2625 22.9875 27.3375 32-33 26.4625 23.674999999999997 23.7375 26.125 34-35 26.9125 23.25 23.525 26.3125 36-37 26.125 23.0375 23.6625 27.175 38-39 26.6625 23.200000000000003 23.5625 26.575 40-41 26.875 23.3625 23.2125 26.55 42-43 26.2125 23.65 22.900000000000002 27.237499999999997 44-45 26.887499999999996 23.0375 22.95 27.125 46-47 26.687499999999996 23.8125 23.6125 25.887500000000003 48-49 26.637499999999996 23.275000000000002 22.8625 27.224999999999998 50-51 26.3 23.474999999999998 23.3375 26.887499999999996 52-53 27.0125 23.575 23.0 26.4125 54-55 26.1625 23.474999999999998 22.95 27.4125 56-57 25.874999999999996 23.8625 23.9125 26.35 58-59 27.224999999999998 22.8875 23.2875 26.6 60-61 26.4125 23.3 23.7375 26.55 62-63 26.174999999999997 23.1375 22.9625 27.725 64-65 26.337500000000002 23.5125 24.349999999999998 25.8 66-67 26.4125 22.9625 23.474999999999998 27.150000000000002 68-69 26.900000000000002 22.6875 23.025000000000002 27.3875 70-71 26.25 23.275000000000002 23.625 26.85 72-73 25.775 23.9375 23.0 27.287499999999998 74-75 26.224999999999998 23.3375 23.5 26.937499999999996 76-77 26.174999999999997 23.2125 23.4875 27.125 78-79 26.687499999999996 23.200000000000003 22.625 27.487499999999997 80-81 26.900000000000002 23.05 22.9875 27.0625 82-83 26.5375 23.0875 23.5 26.875 84-85 26.4125 22.8375 23.175 27.575 86-87 26.2875 23.400000000000002 23.5125 26.8 88-89 26.0 23.075000000000003 23.8125 27.1125 90-91 27.200000000000003 22.7 22.7625 27.3375 92-93 26.125 23.2375 23.150000000000002 27.487499999999997 94-95 27.175 22.9875 22.6 27.237499999999997 96-97 27.1125 22.5125 23.549999999999997 26.825 98-99 26.700000000000003 23.65 23.400000000000002 26.25 100-101 26.6625 23.474999999999998 23.025000000000002 26.8375 102-103 27.075 23.925 22.662499999999998 26.337500000000002 104-105 27.3625 22.8125 23.1875 26.637499999999996 106-107 26.525 22.8 23.7375 26.937499999999996 108-109 26.3 22.8625 23.3875 27.450000000000003 110-111 26.087500000000002 23.150000000000002 23.3375 27.425 112-113 26.7125 23.075000000000003 23.4375 26.775 114-115 26.4625 23.674999999999997 22.8625 27.0 116-117 26.650000000000002 23.125 23.549999999999997 26.674999999999997 118-119 27.187499999999996 22.8875 23.8375 26.087500000000002 120-121 25.7375 24.325 23.3625 26.575 122-123 26.187500000000004 23.0875 23.5875 27.1375 124-125 26.887499999999996 23.7875 23.0375 26.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.5 25 2.0 26 0.5 27 1.5 28 2.5 29 3.0 30 3.5 31 6.0 32 11.5 33 12.0 34 15.5 35 26.0 36 37.0 37 50.5 38 59.5 39 62.0 40 75.5 41 104.5 42 121.5 43 135.0 44 147.5 45 152.5 46 154.0 47 153.5 48 160.5 49 146.5 50 126.0 51 131.5 52 135.0 53 123.5 54 99.0 55 91.0 56 99.5 57 107.0 58 110.5 59 98.5 60 83.5 61 81.0 62 87.0 63 92.5 64 87.0 65 76.5 66 71.0 67 72.5 68 75.0 69 67.0 70 57.5 71 64.0 72 64.0 73 54.0 74 48.0 75 37.0 76 27.0 77 22.5 78 20.0 79 14.5 80 9.5 81 4.5 82 5.5 83 3.0 84 1.0 85 1.0 86 0.5 87 0.5 88 1.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661107 spots for SRR13662583.sra Written 661107 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra Read 661096 spots for SRR13662583.sra Written 661096 spots for SRR13662583.sra SRR ids: ['SRR13662583.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mg91invd SRR13662583.sra spots: 13221931 blocks: [[1, 661096], [661097, 1322192], [1322193, 1983288], [1983289, 2644384], [2644385, 3305480], [3305481, 3966576], [3966577, 4627672], [4627673, 5288768], [5288769, 5949864], [5949865, 6610960], [6610961, 7272056], [7272057, 7933152], [7933153, 8594248], [8594249, 9255344], [9255345, 9916440], [9916441, 10577536], [10577537, 11238632], [11238633, 11899728], [11899729, 12560824], [12560825, 13221931]] SRR13662583 file size 3800264 SRR13662583 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662583 SRR13662583_1.fastq SRR13662583_2.fastq Input file: SRR13662583_1.fastq Paired file: SRR13662583_2.fastq trimmed: SRR13662583-trimmed-pair1.fastq, SRR13662583-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:35:00 2024 >> started Tue Dec 10 07:35:13 2024 >> done (12.919s) 13221931 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 91 ( 0.00%) empty read pairs filtered out after trimming by size control 13221840 (100.00%) read pairs available; of these: 1656804 (12.53%) trimmed read pairs available after processing 11565036 (87.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 3 0.00% 36 0 0.00% 37 1 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 0 0.00% 47 0 0.00% 48 1 0.00% 49 0 0.00% 50 2 0.00% 51 0 0.00% 52 0 0.00% 53 2 0.00% 54 1 0.00% 55 0 0.00% 56 0 0.00% 57 0 0.00% 58 7 0.00% 59 2 0.00% 60 2 0.00% 61 6 0.00% 62 5 0.00% 63 17 0.00% 64 34 0.00% 65 49 0.00% 66 77 0.00% 67 91 0.00% 68 97 0.00% 69 135 0.00% 70 153 0.00% 71 153 0.00% 72 191 0.00% 73 209 0.00% 74 237 0.00% 75 261 0.00% 76 302 0.00% 77 301 0.00% 78 356 0.00% 79 420 0.00% 80 458 0.00% 81 486 0.00% 82 503 0.00% 83 548 0.00% 84 640 0.00% 85 684 0.01% 86 745 0.01% 87 809 0.01% 88 922 0.01% 89 1130 0.01% 90 1065 0.01% 91 1430 0.01% 92 1554 0.01% 93 2016 0.02% 94 5416 0.04% 95 5612 0.04% 96 5868 0.04% 97 6197 0.05% 98 6444 0.05% 99 6879 0.05% 100 7253 0.05% 101 7491 0.06% 102 7928 0.06% 103 8323 0.06% 104 8655 0.07% 105 9108 0.07% 106 9581 0.07% 107 10463 0.08% 108 10834 0.08% 109 11793 0.09% 110 12870 0.10% 111 14472 0.11% 112 15935 0.12% 113 17532 0.13% 114 19509 0.15% 115 22004 0.17% 116 37873 0.29% 117 43960 0.33% 118 51337 0.39% 119 62274 0.47% 120 78995 0.60% 121 104910 0.79% 122 151694 1.15% 123 255414 1.93% 124 624070 4.72% 125 11565036 87.47% 13221840 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.12 prefix-fanout=2.0 sequence=ACGGGAATCGCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=357.68 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=26.7 sequence=CGCCGCCGCCGG criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=40 prefix-density=0.12 prefix-fanout=1.9 sequence=ACGGGAATCGCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=376.19 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=27.3 sequence=CGCCGCCGCCGG SRR13662583 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:36:06 Started mapping on | Dec 10 07:36:06 Finished on | Dec 10 07:38:07 Mapping speed, Million of reads per hour | 393.38 Number of input reads | 13221840 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 11383639 Uniquely mapped reads % | 86.10% Average mapped length | 246.91 Number of splices: Total | 8361871 Number of splices: Annotated (sjdb) | 7904187 Number of splices: GT/AG | 8250484 Number of splices: GC/AG | 92966 Number of splices: AT/AC | 3922 Number of splices: Non-canonical | 14499 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 2.62 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 216031 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 37340 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.34% % of reads unmapped: other | 1.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1622233 1622233 1622233 N_multimapping 216031 216031 216031 N_noFeature 340095 5762810 5771971 N_ambiguous 227929 20549 20700 UnstrandedReadsAssigned:10815615 PositiveStrandReadsAssigned:5600280 NegativeStrandReadsAssigned:5590968 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662583 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662583-trimmed-pair1.fastq SRR13662583-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,221,840 reads, 11,186,067 reads pseudoaligned [quant] estimated average fragment length: 201.973 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52973 SRR13662583.ke.tsv 35125 SRR13662583.se.tsv 88098 total ==> SRR13662583.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 735.342 0 0 PNS24247 1044 843.027 24.3573 3.52242 PNS24249 1928 1727.03 182.006 12.8481 PNS24246 1044 843.027 24.3573 3.52242 PNS24248 1044 843.027 24.3573 3.52242 PNS24244 1471 1270.03 29.9224 2.87234 PNS24243 293 99.7988 7 8.55118 KQK14069 1603 1402.03 3843.8 334.24 KQK14071 474 274.938 475.982 211.061 ==> SRR13662583.se.tsv <== BRADI_1g14170v3 4660 BRADI_1g53295v3 18 BRADI_1g59795v3 130 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 214 BRADI_1g74790v3 790 BRADI_1g09890v3 0 BRADI_1g77505v3 108 BRADI_1g48960v3 0 SRR13662583 completed mapping pipeline successfully