Starting /dee2/code/volunteer_pipeline.sh SRR13662584 current disk space = 1526687870976 free memory = 1555210500 SRR13662584 SRAfilesize f0b196b7fcc15cb12cd08a7ab2778525 SRR13662584.sra SRR13662584.sra file validated SRR13662584 is paired end SRR13662584 is conventional basespace SRR13662584 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662584_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2585 33.0 33.0 34.0 30.0 34.0 2 32.30025 33.0 33.0 34.0 30.0 34.0 3 32.33625 33.0 33.0 34.0 30.0 34.0 4 32.12825 33.0 33.0 34.0 30.0 34.0 5 32.23025 33.0 33.0 34.0 31.0 34.0 6 35.632 38.0 36.0 38.0 29.0 38.0 7 36.3555 38.0 37.0 38.0 33.0 38.0 8 36.4945 38.0 38.0 38.0 34.0 38.0 9 36.60075 38.0 38.0 38.0 34.0 38.0 10-11 36.70975 38.0 38.0 38.0 34.0 38.0 12-13 36.598749999999995 38.0 38.0 38.0 34.0 38.0 14-15 36.748625000000004 38.0 38.0 38.0 34.0 38.0 16-17 36.717375000000004 38.0 38.0 38.0 34.0 38.0 18-19 36.791125 38.0 38.0 38.0 34.5 38.0 20-21 36.726625 38.0 38.0 38.0 34.0 38.0 22-23 36.751625000000004 38.0 38.0 38.0 34.0 38.0 24-25 36.623125 38.0 38.0 38.0 34.0 38.0 26-27 36.4095 38.0 38.0 38.0 34.0 38.0 28-29 36.58675 38.0 38.0 38.0 34.0 38.0 30-31 36.587 38.0 38.0 38.0 34.0 38.0 32-33 36.622375000000005 38.0 38.0 38.0 34.0 38.0 34-35 36.644875 38.0 38.0 38.0 34.0 38.0 36-37 36.593125 38.0 38.0 38.0 34.0 38.0 38-39 36.525125 38.0 38.0 38.0 34.0 38.0 40-41 36.525000000000006 38.0 38.0 38.0 34.0 38.0 42-43 36.530249999999995 38.0 38.0 38.0 34.0 38.0 44-45 36.48325 38.0 38.0 38.0 34.0 38.0 46-47 36.487624999999994 38.0 38.0 38.0 34.0 38.0 48-49 36.537875 38.0 38.0 38.0 34.0 38.0 50-51 36.502375 38.0 38.0 38.0 33.5 38.0 52-53 36.41374999999999 38.0 38.0 38.0 33.5 38.0 54-55 36.489625 38.0 38.0 38.0 33.5 38.0 56-57 36.392250000000004 38.0 38.0 38.0 33.5 38.0 58-59 36.345875 38.0 37.0 38.0 33.0 38.0 60-61 36.30875 38.0 37.5 38.0 33.5 38.0 62-63 36.2195 38.0 37.5 38.0 33.0 38.0 64-65 36.363749999999996 38.0 37.5 38.0 33.0 38.0 66-67 36.305625000000006 38.0 37.0 38.0 33.0 38.0 68-69 36.2535 38.0 37.0 38.0 33.0 38.0 70-71 36.308125000000004 38.0 37.5 38.0 33.0 38.0 72-73 36.283125 38.0 37.0 38.0 33.0 38.0 74-75 36.143125 38.0 37.0 38.0 33.0 38.0 76-77 36.20025 38.0 37.0 38.0 33.0 38.0 78-79 36.141625000000005 38.0 37.5 38.0 32.5 38.0 80-81 36.082499999999996 38.0 37.0 38.0 32.5 38.0 82-83 36.052499999999995 38.0 37.0 38.0 32.5 38.0 84-85 36.090125 38.0 37.0 38.0 32.5 38.0 86-87 36.045249999999996 38.0 37.0 38.0 32.5 38.0 88-89 36.122 38.0 37.0 38.0 33.0 38.0 90-91 35.96125000000001 38.0 37.0 38.0 32.5 38.0 92-93 35.922625 38.0 37.0 38.0 31.0 38.0 94-95 35.951750000000004 38.0 37.0 38.0 32.0 38.0 96-97 35.907875000000004 38.0 37.0 38.0 32.0 38.0 98-99 35.8695 38.0 37.0 38.0 32.0 38.0 100-101 35.660375 38.0 36.0 38.0 31.0 38.0 102-103 35.51775000000001 38.0 36.0 38.0 30.5 38.0 104-105 35.614875 38.0 36.0 38.0 31.0 38.0 106-107 35.42125 38.0 36.0 38.0 30.0 38.0 108-109 35.445125000000004 38.0 36.0 38.0 30.0 38.0 110-111 35.419250000000005 38.0 36.0 38.0 29.0 38.0 112-113 35.4 38.0 36.0 38.0 30.0 38.0 114-115 35.339375000000004 38.0 36.0 38.0 29.0 38.0 116-117 35.2845 38.0 36.0 38.0 30.0 38.0 118-119 34.983875 38.0 35.0 38.0 28.5 38.0 120-121 34.963 38.0 35.0 38.0 28.5 38.0 122-123 34.76125 38.0 35.5 38.0 28.0 38.0 124-125 34.266999999999996 38.0 35.0 38.0 27.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 0.0 19 3.0 20 2.0 21 5.0 22 2.0 23 8.0 24 6.0 25 20.0 26 27.0 27 28.0 28 60.0 29 51.0 30 91.0 31 87.0 32 125.0 33 158.0 34 192.0 35 290.0 36 541.0 37 2299.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.55 12.625 10.575 35.25 2 29.4 18.875 28.749999999999996 22.975 3 28.7 23.200000000000003 20.925 27.175 4 30.425 31.374999999999996 16.950000000000003 21.25 5 28.549999999999997 30.0 19.525000000000002 21.925 6 23.150000000000002 34.375 18.75 23.724999999999998 7 21.925 16.225 36.9 24.95 8 23.325000000000003 20.275000000000002 23.225 33.175 9 24.224999999999998 19.3 27.375 29.099999999999998 10-11 27.925 28.287499999999998 18.8875 24.9 12-13 25.85 21.95 25.45 26.75 14-15 25.474999999999998 22.875 25.112499999999997 26.5375 16-17 26.387500000000003 24.462500000000002 23.5375 25.6125 18-19 25.7 23.1875 24.2625 26.85 20-21 26.5125 24.0125 22.775000000000002 26.700000000000003 22-23 26.125 24.025 23.724999999999998 26.125 24-25 27.425 24.212500000000002 22.5625 25.8 26-27 26.424999999999997 23.5 24.2875 25.7875 28-29 26.1 24.05 22.55 27.3 30-31 26.025 23.599999999999998 23.4625 26.9125 32-33 26.325 23.9 22.925 26.85 34-35 27.0875 24.65 23.3375 24.925 36-37 26.224999999999998 23.775 23.200000000000003 26.8 38-39 27.150000000000002 23.5875 23.1875 26.075 40-41 26.8375 23.7 23.3375 26.125 42-43 25.9625 22.9625 24.349999999999998 26.724999999999998 44-45 25.937500000000004 23.1625 23.375 27.525 46-47 27.3 23.1 23.8875 25.7125 48-49 25.9625 24.4375 22.1875 27.4125 50-51 26.8625 23.0125 23.275000000000002 26.85 52-53 26.687499999999996 23.2125 23.45 26.650000000000002 54-55 26.775 23.974999999999998 23.375 25.874999999999996 56-57 26.7625 22.875 24.175 26.187500000000004 58-59 26.937499999999996 23.45 23.45 26.1625 60-61 26.775 22.875 23.974999999999998 26.375 62-63 26.950000000000003 24.3875 23.025000000000002 25.637500000000003 64-65 26.7625 22.5625 23.65 27.025 66-67 26.4625 24.075 22.900000000000002 26.5625 68-69 26.737499999999997 24.2375 23.375 25.650000000000002 70-71 26.6 24.637500000000003 22.7 26.0625 72-73 26.150000000000002 23.1375 23.200000000000003 27.5125 74-75 26.6125 24.1125 23.075000000000003 26.200000000000003 76-77 26.950000000000003 22.6375 23.549999999999997 26.8625 78-79 26.1 23.25 24.099999999999998 26.55 80-81 26.424999999999997 23.4375 23.7875 26.35 82-83 27.700000000000003 22.9875 23.1625 26.150000000000002 84-85 26.437500000000004 22.85 23.3125 27.400000000000002 86-87 26.687499999999996 23.7375 22.8125 26.7625 88-89 27.125 22.775000000000002 24.15 25.95 90-91 26.5875 23.6875 23.3125 26.4125 92-93 25.575 23.6875 23.45 27.287499999999998 94-95 27.6 23.2375 23.0 26.1625 96-97 27.525 22.8875 22.825 26.7625 98-99 27.3375 22.575 23.5375 26.55 100-101 26.974999999999998 23.3375 23.325000000000003 26.3625 102-103 25.95 23.150000000000002 24.337500000000002 26.5625 104-105 26.6125 23.525 22.6 27.2625 106-107 27.462500000000002 23.525 23.5875 25.424999999999997 108-109 26.775 23.8125 22.8875 26.525 110-111 27.025 23.799999999999997 23.1625 26.0125 112-113 26.8 23.6625 23.5625 25.974999999999998 114-115 26.75 23.6875 23.025000000000002 26.5375 116-117 27.025 23.45 22.6375 26.887499999999996 118-119 27.2625 23.275000000000002 23.125 26.337500000000002 120-121 27.250000000000004 23.674999999999997 23.962500000000002 25.112499999999997 122-123 26.487500000000004 24.337500000000002 22.5625 26.6125 124-125 27.500000000000004 23.1625 23.6625 25.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 1.5 28 1.0 29 3.0 30 6.5 31 8.0 32 11.5 33 12.0 34 15.0 35 26.0 36 34.5 37 45.0 38 55.5 39 76.5 40 91.0 41 96.0 42 117.5 43 134.5 44 137.0 45 147.0 46 156.5 47 159.0 48 151.5 49 144.0 50 142.5 51 135.5 52 129.0 53 116.0 54 108.5 55 113.5 56 112.5 57 108.5 58 111.0 59 103.5 60 93.5 61 88.5 62 89.0 63 89.5 64 78.0 65 71.0 66 68.5 67 76.0 68 74.5 69 63.0 70 66.5 71 58.0 72 43.5 73 46.5 74 40.5 75 32.0 76 31.5 77 20.5 78 14.5 79 14.0 80 9.5 81 5.5 82 3.5 83 2.5 84 2.5 85 2.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662584 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662584_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.416 33.0 32.0 33.0 27.0 34.0 2 31.75 33.0 32.0 34.0 27.0 34.0 3 31.5235 33.0 32.0 34.0 27.0 34.0 4 31.36175 33.0 32.0 34.0 27.0 34.0 5 31.46425 33.0 32.0 34.0 27.0 34.0 6 35.0705 38.0 36.0 38.0 27.0 38.0 7 35.60275 38.0 37.0 38.0 29.0 38.0 8 35.4665 38.0 37.0 38.0 29.0 38.0 9 35.55125 38.0 36.0 38.0 29.0 38.0 10-11 35.463125 38.0 36.0 38.0 29.0 38.0 12-13 35.670375 38.0 37.0 38.0 29.0 38.0 14-15 35.545500000000004 38.0 37.0 38.0 29.0 38.0 16-17 35.439125000000004 38.0 36.5 38.0 28.5 38.0 18-19 35.45425 38.0 36.5 38.0 28.0 38.0 20-21 35.46125 38.0 36.0 38.0 28.5 38.0 22-23 35.551 38.0 37.0 38.0 29.0 38.0 24-25 35.46875 38.0 36.0 38.0 28.5 38.0 26-27 35.476875 38.0 37.0 38.0 28.5 38.0 28-29 35.518249999999995 38.0 37.0 38.0 29.0 38.0 30-31 35.268375000000006 38.0 36.0 38.0 27.5 38.0 32-33 35.5775 38.0 37.0 38.0 28.5 38.0 34-35 35.501875 38.0 37.0 38.0 28.5 38.0 36-37 35.619625 38.0 37.0 38.0 29.0 38.0 38-39 35.4995 38.0 37.0 38.0 28.5 38.0 40-41 35.570125000000004 38.0 37.0 38.0 29.0 38.0 42-43 35.646125 38.0 37.0 38.0 29.0 38.0 44-45 35.485875 38.0 36.0 38.0 29.0 38.0 46-47 35.474125 38.0 36.5 38.0 29.0 38.0 48-49 35.447500000000005 38.0 36.0 38.0 28.5 38.0 50-51 35.420625 38.0 36.5 38.0 29.0 38.0 52-53 35.4645 38.0 36.0 38.0 29.0 38.0 54-55 35.392875000000004 38.0 36.0 38.0 28.5 38.0 56-57 35.338125000000005 38.0 36.0 38.0 27.5 38.0 58-59 35.315125 38.0 36.0 38.0 28.0 38.0 60-61 35.284625 38.0 36.0 38.0 27.5 38.0 62-63 35.29375 38.0 36.0 38.0 27.5 38.0 64-65 35.316125 38.0 36.0 38.0 27.5 38.0 66-67 35.430125000000004 38.0 36.0 38.0 29.0 38.0 68-69 35.276624999999996 38.0 36.0 38.0 27.5 38.0 70-71 35.202875 38.0 36.0 38.0 27.0 38.0 72-73 35.290625000000006 38.0 36.0 38.0 28.0 38.0 74-75 35.313875 38.0 36.0 38.0 28.0 38.0 76-77 35.17675 38.0 36.0 38.0 27.0 38.0 78-79 35.188 38.0 36.0 38.0 27.5 38.0 80-81 35.059125 38.0 36.0 38.0 27.0 38.0 82-83 35.025999999999996 38.0 36.0 38.0 27.0 38.0 84-85 34.903125 38.0 35.5 38.0 25.5 38.0 86-87 34.88775 38.0 36.0 38.0 26.0 38.0 88-89 34.88175 38.0 35.5 38.0 26.0 38.0 90-91 34.757125 38.0 35.0 38.0 25.5 38.0 92-93 34.67725 38.0 35.0 38.0 25.5 38.0 94-95 34.521249999999995 38.0 35.0 38.0 25.0 38.0 96-97 34.50725 38.0 35.0 38.0 24.5 38.0 98-99 34.376999999999995 38.0 35.0 38.0 23.0 38.0 100-101 34.324625 38.0 35.0 38.0 23.0 38.0 102-103 34.19125 38.0 35.0 38.0 23.0 38.0 104-105 34.07025 38.0 34.0 38.0 23.0 38.0 106-107 34.109125 38.0 34.5 38.0 23.0 38.0 108-109 33.725625 38.0 34.0 38.0 21.0 38.0 110-111 33.582125 38.0 34.0 38.0 21.0 38.0 112-113 33.482375 38.0 34.0 38.0 18.0 38.0 114-115 33.56075 38.0 34.0 38.0 21.0 38.0 116-117 33.575 38.0 34.0 38.0 22.0 38.0 118-119 33.58125 38.0 34.0 38.0 22.0 38.0 120-121 33.1435 38.0 34.0 38.0 15.0 38.0 122-123 32.974625 38.0 34.0 38.0 14.5 38.0 124-125 32.094375 38.0 34.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 4.0 14 2.0 15 6.0 16 5.0 17 13.0 18 10.0 19 13.0 20 20.0 21 15.0 22 25.0 23 37.0 24 43.0 25 47.0 26 64.0 27 87.0 28 72.0 29 66.0 30 112.0 31 130.0 32 133.0 33 165.0 34 188.0 35 315.0 36 540.0 37 1885.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.1 13.625000000000002 11.899999999999999 34.375 2 30.875000000000004 18.65 29.475 21.0 3 26.025 25.775 20.575 27.625 4 29.975 30.3 16.650000000000002 23.075000000000003 5 29.725 31.075000000000003 19.075 20.125 6 22.325 34.4 20.325 22.95 7 20.925 15.1 37.45 26.525 8 23.5 20.05 25.55 30.9 9 23.150000000000002 20.875 27.575 28.4 10-11 26.974999999999998 28.15 19.537499999999998 25.337500000000002 12-13 24.625 21.95 26.55 26.875 14-15 25.7 22.900000000000002 25.5375 25.8625 16-17 26.5 22.400000000000002 23.9 27.200000000000003 18-19 26.325 22.8375 23.7875 27.05 20-21 25.424999999999997 23.150000000000002 23.724999999999998 27.700000000000003 22-23 26.5 24.05 22.75 26.700000000000003 24-25 25.525 24.7 23.849999999999998 25.924999999999997 26-27 26.0125 24.6125 23.150000000000002 26.224999999999998 28-29 26.125 23.6375 22.8125 27.425 30-31 25.35 23.549999999999997 24.3125 26.787499999999998 32-33 25.1875 25.15 23.375 26.2875 34-35 26.137500000000003 23.6875 23.3375 26.8375 36-37 25.912499999999998 23.175 23.9375 26.974999999999998 38-39 25.7375 23.6875 23.962500000000002 26.6125 40-41 26.825 23.8125 22.2625 27.1 42-43 25.95 23.9875 23.175 26.887499999999996 44-45 25.525 24.675 23.1125 26.687499999999996 46-47 26.924999999999997 23.7125 23.1625 26.200000000000003 48-49 26.0 22.975 23.9 27.125 50-51 26.637499999999996 22.8 24.05 26.5125 52-53 25.775 24.125 23.1 27.0 54-55 25.924999999999997 24.2 23.849999999999998 26.025 56-57 26.6125 24.2875 23.3375 25.7625 58-59 26.275 23.962500000000002 23.474999999999998 26.2875 60-61 26.075 22.912499999999998 23.8125 27.200000000000003 62-63 27.0625 22.037499999999998 23.6375 27.2625 64-65 26.9625 22.1375 23.549999999999997 27.35 66-67 26.75 24.0375 23.2625 25.95 68-69 26.724999999999998 24.099999999999998 22.7125 26.4625 70-71 26.724999999999998 23.3375 23.65 26.2875 72-73 26.8625 22.775000000000002 23.0875 27.275 74-75 26.4625 23.0 23.525 27.0125 76-77 25.687500000000004 24.2625 22.4375 27.6125 78-79 26.337500000000002 23.175 23.775 26.7125 80-81 26.5625 22.7375 23.5625 27.1375 82-83 26.450000000000003 22.875 23.225 27.450000000000003 84-85 25.7125 23.200000000000003 23.0625 28.025 86-87 26.2625 23.400000000000002 23.849999999999998 26.487500000000004 88-89 26.625 23.7625 22.825 26.787499999999998 90-91 26.1625 23.125 23.8375 26.875 92-93 27.0875 22.537499999999998 23.25 27.125 94-95 26.200000000000003 23.35 23.6875 26.7625 96-97 26.825 23.125 23.1125 26.937499999999996 98-99 26.0125 23.7 24.087500000000002 26.200000000000003 100-101 27.237499999999997 22.787499999999998 23.125 26.85 102-103 26.2125 22.725 23.275000000000002 27.787499999999998 104-105 26.2625 23.5 23.1625 27.075 106-107 26.674999999999997 23.35 23.3875 26.5875 108-109 26.60815047021944 23.21003134796238 23.53605015673981 26.64576802507837 110-111 25.9091481062036 24.32364414244369 23.920976469107842 25.846231282244876 112-113 25.66561514195584 23.69716088328076 23.141955835962143 27.49526813880126 114-115 26.817325800376647 22.81230382925298 23.02573760200879 27.34463276836158 116-117 26.151151151151154 23.073073073073072 23.523523523523522 27.25225225225225 118-119 27.0875 22.8625 23.4625 26.5875 120-121 27.325 22.825 22.5875 27.2625 122-123 26.50994122796049 23.62135800925347 23.446292359634864 26.42240840315118 124-125 27.181795448862218 23.755938984746187 22.143035758939735 26.91922980745186 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 2.5 28 2.5 29 3.5 30 6.5 31 8.5 32 7.5 33 13.0 34 18.0 35 22.0 36 30.0 37 47.0 38 65.5 39 79.0 40 95.5 41 119.0 42 121.5 43 112.5 44 136.0 45 153.5 46 157.0 47 157.5 48 159.0 49 144.0 50 133.0 51 139.0 52 127.5 53 123.5 54 113.0 55 105.0 56 110.0 57 111.0 58 107.5 59 93.5 60 93.0 61 98.0 62 85.0 63 82.0 64 80.0 65 67.5 66 68.5 67 75.0 68 74.0 69 67.0 70 52.0 71 49.0 72 50.5 73 43.5 74 38.0 75 32.0 76 31.0 77 28.0 78 19.5 79 13.5 80 9.5 81 7.0 82 6.0 83 2.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.3125 110-111 0.6625 112-113 0.9375 114-115 0.43750000000000006 116-117 0.1 118-119 0.0 120-121 0.0 122-123 0.0375 124-125 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703643 spots for SRR13662584.sra Written 703643 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra Read 703641 spots for SRR13662584.sra Written 703641 spots for SRR13662584.sra SRR ids: ['SRR13662584.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u_znbqod SRR13662584.sra spots: 14072822 blocks: [[1, 703641], [703642, 1407282], [1407283, 2110923], [2110924, 2814564], [2814565, 3518205], [3518206, 4221846], [4221847, 4925487], [4925488, 5629128], [5629129, 6332769], [6332770, 7036410], [7036411, 7740051], [7740052, 8443692], [8443693, 9147333], [9147334, 9850974], [9850975, 10554615], [10554616, 11258256], [11258257, 11961897], [11961898, 12665538], [12665539, 13369179], [13369180, 14072822]] SRR13662584 file size 4046224 SRR13662584 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662584 SRR13662584_1.fastq SRR13662584_2.fastq Input file: SRR13662584_1.fastq Paired file: SRR13662584_2.fastq trimmed: SRR13662584-trimmed-pair1.fastq, SRR13662584-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:34:33 2024 >> started Tue Dec 10 07:34:47 2024 >> done (14.823s) 14072822 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 113 ( 0.00%) empty read pairs filtered out after trimming by size control 14072700 (100.00%) read pairs available; of these: 1881044 (13.37%) trimmed read pairs available after processing 12191656 (86.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 0 0.00% 32 2 0.00% 33 0 0.00% 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 1 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 1 0.00% 42 2 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 2 0.00% 51 2 0.00% 52 0 0.00% 53 0 0.00% 54 2 0.00% 55 1 0.00% 56 1 0.00% 57 2 0.00% 58 4 0.00% 59 2 0.00% 60 5 0.00% 61 4 0.00% 62 4 0.00% 63 21 0.00% 64 33 0.00% 65 52 0.00% 66 69 0.00% 67 98 0.00% 68 110 0.00% 69 112 0.00% 70 136 0.00% 71 170 0.00% 72 173 0.00% 73 236 0.00% 74 252 0.00% 75 251 0.00% 76 282 0.00% 77 348 0.00% 78 357 0.00% 79 397 0.00% 80 445 0.00% 81 488 0.00% 82 553 0.00% 83 580 0.00% 84 665 0.00% 85 720 0.01% 86 843 0.01% 87 885 0.01% 88 967 0.01% 89 1146 0.01% 90 1308 0.01% 91 1522 0.01% 92 1771 0.01% 93 2291 0.02% 94 5798 0.04% 95 6192 0.04% 96 6480 0.05% 97 6881 0.05% 98 7291 0.05% 99 7665 0.05% 100 7968 0.06% 101 8292 0.06% 102 8788 0.06% 103 9157 0.07% 104 9926 0.07% 105 10429 0.07% 106 11093 0.08% 107 11549 0.08% 108 12793 0.09% 109 13576 0.10% 110 15002 0.11% 111 16347 0.12% 112 18206 0.13% 113 20437 0.15% 114 22774 0.16% 115 26400 0.19% 116 47278 0.34% 117 52544 0.37% 118 61157 0.43% 119 73479 0.52% 120 91987 0.65% 121 120122 0.85% 122 173740 1.23% 123 286816 2.04% 124 693553 4.93% 125 12191656 86.63% 14072700 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=206.06 fanout-score-rank=8 prefix-density=0.83 prefix-fanout=26.0 sequence=CGGCGGCGGCGA criterion=fanout-score sequence-density=0.07 sequence-density-rank=16 fanout-score=369.37 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=26.5 sequence=CGCCGCCGCCGG criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=228.41 fanout-score-rank=7 prefix-density=0.82 prefix-fanout=26.7 sequence=CGGCGGCGGCGA criterion=fanout-score sequence-density=0.08 sequence-density-rank=8 fanout-score=323.47 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=27.0 sequence=CGCCGCCGCCGC SRR13662584 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:35:38 Started mapping on | Dec 10 07:35:39 Finished on | Dec 10 07:37:51 Mapping speed, Million of reads per hour | 383.80 Number of input reads | 14072700 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 11950103 Uniquely mapped reads % | 84.92% Average mapped length | 247.00 Number of splices: Total | 8843030 Number of splices: Annotated (sjdb) | 8358548 Number of splices: GT/AG | 8725379 Number of splices: GC/AG | 99723 Number of splices: AT/AC | 4237 Number of splices: Non-canonical | 13691 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.81 Insertion rate per base | 0.00% Insertion average length | 1.98 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290136 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 75073 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.53% % of reads unmapped: other | 2.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1832536 1832536 1832536 N_multimapping 290136 290136 290136 N_noFeature 413223 6081495 6087397 N_ambiguous 235025 21569 21330 UnstrandedReadsAssigned:11301855 PositiveStrandReadsAssigned:5847039 NegativeStrandReadsAssigned:5841376 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662584 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662584-trimmed-pair1.fastq SRR13662584-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,072,700 reads, 11,752,934 reads pseudoaligned [quant] estimated average fragment length: 200.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 SRR13662584.ke.tsv 35125 SRR13662584.se.tsv 88098 total ==> SRR13662584.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 736.872 0 0 PNS24247 1044 844.603 36.0722 5.04684 PNS24249 1928 1728.6 228.582 15.626 PNS24246 1044 844.603 36.0722 5.04684 PNS24248 1044 844.603 36.0722 5.04684 PNS24244 1471 1271.6 41.2012 3.82876 PNS24243 293 100.961 14 16.386 KQK14069 1603 1403.6 3304.59 278.21 KQK14071 474 276.517 318.43 136.079 ==> SRR13662584.se.tsv <== BRADI_1g14170v3 3955 BRADI_1g53295v3 30 BRADI_1g59795v3 130 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 299 BRADI_1g74790v3 1000 BRADI_1g09890v3 0 BRADI_1g77505v3 111 BRADI_1g48960v3 0 SRR13662584 completed mapping pipeline successfully