Starting /dee2/code/volunteer_pipeline.sh SRR13662585 current disk space = 1526744645632 free memory = 1477731672 SRR13662585 SRAfilesize 0fc21524902c69dbff076bcafecb8e03 SRR13662585.sra SRR13662585.sra file validated SRR13662585 is paired end SRR13662585 is conventional basespace SRR13662585 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662585_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.481 33.0 33.0 34.0 31.0 34.0 2 32.21975 33.0 33.0 34.0 30.0 34.0 3 32.438 33.0 33.0 34.0 31.0 34.0 4 32.4185 33.0 33.0 34.0 31.0 34.0 5 32.34125 33.0 33.0 34.0 31.0 34.0 6 36.02725 38.0 37.0 38.0 31.0 38.0 7 36.57225 38.0 37.0 38.0 34.0 38.0 8 36.736 38.0 38.0 38.0 34.0 38.0 9 36.75925 38.0 38.0 38.0 35.0 38.0 10-11 36.71625 38.0 38.0 38.0 34.0 38.0 12-13 36.67125 38.0 38.0 38.0 34.0 38.0 14-15 36.675 38.0 38.0 38.0 34.0 38.0 16-17 36.654875000000004 38.0 38.0 38.0 34.0 38.0 18-19 36.739625 38.0 38.0 38.0 34.0 38.0 20-21 36.660125 38.0 38.0 38.0 34.0 38.0 22-23 36.678875000000005 38.0 38.0 38.0 34.0 38.0 24-25 36.561125000000004 38.0 38.0 38.0 34.0 38.0 26-27 36.612375 38.0 38.0 38.0 34.0 38.0 28-29 36.76975 38.0 38.0 38.0 34.5 38.0 30-31 36.681375 38.0 38.0 38.0 34.0 38.0 32-33 36.622749999999996 38.0 38.0 38.0 34.0 38.0 34-35 36.5385 38.0 38.0 38.0 34.0 38.0 36-37 36.56375 38.0 38.0 38.0 34.0 38.0 38-39 36.442375 38.0 38.0 38.0 33.5 38.0 40-41 36.56075 38.0 38.0 38.0 34.0 38.0 42-43 36.59 38.0 38.0 38.0 34.0 38.0 44-45 36.585625 38.0 38.0 38.0 34.0 38.0 46-47 36.426500000000004 38.0 38.0 38.0 33.5 38.0 48-49 36.666875 38.0 38.0 38.0 34.0 38.0 50-51 36.716375 38.0 38.0 38.0 34.0 38.0 52-53 36.59575 38.0 38.0 38.0 34.0 38.0 54-55 36.64475 38.0 38.0 38.0 34.0 38.0 56-57 36.62625 38.0 38.0 38.0 34.0 38.0 58-59 36.376374999999996 38.0 38.0 38.0 33.5 38.0 60-61 36.3535 38.0 38.0 38.0 33.0 38.0 62-63 36.413 38.0 38.0 38.0 34.0 38.0 64-65 36.286875 38.0 38.0 38.0 33.0 38.0 66-67 36.419875000000005 38.0 38.0 38.0 33.5 38.0 68-69 36.535624999999996 38.0 38.0 38.0 34.0 38.0 70-71 36.400499999999994 38.0 38.0 38.0 34.0 38.0 72-73 36.4255 38.0 38.0 38.0 34.0 38.0 74-75 36.170249999999996 38.0 38.0 38.0 33.0 38.0 76-77 36.36625 38.0 38.0 38.0 34.0 38.0 78-79 36.288250000000005 38.0 38.0 38.0 33.0 38.0 80-81 36.311625 38.0 38.0 38.0 33.5 38.0 82-83 36.106750000000005 38.0 37.5 38.0 32.5 38.0 84-85 36.211 38.0 38.0 38.0 33.0 38.0 86-87 35.832375 38.0 37.0 38.0 31.0 38.0 88-89 36.00375 38.0 37.5 38.0 32.0 38.0 90-91 36.266375 38.0 38.0 38.0 33.5 38.0 92-93 35.839125 38.0 37.0 38.0 31.5 38.0 94-95 35.855125 38.0 37.5 38.0 32.0 38.0 96-97 35.868375 38.0 37.0 38.0 31.5 38.0 98-99 35.461375000000004 38.0 36.0 38.0 30.0 38.0 100-101 35.755875 38.0 37.0 38.0 31.5 38.0 102-103 35.664875 38.0 36.5 38.0 31.0 38.0 104-105 35.863375000000005 38.0 37.0 38.0 31.5 38.0 106-107 35.5565 38.0 37.0 38.0 30.0 38.0 108-109 35.465 38.0 36.5 38.0 31.0 38.0 110-111 35.328500000000005 38.0 36.0 38.0 29.5 38.0 112-113 35.266375 38.0 36.0 38.0 29.5 38.0 114-115 35.317750000000004 38.0 36.5 38.0 30.0 38.0 116-117 35.12025 38.0 36.0 38.0 28.5 38.0 118-119 35.257875 38.0 36.0 38.0 30.0 38.0 120-121 34.79675 38.0 35.5 38.0 27.5 38.0 122-123 35.040125 38.0 36.0 38.0 29.5 38.0 124-125 34.407375 38.0 35.5 38.0 27.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 1.0 17 1.0 18 3.0 19 3.0 20 1.0 21 5.0 22 13.0 23 6.0 24 8.0 25 18.0 26 30.0 27 35.0 28 37.0 29 58.0 30 74.0 31 86.0 32 124.0 33 150.0 34 179.0 35 293.0 36 484.0 37 2389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.725 11.200000000000001 11.175 36.9 2 32.25 17.575 27.425 22.75 3 28.749999999999996 22.8 22.25 26.200000000000003 4 30.2 29.65 17.224999999999998 22.925 5 30.175 30.099999999999998 18.775 20.95 6 22.675 34.449999999999996 20.525 22.35 7 21.975 13.825000000000001 39.050000000000004 25.15 8 23.849999999999998 19.775000000000002 24.05 32.324999999999996 9 24.175 19.525000000000002 27.1 29.2 10-11 27.400000000000002 28.175 18.95 25.474999999999998 12-13 24.7375 21.712500000000002 25.85 27.700000000000003 14-15 26.474999999999998 22.7125 24.6 26.2125 16-17 27.0 23.3 23.150000000000002 26.55 18-19 24.875 23.962500000000002 24.2375 26.924999999999997 20-21 26.5875 23.225 23.275000000000002 26.9125 22-23 27.437499999999996 23.65 22.8625 26.05 24-25 25.8125 24.5375 22.787499999999998 26.8625 26-27 27.3125 23.3125 23.025000000000002 26.35 28-29 27.1375 22.925 23.35 26.5875 30-31 26.6 24.4 23.474999999999998 25.525 32-33 26.5875 22.912499999999998 24.0 26.5 34-35 26.5875 23.175 22.5875 27.650000000000002 36-37 25.637500000000003 23.7625 23.8625 26.737499999999997 38-39 26.6625 23.674999999999997 22.325 27.3375 40-41 26.674999999999997 23.4125 23.3875 26.525 42-43 26.2125 23.875 23.1625 26.75 44-45 26.2875 23.95 22.8125 26.950000000000003 46-47 26.224999999999998 24.0125 23.25 26.5125 48-49 25.5125 23.6875 24.087500000000002 26.7125 50-51 26.1125 23.674999999999997 23.425 26.787499999999998 52-53 26.0375 23.962500000000002 23.3125 26.687499999999996 54-55 26.937499999999996 23.1625 22.8375 27.0625 56-57 27.462500000000002 23.0375 22.8 26.700000000000003 58-59 27.3875 23.2125 22.6125 26.787499999999998 60-61 26.2125 23.5875 23.5375 26.6625 62-63 26.9625 23.525 23.025000000000002 26.487500000000004 64-65 26.05 23.575 23.2875 27.0875 66-67 26.75 23.025000000000002 23.400000000000002 26.825 68-69 27.1625 23.549999999999997 22.725 26.5625 70-71 26.5625 23.5 23.1125 26.825 72-73 26.1625 24.025 22.400000000000002 27.4125 74-75 26.987499999999997 23.5375 23.3 26.174999999999997 76-77 27.1 23.3875 22.7625 26.75 78-79 26.0625 23.9 23.1875 26.85 80-81 27.187499999999996 23.799999999999997 22.112499999999997 26.900000000000002 82-83 27.3125 23.2125 23.1375 26.337500000000002 84-85 26.174999999999997 23.6125 23.525 26.687499999999996 86-87 26.875 24.087500000000002 22.6875 26.35 88-89 26.35 23.849999999999998 22.7125 27.0875 90-91 27.275 22.8375 23.1625 26.724999999999998 92-93 27.125 23.0 22.875 27.0 94-95 26.5125 23.5625 23.25 26.674999999999997 96-97 25.974999999999998 23.1125 23.400000000000002 27.5125 98-99 26.700000000000003 23.5125 23.225 26.5625 100-101 26.5375 22.787499999999998 23.849999999999998 26.825 102-103 26.087500000000002 23.875 22.662499999999998 27.375 104-105 26.6 23.425 23.575 26.400000000000002 106-107 26.974999999999998 23.225 23.1625 26.637499999999996 108-109 26.387500000000003 23.875 22.675 27.0625 110-111 27.1625 23.849999999999998 22.625 26.3625 112-113 26.8 23.3625 23.575 26.2625 114-115 26.7125 22.5 23.7625 27.025 116-117 27.0 23.549999999999997 23.1125 26.337500000000002 118-119 25.937500000000004 23.0125 23.45 27.6 120-121 26.387500000000003 23.025000000000002 22.8875 27.700000000000003 122-123 26.9125 23.775 22.112499999999997 27.200000000000003 124-125 25.837500000000002 22.925 23.825 27.4125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.0 27 1.5 28 2.0 29 3.5 30 5.0 31 8.0 32 15.0 33 17.0 34 21.0 35 25.0 36 33.0 37 47.5 38 57.0 39 71.0 40 92.0 41 115.0 42 132.5 43 140.5 44 145.0 45 143.0 46 146.0 47 163.5 48 173.0 49 168.0 50 144.5 51 118.5 52 113.0 53 100.0 54 86.5 55 90.5 56 87.5 57 82.0 58 79.0 59 77.0 60 81.0 61 83.0 62 89.5 63 87.5 64 75.0 65 74.5 66 85.5 67 80.5 68 69.5 69 80.0 70 80.0 71 65.5 72 58.0 73 44.5 74 36.0 75 35.5 76 31.0 77 30.5 78 29.0 79 20.0 80 14.0 81 11.5 82 8.0 83 7.5 84 6.0 85 4.0 86 2.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0125 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0 0.0 0.0 0.0 0.025 92-93 0.0 0.0 0.0 0.0 0.025 94-95 0.0 0.0 0.0 0.0 0.05 96-97 0.0 0.0 0.0 0.0 0.05 98-99 0.0 0.0 0.0 0.0 0.05 100-101 0.0 0.0 0.0 0.0 0.05 102-103 0.0 0.0 0.0 0.0 0.05 104-105 0.0 0.0 0.0 0.0 0.05 106-107 0.0 0.0 0.0 0.0 0.05 108-109 0.0 0.0 0.0 0.0 0.05 110-111 0.0 0.0 0.0 0.0 0.05 112-113 0.0 0.0 0.0 0.0 0.05 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662585 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662585_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.44025 33.0 32.0 34.0 25.0 34.0 2 31.48525 33.0 32.0 34.0 27.0 34.0 3 31.31325 33.0 32.0 34.0 25.0 34.0 4 31.2505 33.0 32.0 34.0 27.0 34.0 5 31.34525 33.0 32.0 34.0 27.0 34.0 6 34.965 38.0 36.0 38.0 26.0 38.0 7 35.31825 38.0 36.0 38.0 28.0 38.0 8 35.01275 38.0 36.0 38.0 26.0 38.0 9 35.4715 38.0 36.0 38.0 29.0 38.0 10-11 35.342625 38.0 36.5 38.0 28.5 38.0 12-13 35.398875000000004 38.0 36.5 38.0 28.5 38.0 14-15 34.968125 38.0 36.0 38.0 26.5 38.0 16-17 35.347125000000005 38.0 36.5 38.0 28.0 38.0 18-19 35.096125 38.0 36.0 38.0 27.0 38.0 20-21 34.72325 38.0 36.0 38.0 25.0 38.0 22-23 35.4305 38.0 36.0 38.0 28.0 38.0 24-25 35.404875000000004 38.0 36.5 38.0 28.0 38.0 26-27 34.91875 38.0 36.0 38.0 26.0 38.0 28-29 35.26475000000001 38.0 36.5 38.0 27.0 38.0 30-31 35.187375 38.0 36.0 38.0 27.5 38.0 32-33 35.0325 38.0 36.0 38.0 26.0 38.0 34-35 34.901375 38.0 36.0 38.0 25.0 38.0 36-37 35.00775 38.0 36.0 38.0 27.0 38.0 38-39 34.531125 38.0 35.5 38.0 20.5 38.0 40-41 34.835750000000004 38.0 35.5 38.0 26.0 38.0 42-43 35.269875 38.0 36.0 38.0 27.0 38.0 44-45 34.89925 38.0 35.5 38.0 25.5 38.0 46-47 35.364125 38.0 36.0 38.0 27.5 38.0 48-49 35.3895 38.0 37.0 38.0 28.0 38.0 50-51 35.52575 38.0 37.0 38.0 28.5 38.0 52-53 35.736000000000004 38.0 37.0 38.0 29.0 38.0 54-55 35.639250000000004 38.0 37.0 38.0 29.0 38.0 56-57 35.625125 38.0 37.0 38.0 29.0 38.0 58-59 35.397875 38.0 36.0 38.0 28.0 38.0 60-61 35.641625000000005 38.0 37.0 38.0 29.0 38.0 62-63 35.59825 38.0 36.5 38.0 29.0 38.0 64-65 35.43675 38.0 36.5 38.0 28.5 38.0 66-67 35.441125 38.0 36.5 38.0 28.0 38.0 68-69 35.595 38.0 36.5 38.0 29.0 38.0 70-71 35.588499999999996 38.0 37.0 38.0 29.0 38.0 72-73 35.59375 38.0 37.0 38.0 30.0 38.0 74-75 35.147625 38.0 36.0 38.0 27.5 38.0 76-77 35.261625 38.0 36.0 38.0 28.0 38.0 78-79 35.357875 38.0 36.0 38.0 28.5 38.0 80-81 35.466875 38.0 36.5 38.0 30.0 38.0 82-83 35.32275 38.0 36.5 38.0 28.0 38.0 84-85 35.541875000000005 38.0 37.0 38.0 29.5 38.0 86-87 35.186 38.0 36.5 38.0 28.0 38.0 88-89 35.32175 38.0 36.0 38.0 29.0 38.0 90-91 34.981125 38.0 36.0 38.0 26.5 38.0 92-93 35.2375 38.0 36.0 38.0 28.5 38.0 94-95 34.95825 38.0 35.5 38.0 27.0 38.0 96-97 35.055125 38.0 36.0 38.0 27.5 38.0 98-99 34.7665 38.0 35.5 38.0 25.5 38.0 100-101 34.857375 38.0 35.0 38.0 26.0 38.0 102-103 34.9535 38.0 36.0 38.0 27.5 38.0 104-105 34.7585 38.0 35.0 38.0 26.0 38.0 106-107 34.762875 38.0 35.5 38.0 26.0 38.0 108-109 34.723 38.0 35.5 38.0 25.0 38.0 110-111 34.829875 38.0 35.5 38.0 27.0 38.0 112-113 34.7005 38.0 35.5 38.0 25.5 38.0 114-115 34.8305 38.0 35.5 38.0 27.0 38.0 116-117 34.4895 38.0 35.0 38.0 23.0 38.0 118-119 34.518375 38.0 35.0 38.0 25.0 38.0 120-121 34.077124999999995 38.0 35.0 38.0 22.0 38.0 122-123 34.13225 38.0 35.0 38.0 23.5 38.0 124-125 33.716 38.0 35.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 2.0 14 5.0 15 6.0 16 6.0 17 7.0 18 5.0 19 8.0 20 15.0 21 20.0 22 22.0 23 31.0 24 50.0 25 41.0 26 58.0 27 77.0 28 67.0 29 96.0 30 89.0 31 105.0 32 144.0 33 161.0 34 212.0 35 283.0 36 476.0 37 2012.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.425 10.525 10.7 37.35 2 31.974999999999998 16.400000000000002 28.775000000000002 22.85 3 28.349999999999998 23.974999999999998 20.1 27.575 4 31.125000000000004 29.299999999999997 16.900000000000002 22.675 5 29.875 30.049999999999997 18.675 21.4 6 22.2 33.275 21.025 23.5 7 22.45 13.975000000000001 37.974999999999994 25.6 8 22.85 19.35 25.4 32.4 9 25.75 19.35 26.825 28.075 10-11 27.8375 27.787499999999998 19.3 25.074999999999996 12-13 25.874999999999996 21.3875 25.687500000000004 27.05 14-15 25.2625 23.125 24.7375 26.875 16-17 26.8375 22.9625 23.962500000000002 26.237500000000004 18-19 27.150000000000002 23.200000000000003 23.225 26.424999999999997 20-21 26.3 22.375 24.474999999999998 26.85 22-23 26.5625 23.65 23.8125 25.974999999999998 24-25 27.037499999999998 22.8375 23.799999999999997 26.325 26-27 25.9875 23.6375 23.5875 26.787499999999998 28-29 27.1 22.5125 23.2125 27.175 30-31 26.3625 22.8 23.5 27.3375 32-33 25.4 24.0125 23.724999999999998 26.8625 34-35 27.075 23.1125 22.900000000000002 26.9125 36-37 26.525 23.875 24.099999999999998 25.5 38-39 26.825 24.0625 23.3125 25.8 40-41 27.1625 23.6625 23.05 26.125 42-43 26.775 23.200000000000003 23.599999999999998 26.424999999999997 44-45 25.937500000000004 23.1125 24.0625 26.887499999999996 46-47 27.0625 22.575 23.1875 27.175 48-49 25.9875 23.875 23.474999999999998 26.6625 50-51 26.337500000000002 22.95 23.425 27.287499999999998 52-53 26.8 23.0875 23.2125 26.900000000000002 54-55 27.1125 22.9625 23.3125 26.6125 56-57 26.424999999999997 23.275000000000002 23.549999999999997 26.75 58-59 26.575 22.85 23.5 27.075 60-61 26.375 23.674999999999997 22.8375 27.1125 62-63 25.8625 24.3875 23.0125 26.737499999999997 64-65 27.725 22.912499999999998 22.4625 26.900000000000002 66-67 26.724999999999998 22.725 23.2375 27.3125 68-69 27.375 23.1 23.1375 26.387500000000003 70-71 27.325 22.6375 23.4625 26.575 72-73 26.3125 23.0125 23.8375 26.8375 74-75 25.5125 24.175 23.375 26.937499999999996 76-77 27.487499999999997 22.85 23.3125 26.35 78-79 26.5125 23.2125 23.25 27.025 80-81 27.625 23.3 22.7125 26.3625 82-83 26.5125 22.925 23.3875 27.175 84-85 26.8625 22.425 24.05 26.6625 86-87 26.7625 23.0 24.075 26.1625 88-89 26.700000000000003 23.0375 22.775000000000002 27.487499999999997 90-91 26.85 23.275000000000002 23.5125 26.3625 92-93 27.487499999999997 22.7125 22.7 27.1 94-95 27.8875 21.925 23.7 26.487500000000004 96-97 26.487500000000004 22.55 23.474999999999998 27.487499999999997 98-99 27.05 22.8 23.175 26.974999999999998 100-101 26.8125 23.1125 23.5875 26.487500000000004 102-103 27.1625 23.575 22.7125 26.55 104-105 26.7125 23.225 23.175 26.887499999999996 106-107 27.400000000000002 21.912499999999998 23.2875 27.400000000000002 108-109 26.05 23.5125 23.8375 26.6 110-111 26.0625 22.8375 23.4875 27.6125 112-113 27.375 22.525000000000002 23.05 27.05 114-115 25.775 23.325000000000003 23.5625 27.3375 116-117 25.7375 23.425 22.85 27.987499999999997 118-119 26.700000000000003 23.3125 22.8625 27.125 120-121 26.6625 23.525 23.2375 26.575 122-123 25.724999999999998 24.525 23.1 26.650000000000002 124-125 26.575 23.200000000000003 22.9375 27.287499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 1.0 27 1.0 28 2.5 29 5.0 30 8.0 31 12.0 32 13.5 33 14.5 34 18.5 35 24.5 36 29.0 37 37.5 38 63.5 39 82.0 40 92.5 41 107.5 42 118.5 43 141.5 44 152.5 45 146.0 46 146.5 47 142.5 48 135.5 49 135.0 50 127.0 51 130.0 52 129.0 53 120.5 54 115.0 55 102.5 56 90.5 57 80.5 58 88.0 59 87.0 60 85.5 61 90.0 62 87.5 63 86.0 64 78.5 65 83.5 66 87.0 67 79.0 68 67.5 69 65.5 70 68.0 71 68.0 72 64.0 73 55.5 74 53.5 75 45.0 76 29.5 77 25.5 78 26.0 79 19.0 80 11.0 81 5.5 82 6.5 83 5.0 84 2.0 85 0.0 86 0.5 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571717 spots for SRR13662585.sra Written 571717 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra Read 571704 spots for SRR13662585.sra Written 571704 spots for SRR13662585.sra SRR ids: ['SRR13662585.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ztlamdu2 SRR13662585.sra spots: 11434093 blocks: [[1, 571704], [571705, 1143408], [1143409, 1715112], [1715113, 2286816], [2286817, 2858520], [2858521, 3430224], [3430225, 4001928], [4001929, 4573632], [4573633, 5145336], [5145337, 5717040], [5717041, 6288744], [6288745, 6860448], [6860449, 7432152], [7432153, 8003856], [8003857, 8575560], [8575561, 9147264], [9147265, 9718968], [9718969, 10290672], [10290673, 10862376], [10862377, 11434093]] SRR13662585 file size 3283467 SRR13662585 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662585 SRR13662585_1.fastq SRR13662585_2.fastq Input file: SRR13662585_1.fastq Paired file: SRR13662585_2.fastq trimmed: SRR13662585-trimmed-pair1.fastq, SRR13662585-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:37:57 2024 >> started Tue Dec 10 07:38:11 2024 >> done (13.845s) 11434093 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 80 ( 0.00%) empty read pairs filtered out after trimming by size control 11434013 (100.00%) read pairs available; of these: 1366775 (11.95%) trimmed read pairs available after processing 10067238 (88.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 2 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 1 0.00% 44 2 0.00% 45 3 0.00% 46 1 0.00% 47 2 0.00% 48 0 0.00% 49 1 0.00% 50 2 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 3 0.00% 55 2 0.00% 56 0 0.00% 57 0 0.00% 58 3 0.00% 59 3 0.00% 60 2 0.00% 61 1 0.00% 62 4 0.00% 63 28 0.00% 64 58 0.00% 65 53 0.00% 66 91 0.00% 67 110 0.00% 68 125 0.00% 69 141 0.00% 70 169 0.00% 71 195 0.00% 72 205 0.00% 73 192 0.00% 74 280 0.00% 75 284 0.00% 76 299 0.00% 77 301 0.00% 78 379 0.00% 79 402 0.00% 80 409 0.00% 81 461 0.00% 82 482 0.00% 83 554 0.00% 84 638 0.01% 85 628 0.01% 86 705 0.01% 87 775 0.01% 88 845 0.01% 89 974 0.01% 90 1011 0.01% 91 1242 0.01% 92 1522 0.01% 93 1774 0.02% 94 4564 0.04% 95 4578 0.04% 96 4911 0.04% 97 4999 0.04% 98 5470 0.05% 99 5764 0.05% 100 5977 0.05% 101 6214 0.05% 102 6600 0.06% 103 6781 0.06% 104 7217 0.06% 105 7518 0.07% 106 7972 0.07% 107 8500 0.07% 108 9216 0.08% 109 9860 0.09% 110 10615 0.09% 111 11595 0.10% 112 12697 0.11% 113 14271 0.12% 114 16033 0.14% 115 18245 0.16% 116 32285 0.28% 117 36625 0.32% 118 43590 0.38% 119 52117 0.46% 120 65117 0.57% 121 86094 0.75% 122 126392 1.11% 123 208695 1.83% 124 510891 4.47% 125 10067238 88.05% 11434013 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=187.75 fanout-score-rank=10 prefix-density=1.11 prefix-fanout=22.9 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=460.45 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=28.3 sequence=CGCCGCCGCCGT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=187.81 fanout-score-rank=11 prefix-density=1.10 prefix-fanout=22.5 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=442.74 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=28.1 sequence=CGCCGCCGCCGT SRR13662585 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 10 07:44:41 Started mapping on | Dec 10 07:44:44 Finished on | Dec 10 07:45:36 Mapping speed, Million of reads per hour | 791.58 Number of input reads | 11434004 Average input read length | 208 UNIQUE READS: Uniquely mapped reads number | 9993332 Uniquely mapped reads % | 87.40% Average mapped length | 207.61 Number of splices: Total | 6491129 Number of splices: Annotated (sjdb) | 6130187 Number of splices: GT/AG | 6403399 Number of splices: GC/AG | 72319 Number of splices: AT/AC | 3533 Number of splices: Non-canonical | 11878 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196462 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 13365 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.94% % of reads unmapped: other | 0.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1246607 1246607 1246607 N_multimapping 196462 196462 196462 N_noFeature 315902 5070914 5076411 N_ambiguous 211873 25875 26205 UnstrandedReadsAssigned:9465557 PositiveStrandReadsAssigned:4896543 NegativeStrandReadsAssigned:4890716 Dataset is classified unstranded MeadianReadLen=105 20thPercentileLength=105 echo kmer=101 SRR13662585 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662585-trimmed-pair1.fastq SRR13662585-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,434,004 reads, 10,592,029 reads pseudoaligned [quant] estimated average fragment length: 162.617 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 SRR13662585.ke.tsv 35125 SRR13662585.se.tsv 88098 total ==> SRR13662585.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 774.559 0 0 PNS24247 1044 882.383 30.7113 4.73671 PNS24249 1928 1766.38 202.424 15.596 PNS24246 1044 882.383 30.7113 4.73671 PNS24248 1044 882.383 30.7113 4.73671 PNS24244 1471 1309.38 47.442 4.93096 PNS24243 293 135.333 9 9.0505 KQK14069 1603 1441.38 5371.45 507.163 KQK14071 474 313.896 1033.57 448.116 ==> SRR13662585.se.tsv <== BRADI_1g14170v3 6021 BRADI_1g53295v3 13 BRADI_1g59795v3 220 BRADI_1g07683v3 1 BRADI_1g00485v3 22 BRADI_1g20270v3 173 BRADI_1g74790v3 203 BRADI_1g09890v3 0 BRADI_1g77505v3 148 BRADI_1g48960v3 0 SRR13662585 completed mapping pipeline successfully