Starting /dee2/code/volunteer_pipeline.sh SRR13662587 current disk space = 1526814539776 free memory = 1459585176 SRR13662587 SRAfilesize 13493787dea3a1e808c44f44cfbd6ff8 SRR13662587.sra SRR13662587.sra file validated SRR13662587 is paired end SRR13662587 is conventional basespace SRR13662587 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662587_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40125 33.0 33.0 34.0 31.0 34.0 2 32.449 33.0 33.0 34.0 31.0 34.0 3 32.1265 33.0 33.0 34.0 30.0 34.0 4 32.36825 33.0 33.0 34.0 31.0 34.0 5 32.38175 33.0 33.0 34.0 31.0 34.0 6 36.0795 38.0 36.0 38.0 33.0 38.0 7 36.64325 38.0 37.0 38.0 34.0 38.0 8 36.7305 38.0 38.0 38.0 34.0 38.0 9 36.7095 38.0 38.0 38.0 34.0 38.0 10-11 36.56925 38.0 38.0 38.0 34.0 38.0 12-13 36.5945 38.0 38.0 38.0 34.0 38.0 14-15 36.677375 38.0 38.0 38.0 34.0 38.0 16-17 36.693375 38.0 38.0 38.0 34.0 38.0 18-19 36.75975 38.0 38.0 38.0 35.0 38.0 20-21 36.776375 38.0 38.0 38.0 35.0 38.0 22-23 36.762625 38.0 38.0 38.0 34.5 38.0 24-25 36.7215 38.0 38.0 38.0 34.0 38.0 26-27 36.738749999999996 38.0 38.0 38.0 34.5 38.0 28-29 36.741625 38.0 38.0 38.0 34.5 38.0 30-31 36.620625000000004 38.0 38.0 38.0 34.0 38.0 32-33 36.594875 38.0 38.0 38.0 34.0 38.0 34-35 36.600125 38.0 38.0 38.0 34.0 38.0 36-37 36.706875 38.0 38.0 38.0 34.5 38.0 38-39 36.620625000000004 38.0 38.0 38.0 34.0 38.0 40-41 36.693 38.0 38.0 38.0 34.0 38.0 42-43 36.46625 38.0 38.0 38.0 33.5 38.0 44-45 36.536500000000004 38.0 38.0 38.0 34.0 38.0 46-47 36.545125 38.0 38.0 38.0 34.0 38.0 48-49 36.5075 38.0 38.0 38.0 34.0 38.0 50-51 36.413624999999996 38.0 38.0 38.0 34.0 38.0 52-53 36.331 38.0 38.0 38.0 33.5 38.0 54-55 36.512375 38.0 38.0 38.0 33.5 38.0 56-57 36.434 38.0 38.0 38.0 34.0 38.0 58-59 36.507875 38.0 38.0 38.0 34.0 38.0 60-61 36.58475 38.0 38.0 38.0 34.0 38.0 62-63 36.391875 38.0 38.0 38.0 33.5 38.0 64-65 36.27925 38.0 38.0 38.0 33.0 38.0 66-67 36.417249999999996 38.0 38.0 38.0 33.5 38.0 68-69 36.451125 38.0 38.0 38.0 33.5 38.0 70-71 36.508624999999995 38.0 38.0 38.0 34.0 38.0 72-73 36.129625000000004 38.0 37.0 38.0 33.0 38.0 74-75 36.323125000000005 38.0 38.0 38.0 33.0 38.0 76-77 36.479875 38.0 38.0 38.0 34.0 38.0 78-79 36.14 38.0 37.5 38.0 33.0 38.0 80-81 36.152 38.0 38.0 38.0 33.0 38.0 82-83 36.01475000000001 38.0 37.5 38.0 32.0 38.0 84-85 36.20525 38.0 38.0 38.0 33.0 38.0 86-87 35.899625 38.0 37.0 38.0 31.0 38.0 88-89 35.81525 38.0 37.0 38.0 32.0 38.0 90-91 35.96975 38.0 37.0 38.0 32.0 38.0 92-93 35.755375 38.0 37.0 38.0 31.0 38.0 94-95 35.90925 38.0 37.5 38.0 32.0 38.0 96-97 35.770875000000004 38.0 37.0 38.0 31.5 38.0 98-99 35.93025 38.0 37.0 38.0 32.0 38.0 100-101 35.805499999999995 38.0 37.0 38.0 31.0 38.0 102-103 35.521625 38.0 36.5 38.0 30.0 38.0 104-105 35.646 38.0 37.0 38.0 31.0 38.0 106-107 35.278999999999996 38.0 36.0 38.0 29.5 38.0 108-109 35.579625 38.0 36.5 38.0 31.0 38.0 110-111 35.660375 38.0 37.0 38.0 31.0 38.0 112-113 35.61075 38.0 37.0 38.0 31.0 38.0 114-115 35.234875 38.0 36.0 38.0 29.5 38.0 116-117 35.08725 38.0 36.0 38.0 28.5 38.0 118-119 34.976625 38.0 35.5 38.0 28.0 38.0 120-121 34.580749999999995 38.0 35.5 38.0 25.5 38.0 122-123 34.26975 38.0 35.0 38.0 24.5 38.0 124-125 33.9785 38.0 35.0 38.0 24.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 2.0 18 3.0 19 3.0 20 2.0 21 7.0 22 8.0 23 12.0 24 13.0 25 19.0 26 18.0 27 36.0 28 53.0 29 61.0 30 67.0 31 82.0 32 128.0 33 118.0 34 216.0 35 266.0 36 567.0 37 2318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.025 13.4 10.575 36.0 2 29.549999999999997 19.05 29.625 21.775 3 27.800000000000004 22.925 21.975 27.3 4 30.575000000000003 29.95 16.950000000000003 22.525000000000002 5 29.475 32.525 18.2 19.8 6 21.375 34.975 21.675 21.975 7 20.424999999999997 16.125 38.5 24.95 8 22.875 20.200000000000003 24.975 31.95 9 23.375 19.55 28.475 28.599999999999998 10-11 26.75 27.950000000000003 20.1875 25.112499999999997 12-13 24.725 21.5 26.887499999999996 26.887499999999996 14-15 26.325 22.7125 25.137500000000003 25.825 16-17 26.2625 23.075000000000003 24.462500000000002 26.200000000000003 18-19 25.15 23.775 24.2 26.875 20-21 26.150000000000002 23.1875 24.1625 26.5 22-23 26.55 24.4875 22.925 26.0375 24-25 26.1125 23.8625 23.599999999999998 26.424999999999997 26-27 25.2 24.462500000000002 24.2625 26.075 28-29 25.637500000000003 23.625 23.925 26.8125 30-31 25.7125 23.599999999999998 25.074999999999996 25.6125 32-33 25.374999999999996 24.4875 24.175 25.9625 34-35 25.424999999999997 23.962500000000002 23.7375 26.875 36-37 25.137500000000003 24.275 23.875 26.7125 38-39 26.5625 23.799999999999997 23.3875 26.25 40-41 26.2625 23.75 23.4125 26.575 42-43 25.5125 23.775 23.875 26.8375 44-45 25.7875 23.7375 23.9 26.575 46-47 25.85 23.825 23.6625 26.6625 48-49 25.974999999999998 24.2625 24.05 25.7125 50-51 26.8375 23.3125 23.775 26.075 52-53 26.5625 23.7375 23.2375 26.4625 54-55 25.474999999999998 23.849999999999998 24.075 26.6 56-57 26.637499999999996 24.875 23.150000000000002 25.337500000000002 58-59 25.887500000000003 23.875 23.35 26.887499999999996 60-61 26.8 23.7375 23.0625 26.400000000000002 62-63 25.775 24.2875 24.2375 25.7 64-65 25.924999999999997 23.8625 24.1875 26.025 66-67 26.450000000000003 23.9 22.8 26.85 68-69 27.200000000000003 23.6875 23.3875 25.724999999999998 70-71 26.05 24.087500000000002 23.5375 26.325 72-73 26.237500000000004 23.2375 24.2 26.325 74-75 25.2625 23.799999999999997 24.025 26.9125 76-77 25.5125 24.0625 24.0375 26.387500000000003 78-79 26.187500000000004 23.25 23.974999999999998 26.5875 80-81 25.837500000000002 24.474999999999998 23.599999999999998 26.087500000000002 82-83 25.674999999999997 23.6125 24.55 26.1625 84-85 26.35 24.175 23.35 26.125 86-87 26.4125 23.6125 23.7375 26.237500000000004 88-89 25.674999999999997 24.0625 23.6125 26.650000000000002 90-91 25.15 24.45 23.6375 26.7625 92-93 25.587500000000002 24.0 24.1625 26.25 94-95 25.575 23.599999999999998 24.9 25.924999999999997 96-97 26.437500000000004 22.900000000000002 23.9375 26.724999999999998 98-99 26.0 24.5375 23.724999999999998 25.7375 100-101 26.337500000000002 23.25 23.35 27.0625 102-103 25.95 24.1625 23.775 26.1125 104-105 26.1 23.8875 23.75 26.2625 106-107 27.1375 24.087500000000002 23.275000000000002 25.5 108-109 26.400000000000002 22.8875 24.3625 26.35 110-111 25.900000000000002 23.4875 24.5625 26.05 112-113 26.137500000000003 23.8875 24.2 25.775 114-115 26.2125 23.25 24.0 26.5375 116-117 25.387500000000003 24.075 24.212500000000002 26.325 118-119 26.900000000000002 23.65 22.7625 26.687499999999996 120-121 25.9875 23.925 23.8375 26.25 122-123 25.912499999999998 23.95 24.1125 26.025 124-125 27.1125 23.2875 23.6875 25.912499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 0.0 26 1.0 27 2.5 28 4.5 29 7.5 30 8.5 31 8.0 32 8.0 33 10.5 34 21.0 35 35.0 36 46.5 37 57.5 38 76.5 39 87.5 40 99.0 41 117.0 42 142.5 43 160.5 44 162.5 45 166.5 46 162.5 47 161.5 48 150.5 49 139.0 50 138.5 51 125.5 52 116.0 53 117.0 54 106.5 55 92.5 56 76.0 57 66.0 58 78.5 59 87.0 60 90.5 61 88.5 62 79.0 63 78.0 64 66.0 65 68.5 66 75.5 67 66.0 68 62.0 69 62.0 70 59.0 71 54.5 72 48.0 73 43.5 74 46.0 75 41.5 76 34.0 77 23.0 78 18.0 79 16.0 80 11.5 81 8.5 82 6.0 83 4.5 84 2.0 85 0.5 86 0.0 87 1.0 88 1.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84973703981969 99.675 2 0.12521913348359628 0.25 3 0.025043826696719257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662587 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662587_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.43275 33.0 32.0 34.0 25.0 34.0 2 31.36175 33.0 32.0 34.0 25.0 34.0 3 31.52375 33.0 32.0 34.0 27.0 34.0 4 31.332 33.0 32.0 34.0 27.0 34.0 5 31.19 33.0 32.0 34.0 25.0 34.0 6 35.17525 38.0 36.0 38.0 28.0 38.0 7 34.9065 38.0 36.0 38.0 26.0 38.0 8 35.19275 38.0 36.0 38.0 28.0 38.0 9 34.54175 38.0 35.0 38.0 16.0 38.0 10-11 35.086 38.0 36.0 38.0 27.0 38.0 12-13 35.20875 38.0 36.0 38.0 27.5 38.0 14-15 35.040875 38.0 36.0 38.0 27.0 38.0 16-17 35.140125 38.0 36.0 38.0 27.0 38.0 18-19 34.873875 38.0 36.0 38.0 26.0 38.0 20-21 35.043375 38.0 36.0 38.0 27.0 38.0 22-23 35.40712499999999 38.0 37.0 38.0 28.0 38.0 24-25 35.143125 38.0 36.0 38.0 27.5 38.0 26-27 35.147625000000005 38.0 36.0 38.0 26.5 38.0 28-29 34.8125 38.0 36.0 38.0 26.0 38.0 30-31 34.8725 38.0 35.5 38.0 26.0 38.0 32-33 35.204875 38.0 36.0 38.0 27.5 38.0 34-35 35.362375 38.0 36.0 38.0 27.5 38.0 36-37 34.809125 38.0 35.5 38.0 25.0 38.0 38-39 34.800625 38.0 35.5 38.0 26.0 38.0 40-41 35.188500000000005 38.0 36.0 38.0 27.5 38.0 42-43 35.252625 38.0 36.0 38.0 27.5 38.0 44-45 35.269375 38.0 36.0 38.0 27.5 38.0 46-47 35.162375 38.0 36.0 38.0 27.0 38.0 48-49 34.986625000000004 38.0 36.0 38.0 27.0 38.0 50-51 34.630125 38.0 35.0 38.0 24.5 38.0 52-53 35.279624999999996 38.0 36.0 38.0 28.0 38.0 54-55 35.394125 38.0 36.0 38.0 28.0 38.0 56-57 35.472625 38.0 36.5 38.0 29.0 38.0 58-59 35.47975 38.0 36.5 38.0 29.0 38.0 60-61 35.624625 38.0 37.0 38.0 29.0 38.0 62-63 35.251625 38.0 36.0 38.0 27.5 38.0 64-65 35.17125 38.0 36.0 38.0 27.5 38.0 66-67 34.83225 38.0 35.5 38.0 26.0 38.0 68-69 35.591499999999996 38.0 36.5 38.0 28.5 38.0 70-71 35.61025 38.0 36.5 38.0 30.0 38.0 72-73 35.293499999999995 38.0 36.5 38.0 28.0 38.0 74-75 35.239625000000004 38.0 36.0 38.0 27.5 38.0 76-77 35.612875 38.0 36.5 38.0 30.0 38.0 78-79 35.169624999999996 38.0 36.0 38.0 27.5 38.0 80-81 35.1725 38.0 36.0 38.0 28.0 38.0 82-83 35.012625 38.0 36.0 38.0 26.5 38.0 84-85 35.397375 38.0 36.0 38.0 29.0 38.0 86-87 35.126125 38.0 36.0 38.0 27.5 38.0 88-89 34.7675 38.0 35.5 38.0 25.5 38.0 90-91 35.250125 38.0 36.0 38.0 28.0 38.0 92-93 35.219875 38.0 36.0 38.0 28.0 38.0 94-95 35.353750000000005 38.0 36.0 38.0 29.0 38.0 96-97 35.00675 38.0 35.5 38.0 26.5 38.0 98-99 34.964124999999996 38.0 36.0 38.0 27.0 38.0 100-101 34.7395 38.0 35.5 38.0 25.0 38.0 102-103 34.85525 38.0 35.0 38.0 26.5 38.0 104-105 34.601124999999996 38.0 35.0 38.0 25.0 38.0 106-107 34.6175 38.0 35.0 38.0 25.0 38.0 108-109 34.374375 38.0 35.0 38.0 23.0 38.0 110-111 34.704625 38.0 35.0 38.0 26.0 38.0 112-113 34.691874999999996 38.0 35.5 38.0 26.0 38.0 114-115 34.338499999999996 38.0 35.0 38.0 23.5 38.0 116-117 34.71875 38.0 35.0 38.0 27.5 38.0 118-119 34.342749999999995 38.0 35.0 38.0 24.5 38.0 120-121 34.05275 38.0 35.0 38.0 23.0 38.0 122-123 33.700125 38.0 35.0 38.0 21.0 38.0 124-125 33.07575 38.0 34.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 3.0 16 5.0 17 3.0 18 11.0 19 18.0 20 9.0 21 27.0 22 18.0 23 32.0 24 42.0 25 35.0 26 65.0 27 71.0 28 87.0 29 113.0 30 117.0 31 114.0 32 149.0 33 166.0 34 196.0 35 270.0 36 501.0 37 1942.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.35 12.775 12.5 34.375 2 30.425 18.075 30.9 20.599999999999998 3 26.85 24.4 20.724999999999998 28.025 4 30.625000000000004 29.25 16.45 23.674999999999997 5 29.4 31.15 19.0 20.45 6 22.15 34.875 20.549999999999997 22.425 7 21.85 16.675 37.875 23.599999999999998 8 23.0 20.5 25.324999999999996 31.175000000000004 9 23.35 19.25 28.4 28.999999999999996 10-11 26.0625 28.6875 20.3875 24.8625 12-13 24.637500000000003 21.8125 26.875 26.674999999999997 14-15 25.7375 24.1375 25.35 24.775 16-17 26.525 23.2625 24.45 25.7625 18-19 26.25 23.0875 24.0375 26.625 20-21 25.6125 23.799999999999997 24.6625 25.924999999999997 22-23 26.3625 23.849999999999998 23.525 26.2625 24-25 26.7625 24.4375 23.025000000000002 25.775 26-27 25.9625 24.8 23.7 25.5375 28-29 26.487500000000004 23.575 23.849999999999998 26.087500000000002 30-31 25.224999999999998 23.8625 24.762500000000003 26.150000000000002 32-33 25.7 23.9875 24.1125 26.200000000000003 34-35 26.0375 24.125 23.7 26.137500000000003 36-37 25.224999999999998 25.112499999999997 24.05 25.6125 38-39 25.7875 24.587500000000002 24.875 24.75 40-41 26.25 24.224999999999998 23.8375 25.687500000000004 42-43 25.525 24.525 24.5375 25.412499999999998 44-45 26.35 24.2625 24.2875 25.1 46-47 26.525 25.0125 22.425 26.0375 48-49 25.9875 24.1625 24.125 25.724999999999998 50-51 25.662499999999998 24.3625 23.625 26.35 52-53 26.224999999999998 24.025 23.425 26.325 54-55 26.2875 23.8125 23.6375 26.2625 56-57 26.8625 24.325 23.525 25.2875 58-59 26.6 23.825 22.925 26.650000000000002 60-61 26.05 23.525 23.5375 26.887499999999996 62-63 25.55 24.3875 24.3125 25.75 64-65 26.275 23.599999999999998 23.95 26.174999999999997 66-67 25.5375 23.8125 23.925 26.724999999999998 68-69 25.937500000000004 24.375 24.1375 25.55 70-71 26.5125 23.6375 23.3125 26.5375 72-73 25.7625 23.9 24.3875 25.95 74-75 26.387500000000003 23.6625 24.2625 25.687500000000004 76-77 26.05 24.349999999999998 23.549999999999997 26.05 78-79 26.125 24.337500000000002 22.925 26.6125 80-81 25.5125 23.6875 25.324999999999996 25.474999999999998 82-83 26.237500000000004 23.4375 23.799999999999997 26.525 84-85 26.35 23.875 22.95 26.825 86-87 26.075 23.849999999999998 23.525 26.55 88-89 26.737499999999997 24.0125 22.5 26.75 90-91 25.9625 23.6125 23.6125 26.8125 92-93 25.9875 24.224999999999998 23.7625 26.025 94-95 26.237500000000004 23.1875 23.7875 26.787499999999998 96-97 26.200000000000003 23.65 24.25 25.900000000000002 98-99 26.8125 23.4125 23.5875 26.187500000000004 100-101 26.8 23.7875 23.4625 25.95 102-103 25.837500000000002 23.3625 24.5625 26.237500000000004 104-105 26.125 23.599999999999998 24.1875 26.087500000000002 106-107 26.224999999999998 23.65 24.075 26.05 108-109 25.687500000000004 23.7125 24.4875 26.1125 110-111 26.424999999999997 23.6375 23.0 26.937499999999996 112-113 26.3 24.325 23.8875 25.4875 114-115 26.1125 23.525 23.9375 26.424999999999997 116-117 27.05 23.075000000000003 24.025 25.85 118-119 26.474999999999998 24.224999999999998 23.0875 26.2125 120-121 26.400000000000002 24.0125 23.7875 25.8 122-123 25.7625 23.6625 24.45 26.125 124-125 26.1 24.462500000000002 22.9375 26.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 1.5 26 1.5 27 0.5 28 3.5 29 6.5 30 5.5 31 8.5 32 14.0 33 18.5 34 20.0 35 27.0 36 36.5 37 57.0 38 80.5 39 94.5 40 116.0 41 121.0 42 141.0 43 154.0 44 151.5 45 169.5 46 168.5 47 159.5 48 150.0 49 145.0 50 134.0 51 116.0 52 110.5 53 108.5 54 101.5 55 99.5 56 100.5 57 90.5 58 90.5 59 89.0 60 82.0 61 78.5 62 67.5 63 62.5 64 72.0 65 78.5 66 72.5 67 72.0 68 61.0 69 60.0 70 66.0 71 53.5 72 47.5 73 44.0 74 33.5 75 28.5 76 28.0 77 24.0 78 20.0 79 13.5 80 12.0 81 9.0 82 5.0 83 5.0 84 3.5 85 2.0 86 1.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628728 spots for SRR13662587.sra Written 628728 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra Read 628711 spots for SRR13662587.sra Written 628711 spots for SRR13662587.sra SRR ids: ['SRR13662587.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1w3e72oo SRR13662587.sra spots: 12574237 blocks: [[1, 628711], [628712, 1257422], [1257423, 1886133], [1886134, 2514844], [2514845, 3143555], [3143556, 3772266], [3772267, 4400977], [4400978, 5029688], [5029689, 5658399], [5658400, 6287110], [6287111, 6915821], [6915822, 7544532], [7544533, 8173243], [8173244, 8801954], [8801955, 9430665], [9430666, 10059376], [10059377, 10688087], [10688088, 11316798], [11316799, 11945509], [11945510, 12574237]] SRR13662587 file size 3613040 SRR13662587 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662587 SRR13662587_1.fastq SRR13662587_2.fastq Input file: SRR13662587_1.fastq Paired file: SRR13662587_2.fastq trimmed: SRR13662587-trimmed-pair1.fastq, SRR13662587-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:39:57 2024 >> started Tue Dec 10 07:40:42 2024 >> done (45.250s) 12574237 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 112 ( 0.00%) empty read pairs filtered out after trimming by size control 12574125 (100.00%) read pairs available; of these: 1503137 (11.95%) trimmed read pairs available after processing 11070988 (88.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 1 0.00% 33 2 0.00% 34 1 0.00% 35 2 0.00% 36 0 0.00% 37 0 0.00% 38 1 0.00% 39 0 0.00% 40 0 0.00% 41 1 0.00% 42 0 0.00% 43 1 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 4 0.00% 50 1 0.00% 51 2 0.00% 52 0 0.00% 53 1 0.00% 54 1 0.00% 55 0 0.00% 56 1 0.00% 57 1 0.00% 58 4 0.00% 59 2 0.00% 60 4 0.00% 61 3 0.00% 62 7 0.00% 63 24 0.00% 64 45 0.00% 65 62 0.00% 66 66 0.00% 67 89 0.00% 68 96 0.00% 69 122 0.00% 70 175 0.00% 71 199 0.00% 72 212 0.00% 73 230 0.00% 74 236 0.00% 75 289 0.00% 76 309 0.00% 77 333 0.00% 78 401 0.00% 79 408 0.00% 80 414 0.00% 81 458 0.00% 82 520 0.00% 83 552 0.00% 84 584 0.00% 85 658 0.01% 86 737 0.01% 87 817 0.01% 88 874 0.01% 89 993 0.01% 90 1116 0.01% 91 1258 0.01% 92 1525 0.01% 93 1816 0.01% 94 4905 0.04% 95 5112 0.04% 96 5293 0.04% 97 5632 0.04% 98 5840 0.05% 99 6410 0.05% 100 6387 0.05% 101 6833 0.05% 102 7192 0.06% 103 7421 0.06% 104 7844 0.06% 105 8121 0.06% 106 8544 0.07% 107 9208 0.07% 108 9852 0.08% 109 10561 0.08% 110 11471 0.09% 111 12764 0.10% 112 14244 0.11% 113 15662 0.12% 114 17110 0.14% 115 19542 0.16% 116 36466 0.29% 117 41787 0.33% 118 49137 0.39% 119 58763 0.47% 120 73784 0.59% 121 96512 0.77% 122 138123 1.10% 123 230109 1.83% 124 556847 4.43% 125 11070988 88.05% 12574125 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=168.11 fanout-score-rank=11 prefix-density=1.05 prefix-fanout=21.8 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=442.90 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=28.3 sequence=CGCCGCCGCCAA criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=165.97 fanout-score-rank=11 prefix-density=1.06 prefix-fanout=21.7 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=422.34 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=28.8 sequence=CGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTA SRR13662587 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 10 07:47:53 Started mapping on | Dec 10 07:47:57 Finished on | Dec 10 07:49:48 Mapping speed, Million of reads per hour | 407.81 Number of input reads | 12574116 Average input read length | 228 UNIQUE READS: Uniquely mapped reads number | 11156596 Uniquely mapped reads % | 88.73% Average mapped length | 226.49 Number of splices: Total | 8075463 Number of splices: Annotated (sjdb) | 7597499 Number of splices: GT/AG | 7964702 Number of splices: GC/AG | 91969 Number of splices: AT/AC | 4464 Number of splices: Non-canonical | 14328 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.00 Insertion rate per base | 0.01% Insertion average length | 1.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 221391 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 16830 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.53% % of reads unmapped: other | 0.85% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1197121 1197121 1197121 N_multimapping 221391 221391 221391 N_noFeature 413196 5687975 5694451 N_ambiguous 243835 29346 29675 UnstrandedReadsAssigned:10499565 PositiveStrandReadsAssigned:5439275 NegativeStrandReadsAssigned:5432470 Dataset is classified unstranded MeadianReadLen=105 20thPercentileLength=105 echo kmer=101 SRR13662587 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662587-trimmed-pair1.fastq SRR13662587-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,574,116 reads, 11,565,359 reads pseudoaligned [quant] estimated average fragment length: 181.404 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,242 rounds 52973 SRR13662587.ke.tsv 35125 SRR13662587.se.tsv 88098 total ==> SRR13662587.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 755.807 0 0 PNS24247 1044 863.596 43.7244 6.20839 PNS24249 1928 1747.6 230.938 16.2039 PNS24246 1044 863.596 43.7244 6.20839 PNS24248 1044 863.596 43.7244 6.20839 PNS24244 1471 1290.6 36.889 3.50486 PNS24243 293 118.295 17 17.6217 KQK14069 1603 1422.6 6369.01 548.979 KQK14071 474 295.534 1087.99 451.423 ==> SRR13662587.se.tsv <== BRADI_1g14170v3 7546 BRADI_1g53295v3 26 BRADI_1g59795v3 333 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 194 BRADI_1g74790v3 269 BRADI_1g09890v3 0 BRADI_1g77505v3 171 BRADI_1g48960v3 0 SRR13662587 completed mapping pipeline successfully