Starting /dee2/code/volunteer_pipeline.sh SRR13662588 current disk space = 1526790963200 free memory = 1600627412 SRR13662588 SRAfilesize 65178b308c4a4530b35cdeaa9ee4d9e4 SRR13662588.sra SRR13662588.sra file validated SRR13662588 is paired end SRR13662588 is conventional basespace SRR13662588 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662588_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40825 33.0 33.0 34.0 31.0 34.0 2 32.53675 33.0 33.0 34.0 31.0 34.0 3 32.445 34.0 33.0 34.0 31.0 34.0 4 32.384 34.0 33.0 34.0 31.0 34.0 5 32.4895 34.0 33.0 34.0 31.0 34.0 6 35.913 38.0 36.0 38.0 31.0 38.0 7 36.54425 38.0 37.0 38.0 34.0 38.0 8 36.66975 38.0 38.0 38.0 34.0 38.0 9 36.75325 38.0 38.0 38.0 34.0 38.0 10-11 36.846875 38.0 38.0 38.0 34.5 38.0 12-13 36.813874999999996 38.0 38.0 38.0 34.5 38.0 14-15 36.804249999999996 38.0 38.0 38.0 35.0 38.0 16-17 36.820875 38.0 38.0 38.0 35.0 38.0 18-19 36.877375 38.0 38.0 38.0 35.0 38.0 20-21 36.839375000000004 38.0 38.0 38.0 35.0 38.0 22-23 36.810625 38.0 38.0 38.0 34.5 38.0 24-25 36.72275 38.0 38.0 38.0 34.5 38.0 26-27 36.7725 38.0 38.0 38.0 35.0 38.0 28-29 36.729749999999996 38.0 38.0 38.0 34.5 38.0 30-31 36.675625 38.0 38.0 38.0 34.0 38.0 32-33 36.666875 38.0 38.0 38.0 34.0 38.0 34-35 36.677375 38.0 38.0 38.0 34.0 38.0 36-37 36.685874999999996 38.0 38.0 38.0 34.0 38.0 38-39 36.58475 38.0 38.0 38.0 34.0 38.0 40-41 36.654375 38.0 38.0 38.0 34.0 38.0 42-43 36.652625 38.0 38.0 38.0 34.0 38.0 44-45 36.512625 38.0 38.0 38.0 34.0 38.0 46-47 36.580875000000006 38.0 38.0 38.0 34.0 38.0 48-49 36.56675 38.0 38.0 38.0 34.0 38.0 50-51 36.605374999999995 38.0 38.0 38.0 34.0 38.0 52-53 36.547124999999994 38.0 38.0 38.0 34.0 38.0 54-55 36.643125 38.0 38.0 38.0 34.0 38.0 56-57 36.473125 38.0 38.0 38.0 34.0 38.0 58-59 36.52725 38.0 38.0 38.0 34.0 38.0 60-61 36.44375 38.0 38.0 38.0 33.5 38.0 62-63 36.396 38.0 38.0 38.0 33.5 38.0 64-65 36.453625 38.0 38.0 38.0 33.5 38.0 66-67 36.421625 38.0 38.0 38.0 33.5 38.0 68-69 36.383375 38.0 38.0 38.0 33.5 38.0 70-71 36.3425 38.0 38.0 38.0 33.0 38.0 72-73 36.335625 38.0 38.0 38.0 33.0 38.0 74-75 36.31925 38.0 38.0 38.0 33.5 38.0 76-77 36.4015 38.0 38.0 38.0 33.5 38.0 78-79 36.370125 38.0 38.0 38.0 33.5 38.0 80-81 36.188 38.0 37.5 38.0 33.0 38.0 82-83 36.180375 38.0 38.0 38.0 33.0 38.0 84-85 36.142875000000004 38.0 38.0 38.0 33.0 38.0 86-87 36.133250000000004 38.0 37.5 38.0 32.5 38.0 88-89 36.150625000000005 38.0 38.0 38.0 33.0 38.0 90-91 36.087875 38.0 37.0 38.0 33.0 38.0 92-93 36.00125 38.0 37.0 38.0 32.5 38.0 94-95 35.999 38.0 37.0 38.0 32.5 38.0 96-97 35.843625 38.0 37.0 38.0 31.5 38.0 98-99 35.904875000000004 38.0 37.0 38.0 32.5 38.0 100-101 35.81075 38.0 37.0 38.0 31.0 38.0 102-103 35.722750000000005 38.0 37.0 38.0 31.0 38.0 104-105 35.863125 38.0 37.0 38.0 32.0 38.0 106-107 35.81825 38.0 37.0 38.0 32.0 38.0 108-109 35.7805 38.0 37.0 38.0 31.5 38.0 110-111 35.54975 38.0 36.0 38.0 31.0 38.0 112-113 35.572374999999994 38.0 36.0 38.0 31.0 38.0 114-115 35.59825 38.0 37.0 38.0 31.0 38.0 116-117 35.367875 38.0 36.0 38.0 30.0 38.0 118-119 35.3005 38.0 36.0 38.0 30.0 38.0 120-121 35.100624999999994 38.0 36.0 38.0 30.0 38.0 122-123 35.064750000000004 38.0 36.0 38.0 29.0 38.0 124-125 34.6455 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 0.0 17 1.0 18 3.0 19 1.0 20 5.0 21 4.0 22 7.0 23 7.0 24 4.0 25 19.0 26 37.0 27 48.0 28 41.0 29 51.0 30 68.0 31 79.0 32 102.0 33 136.0 34 168.0 35 251.0 36 480.0 37 2486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.675 12.1 11.1 36.125 2 30.475 17.325 29.349999999999998 22.85 3 28.1 22.775000000000002 21.5 27.625 4 29.275000000000002 30.25 17.974999999999998 22.5 5 28.849999999999998 29.925 20.200000000000003 21.025 6 23.875 33.324999999999996 20.025000000000002 22.775000000000002 7 20.974999999999998 15.25 38.574999999999996 25.2 8 23.35 19.55 25.575 31.525 9 23.95 19.900000000000002 26.75 29.4 10-11 26.0125 28.262500000000003 20.525 25.2 12-13 25.224999999999998 21.0125 26.450000000000003 27.3125 14-15 25.55 22.7125 24.962500000000002 26.775 16-17 26.4125 23.175 24.087500000000002 26.325 18-19 25.424999999999997 23.3375 24.0375 27.200000000000003 20-21 26.275 22.3375 24.175 27.212500000000002 22-23 26.125 23.65 23.962500000000002 26.2625 24-25 26.825 23.9125 23.4125 25.85 26-27 26.450000000000003 24.3125 23.0625 26.174999999999997 28-29 26.437500000000004 24.075 23.2625 26.224999999999998 30-31 26.437500000000004 24.25 23.45 25.8625 32-33 26.224999999999998 23.4125 23.724999999999998 26.637499999999996 34-35 26.7625 24.15 23.1125 25.974999999999998 36-37 26.3 24.224999999999998 23.2375 26.237500000000004 38-39 26.474999999999998 23.1375 23.6125 26.775 40-41 25.5375 23.3375 24.462500000000002 26.6625 42-43 26.55 24.2 23.1625 26.087500000000002 44-45 26.375 23.7625 22.8625 27.0 46-47 26.875 23.962500000000002 23.0125 26.150000000000002 48-49 26.025 23.425 23.599999999999998 26.950000000000003 50-51 25.7375 24.1375 23.7375 26.387500000000003 52-53 26.6625 23.150000000000002 23.724999999999998 26.4625 54-55 25.687500000000004 24.3 23.175 26.8375 56-57 26.700000000000003 23.45 23.5125 26.337500000000002 58-59 26.7125 23.8375 22.925 26.525 60-61 27.0 23.225 22.8375 26.937499999999996 62-63 26.887499999999996 23.6125 23.4625 26.0375 64-65 26.5 24.0125 23.2125 26.275 66-67 25.874999999999996 23.8625 23.2375 27.025 68-69 26.0625 23.7 24.087500000000002 26.150000000000002 70-71 27.3125 23.7 22.6375 26.35 72-73 26.25 23.674999999999997 24.0625 26.0125 74-75 26.2875 23.6375 23.400000000000002 26.674999999999997 76-77 26.687499999999996 24.0 23.150000000000002 26.1625 78-79 26.5375 23.8875 23.05 26.525 80-81 26.55 23.1875 23.674999999999997 26.5875 82-83 25.837500000000002 23.6625 24.5 26.0 84-85 26.087500000000002 23.45 23.625 26.8375 86-87 26.2625 23.9375 23.45 26.35 88-89 26.737499999999997 24.087500000000002 22.787499999999998 26.387500000000003 90-91 26.1125 23.7625 24.099999999999998 26.025 92-93 26.087500000000002 23.4375 23.9875 26.487500000000004 94-95 27.737499999999997 23.1875 23.3375 25.7375 96-97 25.912499999999998 23.775 22.900000000000002 27.4125 98-99 26.375 23.5125 23.5125 26.6 100-101 25.7875 23.674999999999997 23.4125 27.125 102-103 26.375 23.7375 23.0125 26.875 104-105 26.887499999999996 22.650000000000002 23.7 26.7625 106-107 26.35 23.724999999999998 23.7875 26.137500000000003 108-109 26.9125 23.150000000000002 23.6375 26.3 110-111 27.1125 23.7375 22.8875 26.2625 112-113 26.450000000000003 24.175 22.8125 26.5625 114-115 26.35 22.825 23.9125 26.9125 116-117 26.674999999999997 23.325000000000003 23.549999999999997 26.450000000000003 118-119 26.5625 23.25 24.099999999999998 26.087500000000002 120-121 27.150000000000002 22.525000000000002 24.099999999999998 26.224999999999998 122-123 27.224999999999998 23.325000000000003 23.4125 26.0375 124-125 26.237500000000004 23.799999999999997 24.425 25.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.5 25 2.5 26 1.0 27 2.5 28 4.5 29 5.5 30 7.5 31 12.5 32 15.5 33 14.0 34 22.0 35 33.5 36 43.0 37 50.0 38 58.5 39 76.5 40 90.5 41 108.0 42 130.0 43 134.0 44 141.5 45 161.0 46 153.0 47 147.5 48 164.0 49 150.5 50 127.0 51 133.5 52 133.0 53 114.5 54 103.5 55 102.5 56 88.0 57 82.0 58 87.0 59 83.0 60 81.0 61 78.0 62 81.5 63 83.0 64 79.0 65 78.0 66 80.5 67 68.5 68 65.0 69 71.5 70 67.5 71 64.0 72 56.0 73 51.0 74 44.5 75 34.5 76 25.5 77 24.5 78 23.0 79 16.0 80 14.0 81 9.0 82 5.5 83 4.0 84 2.0 85 1.5 86 1.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662588 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662588_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.13125 33.0 33.0 34.0 30.0 34.0 2 32.1985 33.0 33.0 34.0 30.0 34.0 3 32.30875 33.0 33.0 34.0 31.0 34.0 4 32.2245 33.0 33.0 34.0 31.0 34.0 5 32.12825 33.0 33.0 34.0 31.0 34.0 6 35.92125 38.0 37.0 38.0 31.0 38.0 7 36.197 38.0 38.0 38.0 33.0 38.0 8 36.04825 38.0 37.0 38.0 32.0 38.0 9 36.07775 38.0 37.0 38.0 32.0 38.0 10-11 36.096125 38.0 37.5 38.0 31.0 38.0 12-13 36.033 38.0 37.0 38.0 32.0 38.0 14-15 36.119875 38.0 37.5 38.0 32.5 38.0 16-17 36.125875 38.0 38.0 38.0 32.0 38.0 18-19 35.9835 38.0 37.0 38.0 31.5 38.0 20-21 35.949 38.0 37.0 38.0 30.0 38.0 22-23 35.92225 38.0 37.5 38.0 31.0 38.0 24-25 36.021874999999994 38.0 38.0 38.0 31.5 38.0 26-27 36.074375 38.0 37.0 38.0 31.0 38.0 28-29 36.0105 38.0 37.5 38.0 32.5 38.0 30-31 36.122375000000005 38.0 38.0 38.0 33.0 38.0 32-33 36.132875 38.0 38.0 38.0 33.0 38.0 34-35 36.111875 38.0 38.0 38.0 32.5 38.0 36-37 36.1425 38.0 38.0 38.0 32.5 38.0 38-39 36.0065 38.0 37.0 38.0 31.5 38.0 40-41 36.105625 38.0 38.0 38.0 31.0 38.0 42-43 35.9385 38.0 37.5 38.0 31.0 38.0 44-45 36.032125 38.0 37.0 38.0 31.0 38.0 46-47 35.897 38.0 37.0 38.0 31.0 38.0 48-49 36.00875 38.0 37.0 38.0 31.0 38.0 50-51 36.144375 38.0 37.5 38.0 33.0 38.0 52-53 35.931875 38.0 37.0 38.0 31.0 38.0 54-55 36.008125 38.0 37.5 38.0 31.0 38.0 56-57 35.958124999999995 38.0 37.0 38.0 31.0 38.0 58-59 35.963750000000005 38.0 37.0 38.0 31.5 38.0 60-61 35.954375 38.0 37.0 38.0 31.0 38.0 62-63 35.953500000000005 38.0 37.0 38.0 31.0 38.0 64-65 35.819500000000005 38.0 37.0 38.0 31.0 38.0 66-67 35.857124999999996 38.0 37.0 38.0 31.0 38.0 68-69 35.803875000000005 38.0 37.0 38.0 31.0 38.0 70-71 35.79125 38.0 37.0 38.0 31.0 38.0 72-73 35.7385 38.0 37.0 38.0 30.0 38.0 74-75 35.8865 38.0 37.0 38.0 31.0 38.0 76-77 35.64375 38.0 37.0 38.0 30.0 38.0 78-79 35.745374999999996 38.0 37.0 38.0 31.0 38.0 80-81 35.64475 38.0 37.0 38.0 29.5 38.0 82-83 35.557249999999996 38.0 36.5 38.0 30.0 38.0 84-85 35.581500000000005 38.0 37.0 38.0 30.0 38.0 86-87 35.525875 38.0 37.0 38.0 29.0 38.0 88-89 35.466375 38.0 36.0 38.0 29.0 38.0 90-91 35.394625 38.0 36.0 38.0 29.5 38.0 92-93 35.312749999999994 38.0 36.0 38.0 29.0 38.0 94-95 35.313375 38.0 36.0 38.0 29.0 38.0 96-97 35.256375 38.0 36.0 38.0 28.5 38.0 98-99 35.17675 38.0 36.0 38.0 28.5 38.0 100-101 35.131249999999994 38.0 36.0 38.0 27.5 38.0 102-103 35.105875 38.0 36.0 38.0 28.0 38.0 104-105 35.044624999999996 38.0 36.0 38.0 27.5 38.0 106-107 34.967 38.0 35.5 38.0 27.5 38.0 108-109 34.719875 38.0 35.0 38.0 26.0 38.0 110-111 34.75325 38.0 35.0 38.0 26.5 38.0 112-113 34.48025 38.0 35.0 38.0 24.5 38.0 114-115 34.490375 38.0 35.0 38.0 24.0 38.0 116-117 34.40075 38.0 35.0 38.0 24.0 38.0 118-119 34.4915 38.0 35.0 38.0 25.0 38.0 120-121 34.380625 38.0 35.0 38.0 24.5 38.0 122-123 33.854625 38.0 35.0 38.0 23.0 38.0 124-125 33.491375000000005 38.0 35.0 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 3.0 16 5.0 17 1.0 18 7.0 19 9.0 20 10.0 21 11.0 22 20.0 23 24.0 24 27.0 25 32.0 26 43.0 27 57.0 28 76.0 29 69.0 30 100.0 31 101.0 32 124.0 33 138.0 34 198.0 35 254.0 36 468.0 37 2221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.975 11.600000000000001 11.325000000000001 37.1 2 32.7 18.275 27.175 21.85 3 27.05 25.4 19.950000000000003 27.6 4 31.125000000000004 30.0 16.5 22.375 5 29.849999999999998 31.0 18.4 20.75 6 23.1 33.4 20.375 23.125 7 21.8 15.325 37.15 25.724999999999998 8 23.925 20.3 25.1 30.675 9 23.75 19.675 26.674999999999997 29.9 10-11 27.4125 28.9 18.8375 24.85 12-13 24.4 21.8 25.6 28.199999999999996 14-15 25.1 23.7875 24.4 26.7125 16-17 26.0 23.125 24.7375 26.137500000000003 18-19 26.2625 23.4125 23.3125 27.0125 20-21 26.6625 23.45 23.4375 26.450000000000003 22-23 26.625 23.4875 23.65 26.237500000000004 24-25 26.6 23.825 24.4875 25.087500000000002 26-27 26.1125 23.9875 23.875 26.025 28-29 26.125 22.9875 24.675 26.2125 30-31 24.8125 24.7375 23.9 26.55 32-33 25.2 24.0625 23.8625 26.875 34-35 26.187500000000004 23.7375 23.525 26.55 36-37 25.650000000000002 23.7875 23.9375 26.625 38-39 26.450000000000003 23.7 22.3125 27.537499999999998 40-41 26.724999999999998 24.325 23.200000000000003 25.75 42-43 26.6625 24.337500000000002 22.825 26.174999999999997 44-45 26.424999999999997 24.2 23.5 25.874999999999996 46-47 25.95 23.5625 23.6125 26.875 48-49 25.637500000000003 23.6375 22.975 27.750000000000004 50-51 26.0125 22.625 25.25 26.1125 52-53 27.1625 23.425 23.1125 26.3 54-55 25.424999999999997 23.925 23.674999999999997 26.974999999999998 56-57 26.49155722326454 23.414634146341466 24.015009380863038 26.07879924953096 58-59 25.887500000000003 23.875 23.599999999999998 26.637499999999996 60-61 27.0875 22.9875 24.3625 25.5625 62-63 26.8625 23.0375 23.925 26.174999999999997 64-65 26.076076076076077 23.523523523523522 23.46096096096096 26.93943943943944 66-67 26.9125 23.7375 23.5 25.85 68-69 26.724999999999998 24.45 22.5875 26.237500000000004 70-71 26.337500000000002 23.6875 23.225 26.75 72-73 26.125 24.2375 23.3 26.337500000000002 74-75 26.325 23.1 23.175 27.400000000000002 76-77 26.7125 23.4625 23.400000000000002 26.424999999999997 78-79 26.25 23.3125 23.724999999999998 26.7125 80-81 25.924999999999997 23.425 24.4875 26.1625 82-83 27.200000000000003 23.175 23.125 26.5 84-85 24.85 23.8625 23.7125 27.575 86-87 26.237500000000004 23.962500000000002 23.549999999999997 26.25 88-89 27.287499999999998 23.4125 23.175 26.125 90-91 25.55 24.0375 23.8125 26.6 92-93 27.3875 22.912499999999998 23.6125 26.087500000000002 94-95 25.924999999999997 24.2875 22.7 27.0875 96-97 26.0125 23.7625 23.1125 27.1125 98-99 27.0875 23.3875 23.2125 26.3125 100-101 26.4625 22.625 24.075 26.8375 102-103 26.525 23.3625 23.8875 26.224999999999998 104-105 26.700000000000003 23.1 23.599999999999998 26.6 106-107 26.5125 23.4875 23.925 26.075 108-109 25.800376647834273 23.515379786566225 23.427495291902073 27.25674827369743 110-111 26.109857035364936 24.053172811637825 23.6017055430148 26.235264609982444 112-113 26.0748959778086 23.994452149791957 23.42705837851469 26.503593493884757 114-115 26.506024096385545 23.004518072289155 22.991967871485944 27.497489959839356 116-117 26.25 23.7 23.4875 26.5625 118-119 27.083854818523157 24.20525657071339 22.315394242803503 26.395494367959948 120-121 25.70642660665166 23.655913978494624 23.893473368342086 26.744186046511626 122-123 27.224999999999998 22.925 23.5375 26.3125 124-125 26.144608456342254 23.71778834125594 23.01726294721041 27.120340255191394 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.5 24 2.0 25 1.0 26 1.5 27 3.5 28 4.0 29 5.5 30 9.5 31 10.5 32 13.0 33 15.0 34 17.0 35 26.0 36 38.0 37 52.0 38 68.5 39 84.5 40 98.0 41 106.0 42 118.5 43 128.5 44 139.5 45 152.0 46 158.0 47 152.0 48 146.5 49 153.5 50 143.5 51 134.0 52 124.5 53 113.0 54 104.0 55 104.0 56 104.0 57 87.5 58 83.0 59 82.5 60 79.5 61 75.0 62 87.0 63 84.5 64 69.0 65 76.5 66 82.5 67 85.5 68 78.0 69 75.0 70 72.0 71 54.0 72 48.5 73 51.5 74 42.5 75 29.0 76 22.0 77 21.5 78 21.5 79 16.5 80 10.0 81 8.5 82 6.0 83 4.0 84 4.0 85 2.0 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0625 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.1 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.43750000000000006 110-111 0.325 112-113 0.8625 114-115 0.4 116-117 0.0 118-119 0.125 120-121 0.025 122-123 0.0 124-125 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705089 spots for SRR13662588.sra Written 705089 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra Read 705079 spots for SRR13662588.sra Written 705079 spots for SRR13662588.sra SRR ids: ['SRR13662588.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5nvfs8_j SRR13662588.sra spots: 14101590 blocks: [[1, 705079], [705080, 1410158], [1410159, 2115237], [2115238, 2820316], [2820317, 3525395], [3525396, 4230474], [4230475, 4935553], [4935554, 5640632], [5640633, 6345711], [6345712, 7050790], [7050791, 7755869], [7755870, 8460948], [8460949, 9166027], [9166028, 9871106], [9871107, 10576185], [10576186, 11281264], [11281265, 11986343], [11986344, 12691422], [12691423, 13396501], [13396502, 14101590]] SRR13662588 file size 4054540 SRR13662588 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662588 SRR13662588_1.fastq SRR13662588_2.fastq Input file: SRR13662588_1.fastq Paired file: SRR13662588_2.fastq trimmed: SRR13662588-trimmed-pair1.fastq, SRR13662588-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:40:14 2024 >> started Tue Dec 10 07:40:28 2024 >> done (13.926s) 14101590 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 157 ( 0.00%) empty read pairs filtered out after trimming by size control 14101432 (100.00%) read pairs available; of these: 1773436 (12.58%) trimmed read pairs available after processing 12327996 (87.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 3 0.00% 40 1 0.00% 41 2 0.00% 42 1 0.00% 43 1 0.00% 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 1 0.00% 48 0 0.00% 49 1 0.00% 50 2 0.00% 51 2 0.00% 52 2 0.00% 53 1 0.00% 54 1 0.00% 55 0 0.00% 56 2 0.00% 57 3 0.00% 58 3 0.00% 59 6 0.00% 60 3 0.00% 61 4 0.00% 62 5 0.00% 63 43 0.00% 64 54 0.00% 65 90 0.00% 66 101 0.00% 67 145 0.00% 68 154 0.00% 69 180 0.00% 70 191 0.00% 71 271 0.00% 72 259 0.00% 73 314 0.00% 74 338 0.00% 75 374 0.00% 76 397 0.00% 77 477 0.00% 78 465 0.00% 79 530 0.00% 80 577 0.00% 81 583 0.00% 82 694 0.00% 83 825 0.01% 84 778 0.01% 85 910 0.01% 86 920 0.01% 87 1004 0.01% 88 1157 0.01% 89 1278 0.01% 90 1432 0.01% 91 1659 0.01% 92 1869 0.01% 93 2486 0.02% 94 6097 0.04% 95 6391 0.05% 96 6649 0.05% 97 7009 0.05% 98 7449 0.05% 99 7671 0.05% 100 7839 0.06% 101 8285 0.06% 102 8537 0.06% 103 9176 0.07% 104 9390 0.07% 105 9873 0.07% 106 10341 0.07% 107 10890 0.08% 108 11940 0.08% 109 12634 0.09% 110 13816 0.10% 111 15471 0.11% 112 16921 0.12% 113 19014 0.13% 114 21388 0.15% 115 24436 0.17% 116 45537 0.32% 117 49586 0.35% 118 57476 0.41% 119 69041 0.49% 120 86514 0.61% 121 112680 0.80% 122 163209 1.16% 123 268326 1.90% 124 649247 4.60% 125 12327996 87.42% 14101432 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=163.42 fanout-score-rank=9 prefix-density=1.02 prefix-fanout=21.0 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=413.55 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=28.8 sequence=CGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGAT criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=161.27 fanout-score-rank=8 prefix-density=1.04 prefix-fanout=21.2 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=385.82 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=28.5 sequence=CGCCGCCGCCGG SRR13662588 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:41:50 Started mapping on | Dec 10 07:41:50 Finished on | Dec 10 07:42:57 Mapping speed, Million of reads per hour | 757.69 Number of input reads | 14101432 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 12794573 Uniquely mapped reads % | 90.73% Average mapped length | 238.70 Number of splices: Total | 9281309 Number of splices: Annotated (sjdb) | 8714503 Number of splices: GT/AG | 9154450 Number of splices: GC/AG | 105529 Number of splices: AT/AC | 5199 Number of splices: Non-canonical | 16131 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.86 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401485 % of reads mapped to multiple loci | 2.85% Number of reads mapped to too many loci | 32870 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.80% % of reads unmapped: other | 1.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 906704 906704 906704 N_multimapping 401485 401485 401485 N_noFeature 572333 6565333 6576164 N_ambiguous 286142 31926 32685 UnstrandedReadsAssigned:11936098 PositiveStrandReadsAssigned:6197314 NegativeStrandReadsAssigned:6185724 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662588 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662588-trimmed-pair1.fastq SRR13662588-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,101,432 reads, 12,793,471 reads pseudoaligned [quant] estimated average fragment length: 192.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52973 SRR13662588.ke.tsv 35125 SRR13662588.se.tsv 88098 total ==> SRR13662588.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.688 0 0 PNS24247 1044 852.421 52.4077 6.57137 PNS24249 1928 1736.42 325.157 20.0149 PNS24246 1044 852.421 52.4077 6.57137 PNS24248 1044 852.421 52.4077 6.57137 PNS24244 1471 1279.42 39.6195 3.30987 PNS24243 293 107.969 23 22.7689 KQK14069 1603 1411.42 6672.47 505.296 KQK14071 474 284.393 1140.74 428.73 ==> SRR13662588.se.tsv <== BRADI_1g14170v3 8272 BRADI_1g53295v3 34 BRADI_1g59795v3 406 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 226 BRADI_1g74790v3 329 BRADI_1g09890v3 0 BRADI_1g77505v3 176 BRADI_1g48960v3 0 SRR13662588 completed mapping pipeline successfully