Starting /dee2/code/volunteer_pipeline.sh SRR13662589 current disk space = 1526787747840 free memory = 1599177668 SRR13662589 SRAfilesize bccfa5e5a9fd06c13995be1821ecdfd9 SRR13662589.sra SRR13662589.sra file validated SRR13662589 is paired end SRR13662589 is conventional basespace SRR13662589 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662589_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.36625 33.0 33.0 34.0 31.0 34.0 2 32.23325 33.0 33.0 34.0 30.0 34.0 3 32.34125 33.0 33.0 34.0 30.0 34.0 4 32.4805 33.0 33.0 34.0 31.0 34.0 5 32.3895 33.0 33.0 34.0 31.0 34.0 6 36.10175 38.0 37.0 38.0 33.0 38.0 7 36.378 38.0 37.0 38.0 33.0 38.0 8 36.64025 38.0 38.0 38.0 34.0 38.0 9 36.74575 38.0 38.0 38.0 34.0 38.0 10-11 36.584 38.0 38.0 38.0 34.0 38.0 12-13 36.58125 38.0 38.0 38.0 34.0 38.0 14-15 36.693375 38.0 38.0 38.0 34.0 38.0 16-17 36.647000000000006 38.0 38.0 38.0 34.0 38.0 18-19 36.725875 38.0 38.0 38.0 34.0 38.0 20-21 36.604 38.0 38.0 38.0 34.0 38.0 22-23 36.642624999999995 38.0 38.0 38.0 34.0 38.0 24-25 36.56325 38.0 38.0 38.0 34.0 38.0 26-27 36.571125 38.0 38.0 38.0 34.0 38.0 28-29 36.642624999999995 38.0 38.0 38.0 34.0 38.0 30-31 36.657624999999996 38.0 38.0 38.0 34.0 38.0 32-33 36.509874999999994 38.0 38.0 38.0 34.0 38.0 34-35 36.41825 38.0 38.0 38.0 33.5 38.0 36-37 36.45525 38.0 38.0 38.0 34.0 38.0 38-39 36.351124999999996 38.0 38.0 38.0 33.0 38.0 40-41 36.428625 38.0 38.0 38.0 33.5 38.0 42-43 36.538375 38.0 38.0 38.0 34.0 38.0 44-45 36.468125 38.0 38.0 38.0 34.0 38.0 46-47 36.400999999999996 38.0 38.0 38.0 33.5 38.0 48-49 36.562 38.0 38.0 38.0 34.0 38.0 50-51 36.617000000000004 38.0 38.0 38.0 34.0 38.0 52-53 36.543125 38.0 38.0 38.0 34.0 38.0 54-55 36.528375 38.0 38.0 38.0 34.0 38.0 56-57 36.517250000000004 38.0 38.0 38.0 33.5 38.0 58-59 36.366125 38.0 38.0 38.0 33.5 38.0 60-61 36.307500000000005 38.0 38.0 38.0 33.0 38.0 62-63 36.32925 38.0 38.0 38.0 33.0 38.0 64-65 36.170625 38.0 38.0 38.0 33.0 38.0 66-67 36.300625 38.0 37.5 38.0 33.5 38.0 68-69 36.435874999999996 38.0 38.0 38.0 34.0 38.0 70-71 36.376125 38.0 38.0 38.0 34.0 38.0 72-73 36.414249999999996 38.0 38.0 38.0 33.5 38.0 74-75 36.076125000000005 38.0 38.0 38.0 33.0 38.0 76-77 36.181375 38.0 38.0 38.0 33.0 38.0 78-79 36.209999999999994 38.0 38.0 38.0 33.0 38.0 80-81 36.141 38.0 38.0 38.0 33.0 38.0 82-83 36.04325 38.0 37.5 38.0 32.0 38.0 84-85 35.964124999999996 38.0 37.0 38.0 32.0 38.0 86-87 35.716875 38.0 37.0 38.0 31.0 38.0 88-89 35.883875 38.0 37.0 38.0 32.0 38.0 90-91 36.050875000000005 38.0 38.0 38.0 33.0 38.0 92-93 35.732124999999996 38.0 37.0 38.0 31.5 38.0 94-95 35.686125000000004 38.0 37.0 38.0 31.0 38.0 96-97 35.738749999999996 38.0 37.0 38.0 31.0 38.0 98-99 35.300875 38.0 36.5 38.0 28.5 38.0 100-101 35.463625 38.0 36.5 38.0 30.0 38.0 102-103 35.411874999999995 38.0 36.5 38.0 30.0 38.0 104-105 35.678250000000006 38.0 37.0 38.0 31.0 38.0 106-107 35.314375 38.0 36.5 38.0 29.5 38.0 108-109 35.199625 38.0 36.0 38.0 28.5 38.0 110-111 35.116 38.0 36.0 38.0 28.5 38.0 112-113 35.120625000000004 38.0 36.0 38.0 28.5 38.0 114-115 35.009249999999994 38.0 36.0 38.0 28.0 38.0 116-117 34.79325 38.0 35.5 38.0 26.0 38.0 118-119 34.99787499999999 38.0 36.0 38.0 28.5 38.0 120-121 34.61175 38.0 35.5 38.0 26.5 38.0 122-123 34.759874999999994 38.0 36.0 38.0 28.0 38.0 124-125 34.190625 38.0 35.5 38.0 26.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 1.0 16 1.0 17 2.0 18 6.0 19 4.0 20 6.0 21 8.0 22 10.0 23 7.0 24 15.0 25 12.0 26 26.0 27 31.0 28 41.0 29 64.0 30 72.0 31 122.0 32 124.0 33 147.0 34 202.0 35 263.0 36 484.0 37 2349.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.15 13.025 9.975000000000001 35.85 2 33.1 18.025 26.950000000000003 21.925 3 29.299999999999997 23.225 19.25 28.225 4 31.95 28.849999999999998 16.625 22.575 5 30.225 30.925000000000004 19.325 19.525000000000002 6 23.849999999999998 33.95 19.725 22.475 7 23.025000000000002 16.25 37.05 23.674999999999997 8 24.975 20.724999999999998 23.025000000000002 31.275 9 24.275 18.975 27.224999999999998 29.525000000000002 10-11 27.950000000000003 27.987499999999997 18.55 25.5125 12-13 25.324999999999996 21.987499999999997 24.337500000000002 28.349999999999998 14-15 25.2875 23.25 24.65 26.8125 16-17 26.987499999999997 23.05 23.125 26.8375 18-19 27.3375 22.5625 23.1875 26.9125 20-21 26.575 23.125 22.5125 27.787499999999998 22-23 27.3625 23.875 23.0 25.7625 24-25 26.8375 24.075 22.3375 26.75 26-27 27.175 23.474999999999998 23.1375 26.2125 28-29 27.075 23.525 22.400000000000002 27.0 30-31 26.3 22.475 23.775 27.450000000000003 32-33 26.450000000000003 23.35 23.075000000000003 27.125 34-35 26.775 23.6125 23.674999999999997 25.937500000000004 36-37 27.0 23.5125 22.412499999999998 27.075 38-39 27.0125 23.1875 23.1375 26.6625 40-41 26.075 22.875 23.4375 27.6125 42-43 26.825 23.3625 23.125 26.687499999999996 44-45 26.8125 23.0875 22.8625 27.237499999999997 46-47 27.0125 23.7 22.5 26.787499999999998 48-49 25.424999999999997 23.5625 22.6 28.4125 50-51 26.625 23.974999999999998 22.3875 27.0125 52-53 26.724999999999998 23.3 22.8125 27.1625 54-55 27.1125 23.2125 22.55 27.125 56-57 26.1625 22.85 24.1875 26.8 58-59 26.8 24.0375 22.6875 26.474999999999998 60-61 27.150000000000002 23.6375 22.675 26.5375 62-63 27.125 22.9375 23.1875 26.75 64-65 27.0125 22.8125 23.599999999999998 26.575 66-67 26.087500000000002 23.3375 22.925 27.650000000000002 68-69 27.0125 23.1375 22.7625 27.0875 70-71 27.400000000000002 23.275000000000002 21.762500000000003 27.5625 72-73 26.75 22.775000000000002 23.325000000000003 27.150000000000002 74-75 27.0625 23.2125 22.662499999999998 27.0625 76-77 26.6125 23.3125 22.787499999999998 27.287499999999998 78-79 25.924999999999997 23.8375 22.4375 27.800000000000004 80-81 26.75 23.65 22.625 26.974999999999998 82-83 27.150000000000002 22.675 22.8875 27.287499999999998 84-85 26.674999999999997 23.325000000000003 22.7375 27.2625 86-87 26.987499999999997 22.5875 23.674999999999997 26.75 88-89 26.8125 22.9625 23.4875 26.737499999999997 90-91 27.1375 23.1625 22.3375 27.3625 92-93 27.400000000000002 22.7375 23.4375 26.424999999999997 94-95 26.700000000000003 22.412499999999998 23.5875 27.3 96-97 27.237499999999997 22.25 23.5875 26.924999999999997 98-99 27.0625 21.6 24.1625 27.175 100-101 27.3125 22.5125 23.0625 27.1125 102-103 27.3375 23.200000000000003 22.8125 26.650000000000002 104-105 27.4125 22.125 23.2625 27.200000000000003 106-107 26.974999999999998 23.775 22.25 27.0 108-109 27.3625 22.7375 23.150000000000002 26.75 110-111 27.6875 22.575 22.775000000000002 26.9625 112-113 27.250000000000004 21.987499999999997 23.5875 27.175 114-115 27.05 23.200000000000003 22.6125 27.1375 116-117 26.9125 22.412499999999998 22.925 27.750000000000004 118-119 26.6125 22.975 23.2375 27.175 120-121 27.150000000000002 23.3875 22.8 26.6625 122-123 26.25 23.45 23.4875 26.8125 124-125 27.3875 23.425 22.412499999999998 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 1.0 23 1.0 24 0.5 25 2.0 26 2.0 27 2.5 28 4.5 29 4.5 30 7.0 31 9.5 32 12.5 33 17.0 34 22.0 35 27.5 36 35.5 37 49.0 38 57.0 39 66.0 40 84.5 41 102.0 42 117.0 43 135.0 44 152.0 45 159.0 46 154.5 47 153.0 48 143.5 49 129.0 50 118.0 51 107.0 52 93.0 53 92.5 54 110.0 55 95.0 56 76.5 57 79.5 58 81.0 59 83.0 60 85.5 61 88.5 62 85.0 63 88.5 64 96.0 65 94.5 66 95.0 67 87.5 68 78.5 69 82.0 70 83.5 71 78.5 72 66.0 73 53.0 74 47.5 75 44.5 76 37.5 77 29.5 78 22.0 79 12.0 80 12.0 81 15.0 82 11.0 83 6.5 84 3.0 85 1.0 86 1.5 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2508151492350138 0.5 3 0.0 0.0 4 0.025081514923501375 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662589 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662589_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.30825 33.0 32.0 34.0 25.0 34.0 2 31.406 33.0 32.0 34.0 25.0 34.0 3 31.37525 33.0 32.0 34.0 25.0 34.0 4 31.3125 33.0 32.0 34.0 27.0 34.0 5 31.4925 33.0 32.0 34.0 27.0 34.0 6 34.97325 38.0 36.0 38.0 27.0 38.0 7 35.19675 38.0 36.0 38.0 28.0 38.0 8 34.73025 38.0 36.0 38.0 26.0 38.0 9 35.33125 38.0 36.0 38.0 28.0 38.0 10-11 35.091875 38.0 36.0 38.0 27.0 38.0 12-13 35.304375 38.0 36.0 38.0 28.0 38.0 14-15 34.94225 38.0 36.0 38.0 26.5 38.0 16-17 35.283125 38.0 36.0 38.0 27.5 38.0 18-19 35.1355 38.0 36.0 38.0 27.5 38.0 20-21 34.69325 38.0 35.0 38.0 26.0 38.0 22-23 35.293625000000006 38.0 36.0 38.0 27.5 38.0 24-25 35.327125 38.0 36.5 38.0 27.5 38.0 26-27 34.861999999999995 38.0 36.0 38.0 25.0 38.0 28-29 35.368624999999994 38.0 36.0 38.0 28.0 38.0 30-31 35.027625 38.0 36.0 38.0 26.0 38.0 32-33 34.802 38.0 35.5 38.0 26.0 38.0 34-35 34.863749999999996 38.0 36.0 38.0 25.0 38.0 36-37 35.093375 38.0 36.0 38.0 27.0 38.0 38-39 34.4345 38.0 35.0 38.0 24.0 38.0 40-41 34.818 38.0 35.5 38.0 26.0 38.0 42-43 35.15775 38.0 36.0 38.0 27.0 38.0 44-45 34.85325 38.0 35.5 38.0 26.0 38.0 46-47 35.299625 38.0 36.0 38.0 27.5 38.0 48-49 35.3095 38.0 36.0 38.0 27.5 38.0 50-51 35.457 38.0 37.0 38.0 28.0 38.0 52-53 35.4725 38.0 36.5 38.0 28.5 38.0 54-55 35.601375000000004 38.0 37.0 38.0 29.0 38.0 56-57 35.62325 38.0 36.5 38.0 29.0 38.0 58-59 35.388125 38.0 36.5 38.0 28.0 38.0 60-61 35.500625 38.0 36.5 38.0 28.5 38.0 62-63 35.528125 38.0 37.0 38.0 28.5 38.0 64-65 35.227625 38.0 36.0 38.0 27.5 38.0 66-67 35.37025 38.0 36.0 38.0 27.5 38.0 68-69 35.51175 38.0 36.5 38.0 29.0 38.0 70-71 35.41825 38.0 36.0 38.0 28.5 38.0 72-73 35.472875 38.0 36.5 38.0 28.5 38.0 74-75 34.985125 38.0 35.5 38.0 26.0 38.0 76-77 35.359125 38.0 36.0 38.0 28.5 38.0 78-79 35.5035 38.0 36.5 38.0 29.5 38.0 80-81 35.391 38.0 36.0 38.0 28.5 38.0 82-83 35.255750000000006 38.0 36.0 38.0 28.0 38.0 84-85 35.496375 38.0 37.0 38.0 29.0 38.0 86-87 35.207499999999996 38.0 36.5 38.0 28.0 38.0 88-89 35.355000000000004 38.0 36.0 38.0 29.0 38.0 90-91 34.965375 38.0 36.0 38.0 26.5 38.0 92-93 35.12875 38.0 36.0 38.0 27.5 38.0 94-95 34.928875000000005 38.0 35.5 38.0 26.0 38.0 96-97 35.007875 38.0 35.5 38.0 26.5 38.0 98-99 34.793625 38.0 35.5 38.0 25.5 38.0 100-101 35.025499999999994 38.0 36.0 38.0 27.0 38.0 102-103 34.88525 38.0 35.5 38.0 26.5 38.0 104-105 34.690375 38.0 35.0 38.0 25.0 38.0 106-107 34.68025 38.0 35.5 38.0 24.5 38.0 108-109 34.517375 38.0 35.0 38.0 24.5 38.0 110-111 34.778625000000005 38.0 35.5 38.0 26.0 38.0 112-113 34.590625 38.0 35.0 38.0 24.5 38.0 114-115 34.735875 38.0 35.0 38.0 27.0 38.0 116-117 34.49575 38.0 35.0 38.0 24.5 38.0 118-119 34.476375000000004 38.0 35.0 38.0 24.5 38.0 120-121 34.161874999999995 38.0 35.0 38.0 23.0 38.0 122-123 34.063125 38.0 35.0 38.0 23.0 38.0 124-125 33.716625 38.0 35.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 1.0 15 6.0 16 4.0 17 9.0 18 8.0 19 11.0 20 17.0 21 15.0 22 24.0 23 42.0 24 40.0 25 45.0 26 71.0 27 68.0 28 90.0 29 71.0 30 127.0 31 93.0 32 139.0 33 165.0 34 197.0 35 274.0 36 445.0 37 2033.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.349999999999994 12.125 10.4 36.125 2 31.624999999999996 18.099999999999998 28.050000000000004 22.225 3 28.799999999999997 23.45 20.200000000000003 27.55 4 31.900000000000002 29.349999999999998 16.75 22.0 5 30.075000000000003 30.475 18.375 21.075 6 22.25 33.7 21.125 22.925 7 21.925 15.9 37.025000000000006 25.15 8 23.724999999999998 18.875 24.8 32.6 9 25.575 19.25 25.8 29.375 10-11 27.9375 28.512500000000003 18.862499999999997 24.6875 12-13 25.724999999999998 21.6 25.75 26.924999999999997 14-15 26.737499999999997 22.3625 24.474999999999998 26.424999999999997 16-17 26.650000000000002 22.8375 23.799999999999997 26.7125 18-19 26.387500000000003 23.150000000000002 23.549999999999997 26.9125 20-21 26.5125 23.3375 22.8375 27.3125 22-23 27.0 24.3625 22.6 26.0375 24-25 26.5125 24.075 22.900000000000002 26.5125 26-27 26.8625 23.95 22.45 26.737499999999997 28-29 27.3375 22.9375 23.0875 26.637499999999996 30-31 26.174999999999997 23.9875 22.4875 27.35 32-33 26.575 23.35 23.200000000000003 26.875 34-35 27.0125 23.7375 22.7375 26.5125 36-37 27.1625 23.175 22.925 26.737499999999997 38-39 27.175 22.375 23.4625 26.987499999999997 40-41 27.3875 22.912499999999998 22.650000000000002 27.05 42-43 27.800000000000004 22.725 23.1 26.375 44-45 27.700000000000003 23.0 23.325000000000003 25.974999999999998 46-47 26.950000000000003 24.224999999999998 22.475 26.35 48-49 27.8375 23.0 22.112499999999997 27.05 50-51 26.400000000000002 24.825 22.8625 25.912499999999998 52-53 27.037499999999998 23.1375 23.3375 26.487500000000004 54-55 26.325 23.2375 23.825 26.6125 56-57 26.137500000000003 23.3625 23.175 27.325 58-59 27.3125 22.625 23.1375 26.924999999999997 60-61 26.625 23.05 22.5625 27.762500000000003 62-63 27.1625 23.35 23.075000000000003 26.4125 64-65 26.8125 23.2375 22.5 27.450000000000003 66-67 26.487500000000004 22.7375 24.125 26.650000000000002 68-69 27.287499999999998 23.6625 22.0875 26.9625 70-71 27.437499999999996 22.8625 23.1625 26.5375 72-73 27.425 22.625 23.35 26.6 74-75 27.474999999999998 22.537499999999998 23.4125 26.575 76-77 27.8625 22.275 23.474999999999998 26.387500000000003 78-79 26.650000000000002 22.7375 22.8875 27.725 80-81 26.85 23.25 22.4375 27.462500000000002 82-83 27.9375 22.3 23.0875 26.674999999999997 84-85 26.275 22.1375 24.325 27.2625 86-87 26.2875 23.25 22.4375 28.025 88-89 26.887499999999996 23.1625 22.9875 26.9625 90-91 26.974999999999998 22.875 22.9875 27.1625 92-93 26.2625 23.3125 23.35 27.075 94-95 26.200000000000003 23.0875 23.3875 27.325 96-97 27.200000000000003 22.7375 23.3875 26.674999999999997 98-99 26.087500000000002 22.375 23.35 28.1875 100-101 27.500000000000004 22.525000000000002 22.8125 27.1625 102-103 26.35 23.150000000000002 23.0125 27.487499999999997 104-105 27.2625 22.7375 22.8 27.200000000000003 106-107 27.0125 23.1875 22.537499999999998 27.2625 108-109 27.075 23.075000000000003 22.7375 27.1125 110-111 26.737499999999997 22.650000000000002 23.799999999999997 26.8125 112-113 26.125 23.6125 23.3 26.9625 114-115 27.200000000000003 22.662499999999998 23.1 27.037499999999998 116-117 26.5625 23.3 23.075000000000003 27.0625 118-119 27.6375 22.8875 22.900000000000002 26.575 120-121 27.0625 23.3625 22.9375 26.637499999999996 122-123 27.224999999999998 22.787499999999998 22.650000000000002 27.3375 124-125 27.537499999999998 23.625 23.075000000000003 25.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 1.5 23 0.5 24 0.5 25 0.5 26 1.5 27 3.0 28 3.0 29 8.0 30 9.5 31 6.5 32 8.5 33 14.5 34 17.5 35 27.0 36 46.0 37 57.0 38 67.0 39 84.5 40 98.0 41 110.5 42 125.0 43 132.0 44 140.0 45 147.5 46 142.0 47 134.0 48 119.5 49 120.5 50 121.5 51 113.5 52 109.5 53 91.0 54 85.0 55 97.0 56 101.0 57 89.0 58 83.0 59 92.5 60 95.5 61 92.0 62 93.5 63 90.0 64 91.0 65 87.5 66 86.0 67 89.0 68 70.0 69 64.5 70 71.5 71 71.0 72 60.0 73 48.0 74 52.0 75 50.0 76 39.5 77 28.5 78 24.0 79 21.0 80 19.0 81 15.5 82 9.5 83 7.0 84 3.5 85 2.5 86 2.0 87 1.0 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604007 spots for SRR13662589.sra Written 604007 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra Read 604005 spots for SRR13662589.sra Written 604005 spots for SRR13662589.sra SRR ids: ['SRR13662589.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4hsa4rm7 SRR13662589.sra spots: 12080102 blocks: [[1, 604005], [604006, 1208010], [1208011, 1812015], [1812016, 2416020], [2416021, 3020025], [3020026, 3624030], [3624031, 4228035], [4228036, 4832040], [4832041, 5436045], [5436046, 6040050], [6040051, 6644055], [6644056, 7248060], [7248061, 7852065], [7852066, 8456070], [8456071, 9060075], [9060076, 9664080], [9664081, 10268085], [10268086, 10872090], [10872091, 11476095], [11476096, 12080102]] SRR13662589 file size 3470204 SRR13662589 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662589 SRR13662589_1.fastq SRR13662589_2.fastq Input file: SRR13662589_1.fastq Paired file: SRR13662589_2.fastq trimmed: SRR13662589-trimmed-pair1.fastq, SRR13662589-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:39:04 2024 >> started Tue Dec 10 07:39:16 2024 >> done (11.912s) 12080102 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 53 ( 0.00%) empty read pairs filtered out after trimming by size control 12080049 (100.00%) read pairs available; of these: 1467847 (12.15%) trimmed read pairs available after processing 10612202 (87.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 0 0.00% 33 1 0.00% 34 0 0.00% 35 1 0.00% 36 1 0.00% 37 1 0.00% 38 0 0.00% 39 2 0.00% 40 0 0.00% 41 1 0.00% 42 1 0.00% 43 1 0.00% 44 0 0.00% 45 0 0.00% 46 1 0.00% 47 1 0.00% 48 0 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 1 0.00% 53 0 0.00% 54 1 0.00% 55 2 0.00% 56 3 0.00% 57 1 0.00% 58 2 0.00% 59 4 0.00% 60 7 0.00% 61 2 0.00% 62 5 0.00% 63 26 0.00% 64 66 0.00% 65 78 0.00% 66 80 0.00% 67 95 0.00% 68 142 0.00% 69 157 0.00% 70 193 0.00% 71 236 0.00% 72 226 0.00% 73 273 0.00% 74 256 0.00% 75 354 0.00% 76 359 0.00% 77 408 0.00% 78 426 0.00% 79 506 0.00% 80 487 0.00% 81 558 0.00% 82 612 0.01% 83 651 0.01% 84 692 0.01% 85 783 0.01% 86 823 0.01% 87 922 0.01% 88 1004 0.01% 89 1033 0.01% 90 1152 0.01% 91 1347 0.01% 92 1631 0.01% 93 2007 0.02% 94 5040 0.04% 95 5298 0.04% 96 5548 0.05% 97 5820 0.05% 98 5980 0.05% 99 6323 0.05% 100 6562 0.05% 101 7007 0.06% 102 7300 0.06% 103 7504 0.06% 104 7889 0.07% 105 8272 0.07% 106 8714 0.07% 107 9358 0.08% 108 9900 0.08% 109 10529 0.09% 110 11516 0.10% 111 12563 0.10% 112 13582 0.11% 113 15145 0.13% 114 16974 0.14% 115 19505 0.16% 116 34539 0.29% 117 39260 0.32% 118 46457 0.38% 119 56309 0.47% 120 69643 0.58% 121 91713 0.76% 122 135086 1.12% 123 222486 1.84% 124 548396 4.54% 125 10612202 87.85% 12080049 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.01 fanout-score-rank=19 prefix-density=0.23 prefix-fanout=3.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=194.33 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=20.9 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=18 prefix-density=0.23 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=13 fanout-score=206.84 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=21.6 sequence=CCGCCGCCGCCG SRR13662589 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:40:00 Started mapping on | Dec 10 07:40:00 Finished on | Dec 10 07:40:49 Mapping speed, Million of reads per hour | 887.51 Number of input reads | 12080049 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 11491377 Uniquely mapped reads % | 95.13% Average mapped length | 246.55 Number of splices: Total | 8719296 Number of splices: Annotated (sjdb) | 8191790 Number of splices: GT/AG | 8599834 Number of splices: GC/AG | 97653 Number of splices: AT/AC | 4027 Number of splices: Non-canonical | 17782 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214196 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 15243 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.25% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 374539 374539 374539 N_multimapping 214196 214196 214196 N_noFeature 386777 5832718 5835048 N_ambiguous 263254 28261 28205 UnstrandedReadsAssigned:10841346 PositiveStrandReadsAssigned:5630398 NegativeStrandReadsAssigned:5628124 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662589 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662589-trimmed-pair1.fastq SRR13662589-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,080,049 reads, 11,201,249 reads pseudoaligned [quant] estimated average fragment length: 201.584 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52973 SRR13662589.ke.tsv 35125 SRR13662589.se.tsv 88098 total ==> SRR13662589.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 735.788 0 0 PNS24247 1044 843.416 31.5471 4.39884 PNS24249 1928 1727.42 156.773 10.6732 PNS24246 1044 843.416 31.5471 4.39884 PNS24248 1044 843.416 31.5471 4.39884 PNS24244 1471 1270.42 22.5856 2.09077 PNS24243 293 100.515 10 11.7001 KQK14069 1603 1402.42 6767.92 567.543 KQK14071 474 275.818 1183.26 504.52 ==> SRR13662589.se.tsv <== BRADI_1g14170v3 8661 BRADI_1g53295v3 20 BRADI_1g59795v3 391 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 154 BRADI_1g74790v3 171 BRADI_1g09890v3 0 BRADI_1g77505v3 218 BRADI_1g48960v3 0 SRR13662589 completed mapping pipeline successfully