Starting /dee2/code/volunteer_pipeline.sh SRR13662590 current disk space = 1526714150912 free memory = 1431047072 SRR13662590 SRAfilesize e83583a6ad128926ec04923c903404c7 SRR13662590.sra SRR13662590.sra file validated SRR13662590 is paired end SRR13662590 is conventional basespace SRR13662590 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662590_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50275 33.0 33.0 34.0 31.0 34.0 2 32.672 34.0 33.0 34.0 32.0 34.0 3 32.617 34.0 33.0 34.0 31.0 34.0 4 32.57275 34.0 33.0 34.0 31.0 34.0 5 32.606 34.0 33.0 34.0 31.0 34.0 6 36.23 38.0 36.0 38.0 33.0 38.0 7 36.61525 38.0 37.0 38.0 34.0 38.0 8 36.8265 38.0 38.0 38.0 34.0 38.0 9 36.877 38.0 38.0 38.0 35.0 38.0 10-11 36.93375 38.0 38.0 38.0 35.5 38.0 12-13 36.960125000000005 38.0 38.0 38.0 35.0 38.0 14-15 36.900000000000006 38.0 38.0 38.0 35.0 38.0 16-17 36.928125 38.0 38.0 38.0 35.5 38.0 18-19 36.921 38.0 38.0 38.0 35.0 38.0 20-21 36.942 38.0 38.0 38.0 35.0 38.0 22-23 36.946 38.0 38.0 38.0 35.0 38.0 24-25 36.887875 38.0 38.0 38.0 35.0 38.0 26-27 36.927375 38.0 38.0 38.0 35.0 38.0 28-29 36.816 38.0 38.0 38.0 35.0 38.0 30-31 36.82825 38.0 38.0 38.0 35.0 38.0 32-33 36.817750000000004 38.0 38.0 38.0 35.0 38.0 34-35 36.829875 38.0 38.0 38.0 35.0 38.0 36-37 36.849500000000006 38.0 38.0 38.0 35.0 38.0 38-39 36.732375000000005 38.0 38.0 38.0 34.5 38.0 40-41 36.832875 38.0 38.0 38.0 35.0 38.0 42-43 36.773375 38.0 38.0 38.0 34.5 38.0 44-45 36.710375 38.0 38.0 38.0 34.0 38.0 46-47 36.757125 38.0 38.0 38.0 34.5 38.0 48-49 36.763374999999996 38.0 38.0 38.0 35.0 38.0 50-51 36.766999999999996 38.0 38.0 38.0 35.0 38.0 52-53 36.642125 38.0 38.0 38.0 34.0 38.0 54-55 36.693 38.0 38.0 38.0 34.0 38.0 56-57 36.651375 38.0 38.0 38.0 34.0 38.0 58-59 36.577749999999995 38.0 38.0 38.0 34.0 38.0 60-61 36.63575 38.0 38.0 38.0 34.0 38.0 62-63 36.571875000000006 38.0 38.0 38.0 34.0 38.0 64-65 36.659625000000005 38.0 38.0 38.0 34.0 38.0 66-67 36.564 38.0 38.0 38.0 34.0 38.0 68-69 36.518 38.0 38.0 38.0 34.0 38.0 70-71 36.585125 38.0 38.0 38.0 34.0 38.0 72-73 36.455124999999995 38.0 38.0 38.0 34.0 38.0 74-75 36.48375 38.0 38.0 38.0 34.0 38.0 76-77 36.492374999999996 38.0 38.0 38.0 34.0 38.0 78-79 36.400999999999996 38.0 38.0 38.0 34.0 38.0 80-81 36.376125 38.0 38.0 38.0 34.0 38.0 82-83 36.366625 38.0 38.0 38.0 34.0 38.0 84-85 36.33075 38.0 38.0 38.0 34.0 38.0 86-87 36.27425 38.0 38.0 38.0 33.5 38.0 88-89 36.150125 38.0 38.0 38.0 33.0 38.0 90-91 36.170500000000004 38.0 38.0 38.0 33.0 38.0 92-93 36.116749999999996 38.0 38.0 38.0 33.0 38.0 94-95 36.093875 38.0 38.0 38.0 33.0 38.0 96-97 36.07425 38.0 38.0 38.0 33.0 38.0 98-99 36.105374999999995 38.0 38.0 38.0 33.0 38.0 100-101 35.974875 38.0 37.5 38.0 32.5 38.0 102-103 35.99525 38.0 37.0 38.0 33.0 38.0 104-105 35.989000000000004 38.0 37.5 38.0 33.0 38.0 106-107 35.849875 38.0 37.0 38.0 32.5 38.0 108-109 35.83175 38.0 37.0 38.0 32.0 38.0 110-111 35.587 38.0 37.0 38.0 31.0 38.0 112-113 35.696625 38.0 37.0 38.0 31.0 38.0 114-115 35.7795 38.0 37.0 38.0 32.5 38.0 116-117 35.526624999999996 38.0 36.0 38.0 31.0 38.0 118-119 35.43275 38.0 36.0 38.0 31.0 38.0 120-121 35.366375 38.0 36.0 38.0 31.0 38.0 122-123 35.19825 38.0 36.0 38.0 31.0 38.0 124-125 34.930875 38.0 36.0 38.0 31.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 1.0 18 3.0 19 3.0 20 6.0 21 6.0 22 7.0 23 9.0 24 10.0 25 22.0 26 13.0 27 29.0 28 41.0 29 45.0 30 55.0 31 70.0 32 101.0 33 107.0 34 145.0 35 280.0 36 468.0 37 2577.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.9 12.15 10.274999999999999 35.675000000000004 2 31.175000000000004 18.65 28.65 21.525 3 28.349999999999998 23.799999999999997 20.275000000000002 27.575 4 30.625000000000004 30.075000000000003 16.175 23.125 5 30.425 30.425 19.275000000000002 19.875 6 22.95 34.150000000000006 19.8 23.1 7 20.849999999999998 16.85 36.5 25.8 8 23.125 20.849999999999998 25.1 30.925000000000004 9 24.375 20.025000000000002 26.650000000000002 28.95 10-11 27.525 28.462500000000002 19.162499999999998 24.85 12-13 24.8 22.15 25.974999999999998 27.075 14-15 25.7625 22.3 24.725 27.212500000000002 16-17 25.95 23.225 24.0625 26.7625 18-19 26.275 23.6375 23.549999999999997 26.5375 20-21 25.924999999999997 23.325000000000003 24.2 26.55 22-23 26.2875 24.0125 23.225 26.474999999999998 24-25 26.6625 23.3875 23.275000000000002 26.674999999999997 26-27 26.450000000000003 24.0 23.4875 26.0625 28-29 26.150000000000002 23.2875 23.5625 27.0 30-31 25.7125 24.075 23.375 26.8375 32-33 26.625 23.7625 23.5875 26.025 34-35 26.875 24.087500000000002 23.1875 25.85 36-37 26.674999999999997 25.424999999999997 22.112499999999997 25.7875 38-39 26.687499999999996 23.6625 23.1 26.55 40-41 26.875 23.525 22.6375 26.9625 42-43 26.525 23.0 23.6375 26.8375 44-45 25.3125 24.55 23.225 26.9125 46-47 26.55 24.2 22.6375 26.6125 48-49 26.474999999999998 22.575 24.224999999999998 26.724999999999998 50-51 26.3 23.7375 23.25 26.7125 52-53 26.5125 23.5125 22.7625 27.212500000000002 54-55 26.700000000000003 23.65 22.3375 27.3125 56-57 25.912499999999998 23.3125 23.549999999999997 27.224999999999998 58-59 25.887500000000003 24.3625 23.1375 26.6125 60-61 26.5625 22.900000000000002 23.3875 27.150000000000002 62-63 26.9625 23.2875 23.962500000000002 25.7875 64-65 26.85 23.65 22.475 27.025 66-67 26.1125 23.025000000000002 23.25 27.6125 68-69 26.0 23.375 23.5125 27.1125 70-71 25.974999999999998 22.5125 24.1125 27.400000000000002 72-73 26.1625 23.9875 23.2125 26.637499999999996 74-75 26.6125 22.6375 24.075 26.674999999999997 76-77 26.625 23.674999999999997 23.2625 26.437500000000004 78-79 27.1625 23.125 22.112499999999997 27.6 80-81 25.650000000000002 23.4375 23.275000000000002 27.6375 82-83 26.787499999999998 23.1125 23.0375 27.0625 84-85 26.625 22.8875 23.2875 27.200000000000003 86-87 25.937500000000004 22.6375 23.2625 28.1625 88-89 26.5 22.675 23.474999999999998 27.35 90-91 26.724999999999998 22.8875 23.3625 27.025 92-93 27.0125 23.4625 23.0875 26.437500000000004 94-95 26.687499999999996 22.925 24.0 26.387500000000003 96-97 26.5625 22.575 23.3625 27.500000000000004 98-99 26.650000000000002 22.4375 24.8 26.1125 100-101 26.150000000000002 23.525 24.0125 26.3125 102-103 25.9875 23.7875 22.775000000000002 27.450000000000003 104-105 26.1 23.2375 23.8625 26.8 106-107 26.187500000000004 24.1875 22.7 26.924999999999997 108-109 26.724999999999998 23.200000000000003 22.525000000000002 27.55 110-111 26.187500000000004 23.5875 23.2375 26.987499999999997 112-113 26.1625 23.5375 23.275000000000002 27.025 114-115 27.437499999999996 23.3125 22.8125 26.437500000000004 116-117 26.7125 23.962500000000002 22.287499999999998 27.037499999999998 118-119 27.150000000000002 23.2375 23.2125 26.400000000000002 120-121 26.950000000000003 23.3875 23.4375 26.224999999999998 122-123 26.85 23.35 23.200000000000003 26.6 124-125 26.9125 23.0625 22.95 27.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 1.5 27 3.5 28 5.0 29 6.5 30 8.5 31 10.5 32 12.0 33 12.5 34 18.5 35 28.5 36 40.5 37 48.5 38 60.0 39 77.5 40 91.5 41 115.0 42 134.0 43 141.5 44 146.5 45 152.5 46 152.0 47 152.5 48 142.5 49 130.0 50 127.5 51 118.0 52 114.5 53 110.0 54 104.5 55 97.0 56 87.5 57 87.0 58 81.5 59 82.0 60 86.5 61 88.0 62 88.0 63 81.0 64 83.5 65 84.0 66 85.5 67 84.0 68 77.5 69 69.5 70 62.5 71 61.0 72 59.5 73 51.0 74 41.5 75 37.5 76 35.0 77 31.0 78 23.5 79 16.0 80 13.0 81 11.5 82 5.0 83 3.0 84 4.0 85 3.5 86 3.0 87 1.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACGGC 15 0.0040846216 59.5 108-109 >>END_MODULE SRR13662590 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662590_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.18125 33.0 33.0 34.0 31.0 34.0 2 32.28225 33.0 33.0 34.0 30.0 34.0 3 32.27975 33.0 33.0 34.0 31.0 34.0 4 32.1315 33.0 33.0 34.0 30.0 34.0 5 32.15775 33.0 33.0 34.0 31.0 34.0 6 36.21925 38.0 38.0 38.0 33.0 38.0 7 36.32975 38.0 38.0 38.0 33.0 38.0 8 36.165 38.0 38.0 38.0 33.0 38.0 9 36.2905 38.0 38.0 38.0 33.0 38.0 10-11 36.200374999999994 38.0 38.0 38.0 32.5 38.0 12-13 36.23325 38.0 38.0 38.0 33.0 38.0 14-15 36.149249999999995 38.0 38.0 38.0 33.0 38.0 16-17 36.254999999999995 38.0 38.0 38.0 33.0 38.0 18-19 36.1535 38.0 38.0 38.0 33.0 38.0 20-21 36.12875 38.0 38.0 38.0 32.0 38.0 22-23 36.1165 38.0 38.0 38.0 33.0 38.0 24-25 36.16575 38.0 37.5 38.0 33.0 38.0 26-27 36.241375000000005 38.0 38.0 38.0 33.0 38.0 28-29 36.201 38.0 38.0 38.0 33.0 38.0 30-31 36.285375 38.0 38.0 38.0 33.0 38.0 32-33 36.299499999999995 38.0 38.0 38.0 33.0 38.0 34-35 36.19625 38.0 38.0 38.0 33.0 38.0 36-37 36.133625 38.0 38.0 38.0 33.0 38.0 38-39 36.030249999999995 38.0 38.0 38.0 32.0 38.0 40-41 36.150000000000006 38.0 38.0 38.0 33.0 38.0 42-43 36.082625 38.0 37.5 38.0 32.5 38.0 44-45 36.147999999999996 38.0 37.5 38.0 33.0 38.0 46-47 36.16225 38.0 37.5 38.0 33.0 38.0 48-49 36.199875 38.0 38.0 38.0 33.0 38.0 50-51 36.206625 38.0 38.0 38.0 33.0 38.0 52-53 36.12925 38.0 38.0 38.0 32.0 38.0 54-55 36.086625 38.0 38.0 38.0 32.0 38.0 56-57 36.04 38.0 37.0 38.0 31.0 38.0 58-59 36.07362500000001 38.0 37.0 38.0 31.5 38.0 60-61 36.048249999999996 38.0 37.0 38.0 31.5 38.0 62-63 36.04975 38.0 37.0 38.0 32.0 38.0 64-65 36.002625 38.0 37.0 38.0 32.0 38.0 66-67 35.973375000000004 38.0 37.0 38.0 31.0 38.0 68-69 35.957375 38.0 37.0 38.0 32.0 38.0 70-71 36.00575 38.0 38.0 38.0 31.5 38.0 72-73 35.869749999999996 38.0 37.5 38.0 31.0 38.0 74-75 35.866875 38.0 37.0 38.0 31.0 38.0 76-77 35.811 38.0 37.0 38.0 31.0 38.0 78-79 35.750875 38.0 37.0 38.0 31.0 38.0 80-81 35.626999999999995 38.0 37.0 38.0 31.0 38.0 82-83 35.630875 38.0 37.0 38.0 30.5 38.0 84-85 35.5325 38.0 37.0 38.0 29.0 38.0 86-87 35.542125 38.0 37.0 38.0 30.0 38.0 88-89 35.489125 38.0 37.0 38.0 29.0 38.0 90-91 35.3995 38.0 37.0 38.0 29.0 38.0 92-93 35.409 38.0 37.0 38.0 29.0 38.0 94-95 35.38725 38.0 37.0 38.0 29.0 38.0 96-97 35.350125000000006 38.0 36.5 38.0 29.0 38.0 98-99 35.28375 38.0 36.5 38.0 29.0 38.0 100-101 35.242125 38.0 36.0 38.0 29.0 38.0 102-103 35.189125000000004 38.0 36.0 38.0 29.0 38.0 104-105 35.070750000000004 38.0 36.0 38.0 28.0 38.0 106-107 35.045375 38.0 36.0 38.0 28.0 38.0 108-109 35.03125 38.0 36.0 38.0 28.5 38.0 110-111 34.766 38.0 36.0 38.0 26.0 38.0 112-113 34.565 38.0 35.5 38.0 25.0 38.0 114-115 34.514624999999995 38.0 35.0 38.0 24.5 38.0 116-117 34.459374999999994 38.0 35.0 38.0 24.5 38.0 118-119 34.510875 38.0 35.5 38.0 24.5 38.0 120-121 34.293375 38.0 35.0 38.0 23.5 38.0 122-123 33.848124999999996 38.0 35.0 38.0 22.0 38.0 124-125 33.482 38.0 35.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 6.0 15 4.0 16 5.0 17 2.0 18 5.0 19 10.0 20 14.0 21 13.0 22 16.0 23 23.0 24 25.0 25 47.0 26 41.0 27 42.0 28 57.0 29 68.0 30 75.0 31 95.0 32 113.0 33 119.0 34 213.0 35 246.0 36 422.0 37 2337.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.8 12.975 10.274999999999999 35.949999999999996 2 31.424999999999997 18.775 27.825 21.975 3 28.499999999999996 24.125 20.125 27.250000000000004 4 32.65 28.975 15.15 23.225 5 30.25 31.025000000000002 18.15 20.575 6 23.474999999999998 34.599999999999994 19.35 22.575 7 21.5 16.1 36.975 25.424999999999997 8 23.825 18.975 24.95 32.25 9 25.15 19.775000000000002 26.35 28.725 10-11 26.5125 28.675 19.787499999999998 25.025 12-13 26.575 21.0625 25.324999999999996 27.037499999999998 14-15 25.8 22.35 24.425 27.425 16-17 26.650000000000002 22.875 23.875 26.6 18-19 26.150000000000002 23.2125 23.575 27.0625 20-21 26.075 23.3875 23.7 26.8375 22-23 26.437500000000004 24.075 22.6875 26.8 24-25 27.1 23.35 22.875 26.674999999999997 26-27 26.6 22.537499999999998 23.4375 27.425 28-29 26.625 23.05 22.975 27.35 30-31 26.9625 23.6375 23.0125 26.387500000000003 32-33 25.874999999999996 24.7375 23.45 25.937500000000004 34-35 25.775 23.7875 23.5625 26.875 36-37 26.775 23.3875 23.799999999999997 26.0375 38-39 26.825 23.05 22.162499999999998 27.962500000000002 40-41 26.7625 23.4375 23.2125 26.5875 42-43 25.9625 23.375 23.925 26.737499999999997 44-45 25.6 23.7125 24.0625 26.625 46-47 26.0375 23.225 23.3375 27.400000000000002 48-49 26.724999999999998 23.7 22.5625 27.0125 50-51 26.7625 23.3 23.4125 26.525 52-53 26.575 23.4625 23.1375 26.825 54-55 26.525 23.4375 23.3875 26.650000000000002 56-57 26.64083010376297 23.75296912114014 24.00300037504688 25.603200400050007 58-59 26.9625 23.5375 23.375 26.125 60-61 26.525 23.325000000000003 23.3625 26.787499999999998 62-63 26.5 23.575 23.1 26.825 64-65 26.406601650412604 23.69342335583896 23.093273318329583 26.806701675418854 66-67 26.95336917114639 23.29041130141268 23.302912864108013 26.453306663332913 68-69 26.637499999999996 23.8125 23.125 26.424999999999997 70-71 28.175 23.4875 22.525000000000002 25.8125 72-73 26.515814476809602 24.24053006625828 22.96537067133392 26.2782847855982 74-75 26.487500000000004 23.525 22.825 27.1625 76-77 26.325 24.0375 23.150000000000002 26.487500000000004 78-79 26.737499999999997 23.8625 22.662499999999998 26.737499999999997 80-81 27.487499999999997 24.875 21.637500000000003 26.0 82-83 27.750000000000004 23.275000000000002 22.8 26.174999999999997 84-85 26.400000000000002 23.1625 23.5 26.937499999999996 86-87 26.674999999999997 22.8375 23.7125 26.775 88-89 27.400000000000002 23.45 23.1125 26.0375 90-91 26.950000000000003 23.4625 22.425 27.1625 92-93 25.324999999999996 23.5875 23.7375 27.35 94-95 27.3875 22.55 23.0375 27.025 96-97 26.7125 23.775 22.662499999999998 26.85 98-99 26.174999999999997 22.5875 24.45 26.787499999999998 100-101 27.650000000000002 22.7 23.95 25.7 102-103 26.5125 23.375 23.8875 26.224999999999998 104-105 26.437500000000004 23.599999999999998 23.2875 26.674999999999997 106-107 27.450000000000003 22.7375 22.775000000000002 27.037499999999998 108-109 27.11651824909068 23.291107487771228 23.128057193026464 26.464317070111626 110-111 26.637390213299874 22.572145545796737 23.952321204516938 26.838143036386448 112-113 27.382753403933435 22.478567826525467 23.600605143721634 26.538073625819464 114-115 26.474278544542035 23.43789209535759 22.986198243412797 27.10163111668758 116-117 26.650000000000002 23.375 23.65 26.325 118-119 26.745058794095574 23.805354015511636 23.2424318238679 26.207155366524894 120-121 26.25656414103526 22.930732683170792 23.668417104276067 27.144286071517882 122-123 27.375 22.8875 23.4875 26.25 124-125 27.547830436413655 24.296611229210953 21.845692134550458 26.30986619982493 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.5 25 1.0 26 1.0 27 3.0 28 4.0 29 3.0 30 7.0 31 9.5 32 13.5 33 21.0 34 23.5 35 25.5 36 38.0 37 55.0 38 62.5 39 69.0 40 86.5 41 109.0 42 125.5 43 138.5 44 149.0 45 157.0 46 160.5 47 156.0 48 146.0 49 129.5 50 119.0 51 121.5 52 123.5 53 115.5 54 95.5 55 86.0 56 89.5 57 79.5 58 80.0 59 92.0 60 87.5 61 88.0 62 77.0 63 68.0 64 77.0 65 82.5 66 88.0 67 88.0 68 82.0 69 75.5 70 66.5 71 61.0 72 54.5 73 53.0 74 54.5 75 40.0 76 28.5 77 30.0 78 25.5 79 15.5 80 14.0 81 12.0 82 10.5 83 9.5 84 6.0 85 2.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0125 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0125 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.3375 110-111 0.375 112-113 0.8500000000000001 114-115 0.375 116-117 0.0 118-119 0.075 120-121 0.025 122-123 0.0 124-125 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717793 spots for SRR13662590.sra Written 717793 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra Read 717788 spots for SRR13662590.sra Written 717788 spots for SRR13662590.sra SRR ids: ['SRR13662590.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_joz6z1ed SRR13662590.sra spots: 14355765 blocks: [[1, 717788], [717789, 1435576], [1435577, 2153364], [2153365, 2871152], [2871153, 3588940], [3588941, 4306728], [4306729, 5024516], [5024517, 5742304], [5742305, 6460092], [6460093, 7177880], [7177881, 7895668], [7895669, 8613456], [8613457, 9331244], [9331245, 10049032], [10049033, 10766820], [10766821, 11484608], [11484609, 12202396], [12202397, 12920184], [12920185, 13637972], [13637973, 14355765]] SRR13662590 file size 4128012 SRR13662590 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662590 SRR13662590_1.fastq SRR13662590_2.fastq Input file: SRR13662590_1.fastq Paired file: SRR13662590_2.fastq trimmed: SRR13662590-trimmed-pair1.fastq, SRR13662590-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:49:21 2024 >> started Tue Dec 10 07:49:40 2024 >> done (19.336s) 14355765 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 117 ( 0.00%) empty read pairs filtered out after trimming by size control 14355647 (100.00%) read pairs available; of these: 1795001 (12.50%) trimmed read pairs available after processing 12560646 (87.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 2 0.00% 37 0 0.00% 38 2 0.00% 39 0 0.00% 40 3 0.00% 41 1 0.00% 42 1 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 0 0.00% 47 1 0.00% 48 0 0.00% 49 2 0.00% 50 1 0.00% 51 0 0.00% 52 2 0.00% 53 1 0.00% 54 1 0.00% 55 4 0.00% 56 2 0.00% 57 0 0.00% 58 2 0.00% 59 6 0.00% 60 8 0.00% 61 5 0.00% 62 5 0.00% 63 33 0.00% 64 53 0.00% 65 73 0.00% 66 98 0.00% 67 131 0.00% 68 148 0.00% 69 163 0.00% 70 203 0.00% 71 239 0.00% 72 261 0.00% 73 281 0.00% 74 344 0.00% 75 355 0.00% 76 458 0.00% 77 452 0.00% 78 459 0.00% 79 502 0.00% 80 573 0.00% 81 649 0.00% 82 670 0.00% 83 714 0.00% 84 724 0.01% 85 833 0.01% 86 862 0.01% 87 1034 0.01% 88 1075 0.01% 89 1238 0.01% 90 1465 0.01% 91 1566 0.01% 92 1859 0.01% 93 2368 0.02% 94 6229 0.04% 95 6562 0.05% 96 6945 0.05% 97 7300 0.05% 98 7635 0.05% 99 7967 0.06% 100 8164 0.06% 101 8374 0.06% 102 8984 0.06% 103 9787 0.07% 104 9639 0.07% 105 10470 0.07% 106 10976 0.08% 107 11357 0.08% 108 12210 0.09% 109 13373 0.09% 110 14362 0.10% 111 16196 0.11% 112 17497 0.12% 113 19544 0.14% 114 21941 0.15% 115 25021 0.17% 116 44317 0.31% 117 49310 0.34% 118 56521 0.39% 119 68977 0.48% 120 85707 0.60% 121 113914 0.79% 122 163439 1.14% 123 272182 1.90% 124 660165 4.60% 125 12560646 87.50% 14355647 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=114.23 fanout-score-rank=9 prefix-density=1.17 prefix-fanout=17.3 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=309.37 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=26.3 sequence=CGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGAGCTTGAGAGGGCACTGTAGCCAGTGTGTCAGTCGTTGTTAAATTACAGGTTGAGATCATCAGCGTACTCCGATG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=117.51 fanout-score-rank=9 prefix-density=1.16 prefix-fanout=17.5 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=326.55 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=26.8 sequence=CGCCGCCGCCGG SRR13662590 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:50:17 Started mapping on | Dec 10 07:50:18 Finished on | Dec 10 07:51:20 Mapping speed, Million of reads per hour | 833.55 Number of input reads | 14355647 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 13625915 Uniquely mapped reads % | 94.92% Average mapped length | 246.78 Number of splices: Total | 10431540 Number of splices: Annotated (sjdb) | 9785199 Number of splices: GT/AG | 10285768 Number of splices: GC/AG | 118292 Number of splices: AT/AC | 5002 Number of splices: Non-canonical | 22478 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271455 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 28187 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.99% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 458371 458371 458371 N_multimapping 271455 271455 271455 N_noFeature 514952 6942337 6944366 N_ambiguous 319066 34352 35127 UnstrandedReadsAssigned:12791897 PositiveStrandReadsAssigned:6649226 NegativeStrandReadsAssigned:6646422 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662590 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662590-trimmed-pair1.fastq SRR13662590-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,355,647 reads, 13,249,362 reads pseudoaligned [quant] estimated average fragment length: 204.428 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52973 SRR13662590.ke.tsv 35125 SRR13662590.se.tsv 88098 total ==> SRR13662590.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.802 0 0 PNS24247 1044 840.572 35.1071 4.16403 PNS24249 1928 1724.57 219.227 12.6738 PNS24246 1044 840.572 35.1071 4.16403 PNS24248 1044 840.572 35.1071 4.16403 PNS24244 1471 1267.57 45.4518 3.57497 PNS24243 293 98.4475 14 14.1781 KQK14069 1603 1399.57 9560.86 681.076 KQK14071 474 272.762 1525.07 557.443 ==> SRR13662590.se.tsv <== BRADI_1g14170v3 12128 BRADI_1g53295v3 22 BRADI_1g59795v3 542 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 160 BRADI_1g74790v3 164 BRADI_1g09890v3 1 BRADI_1g77505v3 267 BRADI_1g48960v3 0 SRR13662590 completed mapping pipeline successfully