Starting /dee2/code/volunteer_pipeline.sh SRR13662591 current disk space = 1526710718464 free memory = 1480210940 SRR13662591 SRAfilesize c10550bd19a682912479722c25eb677b SRR13662591.sra SRR13662591.sra file validated SRR13662591 is paired end SRR13662591 is conventional basespace SRR13662591 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662591_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4885 33.0 33.0 34.0 31.0 34.0 2 32.5305 34.0 33.0 34.0 31.0 34.0 3 32.5795 34.0 33.0 34.0 31.0 34.0 4 32.496 34.0 33.0 34.0 31.0 34.0 5 32.43975 34.0 33.0 34.0 31.0 34.0 6 35.94375 38.0 36.0 38.0 31.0 38.0 7 36.57375 38.0 37.0 38.0 34.0 38.0 8 36.672 38.0 38.0 38.0 34.0 38.0 9 36.8375 38.0 38.0 38.0 35.0 38.0 10-11 36.916125 38.0 38.0 38.0 35.0 38.0 12-13 36.88275 38.0 38.0 38.0 35.0 38.0 14-15 36.800625 38.0 38.0 38.0 34.5 38.0 16-17 36.92125 38.0 38.0 38.0 35.0 38.0 18-19 36.907375 38.0 38.0 38.0 35.0 38.0 20-21 36.93875 38.0 38.0 38.0 35.0 38.0 22-23 36.852125 38.0 38.0 38.0 35.0 38.0 24-25 36.826 38.0 38.0 38.0 35.0 38.0 26-27 36.842124999999996 38.0 38.0 38.0 35.0 38.0 28-29 36.791250000000005 38.0 38.0 38.0 35.0 38.0 30-31 36.717875 38.0 38.0 38.0 34.0 38.0 32-33 36.76375 38.0 38.0 38.0 34.5 38.0 34-35 36.80875 38.0 38.0 38.0 34.5 38.0 36-37 36.747625 38.0 38.0 38.0 34.5 38.0 38-39 36.724125 38.0 38.0 38.0 34.0 38.0 40-41 36.741875 38.0 38.0 38.0 34.5 38.0 42-43 36.679125 38.0 38.0 38.0 34.5 38.0 44-45 36.632125 38.0 38.0 38.0 34.0 38.0 46-47 36.661 38.0 38.0 38.0 34.0 38.0 48-49 36.678375 38.0 38.0 38.0 34.0 38.0 50-51 36.624125 38.0 38.0 38.0 34.0 38.0 52-53 36.56625 38.0 38.0 38.0 34.0 38.0 54-55 36.556625 38.0 38.0 38.0 34.0 38.0 56-57 36.61450000000001 38.0 38.0 38.0 34.0 38.0 58-59 36.548874999999995 38.0 38.0 38.0 34.0 38.0 60-61 36.466 38.0 38.0 38.0 34.0 38.0 62-63 36.5595 38.0 38.0 38.0 34.0 38.0 64-65 36.484625 38.0 38.0 38.0 34.0 38.0 66-67 36.48025 38.0 38.0 38.0 33.5 38.0 68-69 36.399875 38.0 38.0 38.0 33.5 38.0 70-71 36.448375 38.0 38.0 38.0 34.0 38.0 72-73 36.38825 38.0 38.0 38.0 33.5 38.0 74-75 36.461124999999996 38.0 38.0 38.0 34.0 38.0 76-77 36.457125000000005 38.0 38.0 38.0 34.0 38.0 78-79 36.297124999999994 38.0 38.0 38.0 33.0 38.0 80-81 36.26875 38.0 38.0 38.0 33.5 38.0 82-83 36.28975 38.0 38.0 38.0 33.5 38.0 84-85 36.255625 38.0 38.0 38.0 33.0 38.0 86-87 36.192125000000004 38.0 38.0 38.0 33.0 38.0 88-89 36.25875 38.0 38.0 38.0 33.0 38.0 90-91 36.154624999999996 38.0 38.0 38.0 33.0 38.0 92-93 36.10325 38.0 38.0 38.0 33.0 38.0 94-95 36.095124999999996 38.0 37.5 38.0 33.0 38.0 96-97 36.01075 38.0 37.0 38.0 33.0 38.0 98-99 35.948 38.0 37.0 38.0 32.0 38.0 100-101 35.929375 38.0 37.0 38.0 32.0 38.0 102-103 35.886624999999995 38.0 37.0 38.0 32.5 38.0 104-105 35.961875 38.0 37.0 38.0 33.0 38.0 106-107 35.785875000000004 38.0 37.0 38.0 31.0 38.0 108-109 35.706375 38.0 36.5 38.0 31.5 38.0 110-111 35.636125 38.0 36.5 38.0 31.0 38.0 112-113 35.597750000000005 38.0 36.0 38.0 31.0 38.0 114-115 35.59425 38.0 36.0 38.0 31.0 38.0 116-117 35.45325 38.0 36.0 38.0 31.0 38.0 118-119 35.3085 38.0 36.0 38.0 31.0 38.0 120-121 35.26575 38.0 36.0 38.0 30.0 38.0 122-123 35.208625 38.0 36.0 38.0 31.0 38.0 124-125 34.690124999999995 38.0 36.0 38.0 30.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 2.0 18 0.0 19 4.0 20 1.0 21 3.0 22 5.0 23 8.0 24 7.0 25 10.0 26 25.0 27 28.0 28 42.0 29 47.0 30 76.0 31 81.0 32 115.0 33 131.0 34 182.0 35 269.0 36 479.0 37 2482.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.725 12.5 11.35 35.425000000000004 2 31.674999999999997 17.474999999999998 29.175 21.675 3 27.925 23.1 20.549999999999997 28.425 4 29.299999999999997 29.95 17.549999999999997 23.200000000000003 5 29.849999999999998 30.75 18.825 20.575 6 22.975 33.900000000000006 20.225 22.900000000000002 7 21.3 14.924999999999999 38.574999999999996 25.2 8 23.775 19.325 24.825 32.074999999999996 9 23.525 20.349999999999998 26.8 29.325000000000003 10-11 26.937499999999996 28.375 19.9125 24.775 12-13 24.3875 21.75 25.775 28.0875 14-15 25.662499999999998 22.725 25.0375 26.575 16-17 26.325 23.075000000000003 23.775 26.825 18-19 25.687500000000004 24.075 23.3875 26.85 20-21 26.075 23.7125 23.9 26.3125 22-23 26.2875 23.7875 23.1875 26.737499999999997 24-25 26.275 24.3 23.0375 26.387500000000003 26-27 26.875 23.549999999999997 23.9875 25.587500000000002 28-29 26.8375 23.799999999999997 23.0625 26.3 30-31 25.474999999999998 24.6 23.4875 26.437500000000004 32-33 26.025 23.8625 23.425 26.687499999999996 34-35 25.9875 23.4875 23.525 27.0 36-37 26.8125 23.625 23.962500000000002 25.6 38-39 26.325 23.275000000000002 23.45 26.950000000000003 40-41 26.075 23.200000000000003 24.4125 26.3125 42-43 25.7875 24.087500000000002 23.0625 27.0625 44-45 25.587500000000002 24.025 24.2875 26.1 46-47 27.3 23.150000000000002 23.225 26.325 48-49 26.0375 24.0375 23.1625 26.7625 50-51 26.887499999999996 23.825 23.1 26.187500000000004 52-53 27.1 23.225 23.875 25.8 54-55 25.8625 24.2375 23.3125 26.5875 56-57 26.0375 22.900000000000002 23.8625 27.200000000000003 58-59 26.924999999999997 23.425 23.2625 26.387500000000003 60-61 26.787499999999998 23.3875 23.1 26.724999999999998 62-63 26.700000000000003 23.8375 23.674999999999997 25.7875 64-65 26.974999999999998 23.799999999999997 23.474999999999998 25.75 66-67 25.7375 23.05 24.0125 27.200000000000003 68-69 27.1375 23.849999999999998 23.525 25.4875 70-71 26.474999999999998 23.8125 23.0375 26.674999999999997 72-73 26.55 23.7 23.925 25.825 74-75 26.825 23.200000000000003 23.974999999999998 26.0 76-77 27.3125 22.975 22.925 26.787499999999998 78-79 26.6125 23.5 23.6625 26.224999999999998 80-81 26.700000000000003 23.3625 23.35 26.5875 82-83 26.724999999999998 23.3875 23.9375 25.95 84-85 27.025 22.912499999999998 23.35 26.7125 86-87 27.487499999999997 22.45 23.35 26.7125 88-89 26.087500000000002 23.1875 23.95 26.775 90-91 25.974999999999998 23.9875 23.65 26.387500000000003 92-93 26.2625 22.9875 23.5 27.250000000000004 94-95 26.525 23.4625 23.1125 26.900000000000002 96-97 27.125 22.7375 23.25 26.887499999999996 98-99 26.987499999999997 23.5 23.2125 26.3 100-101 26.487500000000004 24.3625 22.7625 26.387500000000003 102-103 26.1625 24.0125 22.95 26.875 104-105 27.1125 23.175 23.6625 26.05 106-107 27.725 23.2875 22.8625 26.125 108-109 27.6125 23.225 23.7625 25.4 110-111 26.637499999999996 23.45 23.2875 26.625 112-113 26.4625 23.4375 23.474999999999998 26.625 114-115 26.35 22.912499999999998 23.849999999999998 26.887499999999996 116-117 25.887500000000003 23.724999999999998 23.525 26.8625 118-119 27.1375 23.1625 23.2125 26.487500000000004 120-121 26.787499999999998 23.7 22.725 26.787499999999998 122-123 26.187500000000004 24.9375 22.075 26.8 124-125 26.437500000000004 23.9875 23.1375 26.437500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 3.0 27 3.0 28 2.5 29 7.5 30 9.0 31 10.0 32 12.0 33 17.5 34 25.0 35 27.0 36 34.0 37 44.5 38 57.5 39 79.0 40 97.5 41 113.5 42 134.0 43 142.0 44 140.0 45 147.5 46 156.5 47 161.5 48 154.5 49 156.0 50 141.0 51 118.5 52 116.5 53 112.0 54 112.5 55 100.5 56 83.5 57 78.0 58 77.0 59 70.5 60 78.5 61 90.0 62 88.0 63 82.0 64 77.0 65 80.5 66 78.5 67 75.0 68 80.0 69 78.0 70 69.0 71 56.5 72 55.0 73 54.0 74 37.5 75 31.0 76 31.5 77 24.5 78 21.5 79 20.5 80 12.5 81 10.0 82 8.5 83 4.5 84 3.0 85 1.0 86 0.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662591 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662591_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0345 33.0 33.0 34.0 30.0 34.0 2 32.20875 33.0 33.0 34.0 30.0 34.0 3 32.18275 33.0 33.0 34.0 30.0 34.0 4 32.058 33.0 33.0 34.0 31.0 34.0 5 32.06175 33.0 33.0 34.0 30.0 34.0 6 35.8965 38.0 37.0 38.0 31.0 38.0 7 36.13775 38.0 37.0 38.0 33.0 38.0 8 36.0345 38.0 37.0 38.0 31.0 38.0 9 36.05475 38.0 37.0 38.0 31.0 38.0 10-11 36.163875000000004 38.0 37.0 38.0 33.0 38.0 12-13 36.136125 38.0 37.0 38.0 32.5 38.0 14-15 36.086875000000006 38.0 37.5 38.0 33.0 38.0 16-17 36.183625 38.0 37.5 38.0 33.0 38.0 18-19 35.933625 38.0 37.0 38.0 31.0 38.0 20-21 35.98975 38.0 37.0 38.0 32.0 38.0 22-23 35.99725 38.0 37.0 38.0 31.0 38.0 24-25 36.0295 38.0 37.5 38.0 32.0 38.0 26-27 36.0985 38.0 37.5 38.0 32.0 38.0 28-29 36.107749999999996 38.0 37.5 38.0 32.5 38.0 30-31 36.09425 38.0 37.5 38.0 33.0 38.0 32-33 36.195 38.0 37.5 38.0 33.0 38.0 34-35 36.054249999999996 38.0 37.5 38.0 32.0 38.0 36-37 36.076625 38.0 37.5 38.0 31.5 38.0 38-39 36.02425 38.0 37.0 38.0 31.5 38.0 40-41 36.03975 38.0 37.0 38.0 32.5 38.0 42-43 35.980000000000004 38.0 37.0 38.0 31.0 38.0 44-45 36.0315 38.0 37.0 38.0 32.5 38.0 46-47 35.96275 38.0 37.0 38.0 31.0 38.0 48-49 36.069 38.0 37.0 38.0 32.0 38.0 50-51 35.942625 38.0 37.0 38.0 31.5 38.0 52-53 36.008375 38.0 37.0 38.0 31.5 38.0 54-55 36.079499999999996 38.0 37.0 38.0 31.5 38.0 56-57 36.067125000000004 38.0 37.0 38.0 32.5 38.0 58-59 36.040375 38.0 37.0 38.0 31.5 38.0 60-61 35.9455 38.0 37.0 38.0 31.0 38.0 62-63 35.9135 38.0 37.0 38.0 31.0 38.0 64-65 35.845125 38.0 37.0 38.0 31.0 38.0 66-67 35.919125 38.0 37.0 38.0 31.0 38.0 68-69 35.79675 38.0 37.0 38.0 31.0 38.0 70-71 35.88275 38.0 37.0 38.0 31.0 38.0 72-73 35.788375 38.0 37.0 38.0 31.0 38.0 74-75 35.83275 38.0 37.0 38.0 31.0 38.0 76-77 35.758 38.0 37.0 38.0 30.5 38.0 78-79 35.781625 38.0 37.0 38.0 31.0 38.0 80-81 35.549875 38.0 37.0 38.0 30.0 38.0 82-83 35.557249999999996 38.0 36.5 38.0 29.5 38.0 84-85 35.4785 38.0 36.5 38.0 29.0 38.0 86-87 35.441 38.0 36.5 38.0 29.0 38.0 88-89 35.379625000000004 38.0 36.0 38.0 29.0 38.0 90-91 35.255125 38.0 36.0 38.0 28.5 38.0 92-93 35.32725 38.0 36.0 38.0 29.0 38.0 94-95 35.299 38.0 36.0 38.0 29.0 38.0 96-97 35.207499999999996 38.0 36.0 38.0 28.5 38.0 98-99 35.13 38.0 36.0 38.0 28.5 38.0 100-101 35.081875 38.0 36.0 38.0 28.0 38.0 102-103 35.16025 38.0 36.0 38.0 28.5 38.0 104-105 34.88175 38.0 36.0 38.0 26.0 38.0 106-107 34.910624999999996 38.0 35.0 38.0 27.5 38.0 108-109 34.7995 38.0 35.0 38.0 27.0 38.0 110-111 34.769375 38.0 36.0 38.0 26.5 38.0 112-113 34.592625 38.0 35.5 38.0 25.5 38.0 114-115 34.423875 38.0 35.0 38.0 24.5 38.0 116-117 34.414 38.0 35.0 38.0 24.5 38.0 118-119 34.5085 38.0 35.0 38.0 25.5 38.0 120-121 34.329499999999996 38.0 35.0 38.0 24.5 38.0 122-123 33.886624999999995 38.0 35.0 38.0 23.0 38.0 124-125 33.48125 38.0 35.0 38.0 19.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 4.0 16 5.0 17 4.0 18 7.0 19 10.0 20 9.0 21 15.0 22 19.0 23 21.0 24 31.0 25 36.0 26 45.0 27 56.0 28 51.0 29 60.0 30 81.0 31 91.0 32 144.0 33 150.0 34 191.0 35 274.0 36 483.0 37 2208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.775 12.925 10.274999999999999 36.025 2 32.725 17.974999999999998 27.925 21.375 3 28.825 23.724999999999998 20.225 27.224999999999998 4 30.225 30.099999999999998 16.75 22.925 5 28.725 31.775 18.7 20.8 6 23.7 33.800000000000004 19.55 22.95 7 21.8 15.775 37.75 24.675 8 24.05 20.125 24.7 31.125000000000004 9 23.150000000000002 19.2 27.575 30.075000000000003 10-11 27.6875 28.3125 19.7375 24.2625 12-13 25.4375 21.85 25.575 27.1375 14-15 24.762500000000003 23.325000000000003 25.4375 26.474999999999998 16-17 27.500000000000004 23.3875 23.275000000000002 25.837500000000002 18-19 26.3125 23.0875 23.2375 27.3625 20-21 26.075 24.3875 22.6375 26.900000000000002 22-23 27.05 23.8125 22.975 26.1625 24-25 26.35 24.3625 22.7125 26.575 26-27 26.174999999999997 24.5375 22.625 26.6625 28-29 26.6625 23.549999999999997 23.025000000000002 26.7625 30-31 25.35 24.2875 23.549999999999997 26.8125 32-33 25.687500000000004 24.762500000000003 23.3875 26.1625 34-35 26.224999999999998 23.1125 23.0625 27.6 36-37 26.35 23.0625 23.575 27.0125 38-39 26.400000000000002 23.425 22.85 27.325 40-41 26.724999999999998 23.45 23.4875 26.337500000000002 42-43 25.412499999999998 24.224999999999998 22.8625 27.500000000000004 44-45 26.187500000000004 24.0625 23.325000000000003 26.424999999999997 46-47 26.3 23.724999999999998 22.8625 27.1125 48-49 25.624999999999996 23.549999999999997 23.4875 27.3375 50-51 26.2125 23.2125 24.25 26.325 52-53 26.840855106888363 23.590448806100763 23.76547068383548 25.803225403175396 54-55 25.724999999999998 23.9 23.5375 26.8375 56-57 26.553319164895612 23.71546443305413 23.377922240280036 26.35329416177022 58-59 26.275 23.3875 23.974999999999998 26.3625 60-61 27.3875 23.275000000000002 23.65 25.687500000000004 62-63 26.137500000000003 23.5875 23.7125 26.5625 64-65 26.569142285571395 23.593398349587396 23.093273318329583 26.744186046511626 66-67 26.365795724465556 23.540442555319416 23.15289411176397 26.940867608451057 68-69 26.0125 23.625 24.075 26.2875 70-71 27.2625 23.2625 23.05 26.424999999999997 72-73 27.315914489311165 23.465433179147393 22.95286910863858 26.26578322290286 74-75 26.8 23.599999999999998 23.275000000000002 26.325 76-77 26.424999999999997 23.2875 22.9875 27.3 78-79 26.325 23.0875 24.4 26.187500000000004 80-81 26.450000000000003 23.2875 23.3375 26.924999999999997 82-83 27.025 22.6375 23.3 27.037499999999998 84-85 26.6625 23.4125 24.175 25.75 86-87 26.05 23.2375 23.125 27.5875 88-89 26.75 23.4875 22.900000000000002 26.8625 90-91 26.6 23.5375 23.7 26.1625 92-93 26.1125 22.775000000000002 23.525 27.5875 94-95 27.0875 22.1 24.25 26.5625 96-97 26.987499999999997 22.5625 23.400000000000002 27.05 98-99 25.624999999999996 22.9875 24.15 27.237499999999997 100-101 26.200000000000003 23.6625 23.225 26.9125 102-103 26.05 24.3 23.275000000000002 26.375 104-105 25.924999999999997 23.525 23.6125 26.937499999999996 106-107 26.275 23.474999999999998 23.0 27.250000000000004 108-109 26.330321285140563 23.481425702811247 23.908132530120483 26.28012048192771 110-111 26.422662321383804 23.364251692153424 23.627475557783907 26.58561042867887 112-113 26.100113478754256 23.33879712520489 23.389232127096204 27.17185726894465 114-115 26.515246580499436 22.738110176935624 23.491027732463294 27.255615510101645 116-117 25.95 23.3375 23.45 27.2625 118-119 26.525762881440716 23.51175587793897 23.78689344672336 26.17558779389695 120-121 26.5 23.0125 23.225 27.2625 122-123 24.8 24.1375 24.1125 26.950000000000003 124-125 27.6625 22.9875 22.912499999999998 26.437500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 2.5 28 2.5 29 4.5 30 7.5 31 10.0 32 13.0 33 17.5 34 22.0 35 29.5 36 46.5 37 60.0 38 74.5 39 80.5 40 97.5 41 116.0 42 118.5 43 132.0 44 153.0 45 155.5 46 144.5 47 145.0 48 150.0 49 156.0 50 143.0 51 119.5 52 111.0 53 104.0 54 90.5 55 86.0 56 89.0 57 86.0 58 75.5 59 83.5 60 86.0 61 81.0 62 91.0 63 83.5 64 73.0 65 78.5 66 79.0 67 77.5 68 80.0 69 69.5 70 58.5 71 60.5 72 61.0 73 53.5 74 51.0 75 44.0 76 31.5 77 24.5 78 21.0 79 18.0 80 13.0 81 9.0 82 8.0 83 8.5 84 5.5 85 2.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0125 54-55 0.0 56-57 0.0125 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.025 66-67 0.0125 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.4 110-111 0.27499999999999997 112-113 0.8625 114-115 0.3875 116-117 0.0 118-119 0.05 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684653 spots for SRR13662591.sra Written 684653 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra Read 684650 spots for SRR13662591.sra Written 684650 spots for SRR13662591.sra SRR ids: ['SRR13662591.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z1k7c2om SRR13662591.sra spots: 13693003 blocks: [[1, 684650], [684651, 1369300], [1369301, 2053950], [2053951, 2738600], [2738601, 3423250], [3423251, 4107900], [4107901, 4792550], [4792551, 5477200], [5477201, 6161850], [6161851, 6846500], [6846501, 7531150], [7531151, 8215800], [8215801, 8900450], [8900451, 9585100], [9585101, 10269750], [10269751, 10954400], [10954401, 11639050], [11639051, 12323700], [12323701, 13008350], [13008351, 13693003]] SRR13662591 file size 3936433 SRR13662591 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662591 SRR13662591_1.fastq SRR13662591_2.fastq Input file: SRR13662591_1.fastq Paired file: SRR13662591_2.fastq trimmed: SRR13662591-trimmed-pair1.fastq, SRR13662591-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:49:10 2024 >> started Tue Dec 10 07:49:25 2024 >> done (14.468s) 13693003 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 127 ( 0.00%) empty read pairs filtered out after trimming by size control 13692873 (100.00%) read pairs available; of these: 1754450 (12.81%) trimmed read pairs available after processing 11938423 (87.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 1 0.00% 33 2 0.00% 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 1 0.00% 41 1 0.00% 42 0 0.00% 43 1 0.00% 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 2 0.00% 49 0 0.00% 50 1 0.00% 51 0 0.00% 52 0 0.00% 53 0 0.00% 54 1 0.00% 55 1 0.00% 56 1 0.00% 57 2 0.00% 58 0 0.00% 59 2 0.00% 60 2 0.00% 61 7 0.00% 62 5 0.00% 63 31 0.00% 64 51 0.00% 65 86 0.00% 66 105 0.00% 67 120 0.00% 68 156 0.00% 69 182 0.00% 70 183 0.00% 71 220 0.00% 72 266 0.00% 73 306 0.00% 74 320 0.00% 75 354 0.00% 76 388 0.00% 77 444 0.00% 78 454 0.00% 79 521 0.00% 80 542 0.00% 81 617 0.00% 82 666 0.00% 83 747 0.01% 84 743 0.01% 85 825 0.01% 86 894 0.01% 87 1007 0.01% 88 1165 0.01% 89 1303 0.01% 90 1430 0.01% 91 1700 0.01% 92 1902 0.01% 93 2337 0.02% 94 6227 0.05% 95 6457 0.05% 96 6635 0.05% 97 7170 0.05% 98 7346 0.05% 99 7554 0.06% 100 7870 0.06% 101 8316 0.06% 102 8550 0.06% 103 9118 0.07% 104 9525 0.07% 105 9960 0.07% 106 10606 0.08% 107 11187 0.08% 108 12301 0.09% 109 12972 0.09% 110 14004 0.10% 111 15852 0.12% 112 16941 0.12% 113 19109 0.14% 114 21632 0.16% 115 24836 0.18% 116 43704 0.32% 117 47668 0.35% 118 56070 0.41% 119 67192 0.49% 120 84953 0.62% 121 110612 0.81% 122 160632 1.17% 123 266157 1.94% 124 643195 4.70% 125 11938423 87.19% 13692873 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=115.10 fanout-score-rank=9 prefix-density=1.17 prefix-fanout=17.8 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=352.58 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=27.7 sequence=CGCCGCCGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAACCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGAGCTTGAGAGGGCACTGTAGCCAGTGTGTCAGTCGTTGTTAAATTACAGGTTGAGATCATCAGCGTACTCCGATG criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=117.67 fanout-score-rank=8 prefix-density=1.15 prefix-fanout=18.1 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=331.87 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=28.3 sequence=CGCCGCCGCCGG SRR13662591 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:50:13 Started mapping on | Dec 10 07:50:13 Finished on | Dec 10 07:51:05 Mapping speed, Million of reads per hour | 947.97 Number of input reads | 13692873 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 13054520 Uniquely mapped reads % | 95.34% Average mapped length | 246.68 Number of splices: Total | 10030565 Number of splices: Annotated (sjdb) | 9393911 Number of splices: GT/AG | 9892140 Number of splices: GC/AG | 116769 Number of splices: AT/AC | 5146 Number of splices: Non-canonical | 16510 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.84 Insertion rate per base | 0.01% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 237293 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 20418 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.95% % of reads unmapped: other | 0.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 401150 401150 401150 N_multimapping 237293 237293 237293 N_noFeature 524335 6672201 6668025 N_ambiguous 297585 30912 31551 UnstrandedReadsAssigned:12232600 PositiveStrandReadsAssigned:6351407 NegativeStrandReadsAssigned:6354944 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662591 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662591-trimmed-pair1.fastq SRR13662591-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,692,873 reads, 12,634,022 reads pseudoaligned [quant] estimated average fragment length: 203.304 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52973 SRR13662591.ke.tsv 35125 SRR13662591.se.tsv 88098 total ==> SRR13662591.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 733.873 0 0 PNS24247 1044 841.696 35.2114 4.51211 PNS24249 1928 1725.7 203.21 12.7008 PNS24246 1044 841.696 35.2114 4.51211 PNS24248 1044 841.696 35.2114 4.51211 PNS24244 1471 1268.7 47.1557 4.00893 PNS24243 293 99.2213 43 46.7428 KQK14069 1603 1400.7 9396.13 723.531 KQK14071 474 273.752 1721.96 678.449 ==> SRR13662591.se.tsv <== BRADI_1g14170v3 12241 BRADI_1g53295v3 59 BRADI_1g59795v3 501 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 116 BRADI_1g74790v3 148 BRADI_1g09890v3 0 BRADI_1g77505v3 228 BRADI_1g48960v3 0 SRR13662591 completed mapping pipeline successfully