Starting /dee2/code/volunteer_pipeline.sh SRR13662592 current disk space = 1526729027584 free memory = 1602057976 SRR13662592 SRAfilesize 7cb1d7b362a33847dc7b719a14b45183 SRR13662592.sra SRR13662592.sra file validated SRR13662592 is paired end SRR13662592 is conventional basespace SRR13662592 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662592_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.516 33.0 33.0 34.0 31.0 34.0 2 32.32925 33.0 33.0 34.0 30.0 34.0 3 32.47775 33.0 33.0 34.0 31.0 34.0 4 32.50175 33.0 33.0 34.0 31.0 34.0 5 32.36725 33.0 33.0 34.0 31.0 34.0 6 35.9555 38.0 36.0 38.0 31.0 38.0 7 36.5705 38.0 37.0 38.0 34.0 38.0 8 36.66975 38.0 38.0 38.0 34.0 38.0 9 36.78075 38.0 38.0 38.0 35.0 38.0 10-11 36.678625 38.0 38.0 38.0 34.0 38.0 12-13 36.662375 38.0 38.0 38.0 34.0 38.0 14-15 36.703625 38.0 38.0 38.0 34.5 38.0 16-17 36.707750000000004 38.0 38.0 38.0 34.0 38.0 18-19 36.80325 38.0 38.0 38.0 34.5 38.0 20-21 36.719625 38.0 38.0 38.0 34.0 38.0 22-23 36.799625 38.0 38.0 38.0 35.0 38.0 24-25 36.701625 38.0 38.0 38.0 34.0 38.0 26-27 36.617000000000004 38.0 38.0 38.0 34.0 38.0 28-29 36.6965 38.0 38.0 38.0 34.0 38.0 30-31 36.72025 38.0 38.0 38.0 34.0 38.0 32-33 36.571125 38.0 38.0 38.0 34.0 38.0 34-35 36.564375 38.0 38.0 38.0 34.0 38.0 36-37 36.541875 38.0 38.0 38.0 34.0 38.0 38-39 36.5015 38.0 38.0 38.0 34.0 38.0 40-41 36.502625 38.0 38.0 38.0 33.5 38.0 42-43 36.608875 38.0 38.0 38.0 34.0 38.0 44-45 36.6045 38.0 38.0 38.0 34.0 38.0 46-47 36.501875 38.0 38.0 38.0 34.0 38.0 48-49 36.597625 38.0 38.0 38.0 34.0 38.0 50-51 36.615875 38.0 38.0 38.0 34.0 38.0 52-53 36.678625 38.0 38.0 38.0 34.0 38.0 54-55 36.656625000000005 38.0 38.0 38.0 34.0 38.0 56-57 36.641625 38.0 38.0 38.0 34.0 38.0 58-59 36.369249999999994 38.0 38.0 38.0 33.5 38.0 60-61 36.481625 38.0 38.0 38.0 34.0 38.0 62-63 36.503125 38.0 38.0 38.0 34.0 38.0 64-65 36.33 38.0 38.0 38.0 33.5 38.0 66-67 36.41025 38.0 38.0 38.0 33.5 38.0 68-69 36.5725 38.0 38.0 38.0 34.0 38.0 70-71 36.411125 38.0 38.0 38.0 34.0 38.0 72-73 36.3995 38.0 38.0 38.0 33.5 38.0 74-75 36.08025 38.0 38.0 38.0 33.0 38.0 76-77 36.305125000000004 38.0 38.0 38.0 33.5 38.0 78-79 36.248875 38.0 38.0 38.0 33.0 38.0 80-81 36.208 38.0 38.0 38.0 33.0 38.0 82-83 36.103875 38.0 37.5 38.0 32.5 38.0 84-85 36.122625 38.0 37.5 38.0 33.0 38.0 86-87 35.860125 38.0 37.0 38.0 31.0 38.0 88-89 36.012125 38.0 37.5 38.0 32.5 38.0 90-91 36.191625 38.0 38.0 38.0 33.0 38.0 92-93 35.747875 38.0 37.0 38.0 31.5 38.0 94-95 35.829875 38.0 37.0 38.0 32.0 38.0 96-97 35.747749999999996 38.0 37.0 38.0 31.0 38.0 98-99 35.40625 38.0 36.5 38.0 29.5 38.0 100-101 35.581374999999994 38.0 37.0 38.0 30.5 38.0 102-103 35.574 38.0 37.0 38.0 31.0 38.0 104-105 35.815875000000005 38.0 37.0 38.0 32.0 38.0 106-107 35.570875 38.0 37.0 38.0 31.0 38.0 108-109 35.257 38.0 36.5 38.0 29.0 38.0 110-111 35.326 38.0 36.0 38.0 29.0 38.0 112-113 35.20325 38.0 36.0 38.0 29.0 38.0 114-115 35.208875 38.0 36.0 38.0 30.0 38.0 116-117 34.935625 38.0 36.0 38.0 28.0 38.0 118-119 35.099875 38.0 36.0 38.0 29.0 38.0 120-121 34.69325 38.0 35.5 38.0 27.0 38.0 122-123 35.035125 38.0 36.5 38.0 30.0 38.0 124-125 34.418 38.0 36.0 38.0 27.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 3.0 17 3.0 18 5.0 19 2.0 20 6.0 21 5.0 22 11.0 23 6.0 24 11.0 25 14.0 26 20.0 27 31.0 28 52.0 29 59.0 30 81.0 31 93.0 32 102.0 33 159.0 34 176.0 35 263.0 36 480.0 37 2417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.725 10.65 9.9 37.724999999999994 2 32.324999999999996 17.299999999999997 27.650000000000002 22.725 3 28.749999999999996 22.8 19.475 28.975 4 31.374999999999996 28.95 16.650000000000002 23.025000000000002 5 30.65 30.349999999999998 19.35 19.650000000000002 6 23.75 34.225 19.125 22.900000000000002 7 22.400000000000002 16.325 38.45 22.825 8 23.575 20.65 24.65 31.125000000000004 9 24.725 19.8 26.900000000000002 28.575 10-11 27.0625 28.125 20.0375 24.775 12-13 26.05 22.25 24.9 26.8 14-15 25.087500000000002 24.1125 24.25 26.55 16-17 27.0875 24.0375 23.825 25.05 18-19 25.85 23.575 24.2625 26.3125 20-21 25.912499999999998 24.2875 23.4125 26.387500000000003 22-23 25.825 24.4375 23.6375 26.1 24-25 25.6125 23.8625 24.462500000000002 26.0625 26-27 26.674999999999997 24.087500000000002 23.1375 26.1 28-29 26.787499999999998 24.4375 23.474999999999998 25.3 30-31 26.6125 23.7625 24.5125 25.112499999999997 32-33 25.2875 24.025 23.849999999999998 26.8375 34-35 25.924999999999997 23.6375 23.8625 26.575 36-37 25.5125 24.212500000000002 24.349999999999998 25.924999999999997 38-39 25.4 23.549999999999997 24.2 26.85 40-41 27.1125 24.0 22.5875 26.3 42-43 26.487500000000004 24.0 23.799999999999997 25.7125 44-45 25.9875 23.962500000000002 24.275 25.775 46-47 26.6125 24.2875 23.25 25.85 48-49 26.187500000000004 23.9 23.5 26.4125 50-51 26.5375 23.8625 22.9375 26.6625 52-53 26.1 24.0 23.3375 26.5625 54-55 25.837500000000002 24.3625 23.3875 26.4125 56-57 26.2125 24.1875 23.8625 25.7375 58-59 26.5625 23.2875 23.7125 26.437500000000004 60-61 26.2625 23.4125 23.7125 26.6125 62-63 25.775 24.1625 23.875 26.187500000000004 64-65 26.875 23.4625 23.9 25.7625 66-67 26.2875 23.375 24.1875 26.150000000000002 68-69 26.5625 23.525 23.9125 26.0 70-71 26.650000000000002 23.150000000000002 23.6375 26.5625 72-73 26.087500000000002 24.25 23.4375 26.224999999999998 74-75 25.95 24.0375 23.400000000000002 26.6125 76-77 25.924999999999997 24.0 23.325000000000003 26.75 78-79 26.125 23.799999999999997 23.9875 26.087500000000002 80-81 26.137500000000003 23.6625 24.0125 26.187500000000004 82-83 27.125 23.775 22.975 26.125 84-85 25.9875 23.674999999999997 23.5625 26.775 86-87 26.137500000000003 23.95 23.375 26.5375 88-89 27.212500000000002 23.175 23.3625 26.25 90-91 26.0125 24.625 22.5875 26.775 92-93 25.4625 23.7875 23.875 26.875 94-95 26.137500000000003 23.35 23.549999999999997 26.9625 96-97 25.912499999999998 23.674999999999997 23.6125 26.8 98-99 25.75 23.95 24.075 26.224999999999998 100-101 27.450000000000003 23.1625 22.95 26.437500000000004 102-103 26.2625 24.3625 22.9625 26.4125 104-105 26.575 24.175 23.4875 25.7625 106-107 26.125 24.3125 22.9375 26.625 108-109 27.0875 24.175 23.225 25.5125 110-111 26.450000000000003 23.7625 23.275000000000002 26.5125 112-113 25.7875 23.9 23.6375 26.674999999999997 114-115 26.174999999999997 23.4625 23.599999999999998 26.7625 116-117 26.35 23.9 22.75 27.0 118-119 26.950000000000003 24.0 23.4375 25.6125 120-121 26.174999999999997 24.087500000000002 24.224999999999998 25.5125 122-123 26.450000000000003 23.3 23.962500000000002 26.2875 124-125 25.900000000000002 23.9375 23.45 26.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 1.5 27 3.0 28 4.5 29 7.0 30 8.0 31 10.0 32 17.0 33 21.5 34 23.0 35 29.0 36 32.5 37 48.0 38 70.5 39 88.5 40 106.0 41 113.5 42 137.5 43 154.0 44 153.0 45 167.5 46 162.0 47 162.5 48 173.0 49 156.0 50 130.0 51 112.5 52 106.5 53 106.0 54 97.5 55 82.0 56 78.5 57 80.5 58 79.5 59 80.5 60 73.0 61 62.5 62 64.5 63 75.5 64 81.5 65 79.0 66 78.0 67 75.5 68 80.0 69 68.0 70 56.5 71 57.0 72 47.5 73 51.5 74 52.5 75 40.5 76 32.0 77 29.0 78 19.5 79 15.0 80 17.0 81 11.5 82 8.0 83 6.5 84 4.5 85 2.0 86 1.5 87 1.5 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662592 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662592_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.347 33.0 32.0 34.0 25.0 34.0 2 31.6675 33.0 32.0 34.0 27.0 34.0 3 31.377 33.0 32.0 34.0 25.0 34.0 4 31.31325 33.0 32.0 34.0 27.0 34.0 5 31.58325 33.0 32.0 34.0 27.0 34.0 6 35.1635 38.0 36.0 38.0 28.0 38.0 7 35.2975 38.0 36.0 38.0 28.0 38.0 8 35.10525 38.0 36.0 38.0 27.0 38.0 9 35.51925 38.0 37.0 38.0 29.0 38.0 10-11 35.3545 38.0 36.5 38.0 28.5 38.0 12-13 35.59875 38.0 37.0 38.0 29.0 38.0 14-15 34.971000000000004 38.0 36.0 38.0 26.5 38.0 16-17 35.30975 38.0 36.5 38.0 28.0 38.0 18-19 35.273125 38.0 36.0 38.0 27.5 38.0 20-21 34.838499999999996 38.0 36.0 38.0 26.0 38.0 22-23 35.585499999999996 38.0 36.5 38.0 28.5 38.0 24-25 35.545500000000004 38.0 37.0 38.0 28.5 38.0 26-27 35.08325000000001 38.0 36.0 38.0 27.0 38.0 28-29 35.54175 38.0 37.0 38.0 28.5 38.0 30-31 35.254 38.0 36.5 38.0 27.5 38.0 32-33 35.186125000000004 38.0 36.0 38.0 27.5 38.0 34-35 35.0705 38.0 36.0 38.0 26.0 38.0 36-37 35.196625 38.0 36.0 38.0 27.0 38.0 38-39 34.50125 38.0 35.0 38.0 24.5 38.0 40-41 34.884625 38.0 36.0 38.0 26.0 38.0 42-43 35.331500000000005 38.0 36.0 38.0 27.5 38.0 44-45 34.98625 38.0 35.5 38.0 25.5 38.0 46-47 35.636250000000004 38.0 37.0 38.0 29.0 38.0 48-49 35.642875000000004 38.0 37.0 38.0 29.0 38.0 50-51 35.71725000000001 38.0 37.0 38.0 29.0 38.0 52-53 35.782375 38.0 37.0 38.0 30.0 38.0 54-55 35.773625 38.0 37.0 38.0 30.0 38.0 56-57 35.770375 38.0 37.0 38.0 30.0 38.0 58-59 35.513125 38.0 37.0 38.0 29.0 38.0 60-61 35.69325 38.0 37.0 38.0 30.0 38.0 62-63 35.651375 38.0 37.0 38.0 30.0 38.0 64-65 35.51275 38.0 37.0 38.0 29.0 38.0 66-67 35.571625 38.0 37.0 38.0 29.0 38.0 68-69 35.780625 38.0 37.0 38.0 30.0 38.0 70-71 35.725875 38.0 37.0 38.0 30.0 38.0 72-73 35.630375 38.0 36.5 38.0 30.0 38.0 74-75 35.195125000000004 38.0 36.0 38.0 27.5 38.0 76-77 35.436375 38.0 36.5 38.0 28.5 38.0 78-79 35.474375 38.0 36.5 38.0 29.0 38.0 80-81 35.412875 38.0 36.5 38.0 29.0 38.0 82-83 35.31225 38.0 36.5 38.0 28.5 38.0 84-85 35.69525 38.0 37.0 38.0 31.0 38.0 86-87 35.415875 38.0 36.5 38.0 29.5 38.0 88-89 35.414375 38.0 37.0 38.0 29.0 38.0 90-91 35.171125 38.0 36.0 38.0 28.5 38.0 92-93 35.346875 38.0 36.0 38.0 29.0 38.0 94-95 35.06325 38.0 36.0 38.0 27.5 38.0 96-97 35.172625 38.0 36.0 38.0 28.5 38.0 98-99 34.918375 38.0 35.5 38.0 26.0 38.0 100-101 35.113125 38.0 36.0 38.0 28.0 38.0 102-103 35.192375 38.0 36.0 38.0 28.5 38.0 104-105 34.848375000000004 38.0 35.5 38.0 26.5 38.0 106-107 34.715125 38.0 35.5 38.0 26.0 38.0 108-109 34.716499999999996 38.0 35.5 38.0 25.5 38.0 110-111 34.81875 38.0 35.5 38.0 27.0 38.0 112-113 34.746750000000006 38.0 35.5 38.0 26.5 38.0 114-115 34.8125 38.0 35.5 38.0 27.5 38.0 116-117 34.460125000000005 38.0 35.0 38.0 24.5 38.0 118-119 34.40725 38.0 35.0 38.0 24.0 38.0 120-121 34.249 38.0 35.0 38.0 24.5 38.0 122-123 34.183875 38.0 35.0 38.0 24.5 38.0 124-125 33.841750000000005 38.0 35.0 38.0 23.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 2.0 14 4.0 15 3.0 16 11.0 17 8.0 18 7.0 19 6.0 20 10.0 21 17.0 22 29.0 23 28.0 24 35.0 25 50.0 26 49.0 27 64.0 28 79.0 29 89.0 30 98.0 31 90.0 32 129.0 33 172.0 34 202.0 35 271.0 36 473.0 37 2072.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.6 11.425 10.25 37.724999999999994 2 31.4 17.724999999999998 28.225 22.650000000000002 3 26.974999999999998 24.05 20.775 28.199999999999996 4 29.25 29.25 17.424999999999997 24.075 5 30.275000000000002 30.15 20.474999999999998 19.1 6 23.3 34.425 21.725 20.549999999999997 7 20.95 17.8 38.224999999999994 23.025000000000002 8 23.75 21.525 25.724999999999998 28.999999999999996 9 24.625 20.175 28.349999999999998 26.85 10-11 26.2125 28.762500000000003 20.6125 24.4125 12-13 24.349999999999998 22.8125 26.775 26.0625 14-15 25.2625 24.4125 25.0625 25.2625 16-17 26.6125 23.474999999999998 24.2875 25.624999999999996 18-19 25.724999999999998 23.5875 24.6875 26.0 20-21 25.8 23.5375 23.6875 26.974999999999998 22-23 26.974999999999998 24.1625 23.25 25.6125 24-25 25.6125 24.1875 24.275 25.924999999999997 26-27 25.874999999999996 24.65 23.7625 25.7125 28-29 26.1 24.125 23.7 26.075 30-31 25.324999999999996 23.9 24.762500000000003 26.0125 32-33 24.637500000000003 24.337500000000002 24.6125 26.4125 34-35 27.1 23.35 23.025000000000002 26.525 36-37 26.0 23.65 24.3 26.05 38-39 26.200000000000003 23.35 24.2875 26.1625 40-41 26.0375 23.9 23.5 26.5625 42-43 25.412499999999998 22.412499999999998 25.162499999999998 27.0125 44-45 26.2875 23.3 23.925 26.487500000000004 46-47 26.8 23.9 23.25 26.05 48-49 25.324999999999996 24.0625 24.575 26.0375 50-51 25.6125 23.65 24.575 26.1625 52-53 26.674999999999997 23.25 24.1375 25.937500000000004 54-55 26.8125 23.674999999999997 23.2125 26.3 56-57 26.1125 23.6625 24.5375 25.687500000000004 58-59 25.8 23.799999999999997 24.349999999999998 26.05 60-61 25.8 24.45 23.6875 26.0625 62-63 25.924999999999997 23.474999999999998 23.962500000000002 26.637499999999996 64-65 26.0625 22.5625 24.5125 26.8625 66-67 26.575 23.325000000000003 23.7625 26.337500000000002 68-69 27.075 22.8375 24.2 25.887500000000003 70-71 26.237500000000004 23.425 24.1625 26.174999999999997 72-73 25.3 24.05 23.45 27.200000000000003 74-75 24.8 24.75 24.325 26.125 76-77 25.837500000000002 23.0125 24.3125 26.8375 78-79 26.337500000000002 23.6125 23.625 26.424999999999997 80-81 27.150000000000002 23.474999999999998 23.9125 25.4625 82-83 26.0625 24.3875 23.3875 26.1625 84-85 26.337500000000002 23.425 23.825 26.4125 86-87 26.8375 22.7 24.087500000000002 26.375 88-89 27.0 23.7125 23.35 25.937500000000004 90-91 25.624999999999996 23.549999999999997 24.575 26.25 92-93 26.525 23.75 23.549999999999997 26.174999999999997 94-95 26.474999999999998 23.875 23.525 26.125 96-97 25.3 24.625 24.025 26.05 98-99 26.174999999999997 23.0375 23.65 27.1375 100-101 26.75 22.975 23.8125 26.4625 102-103 26.0625 22.7 23.6125 27.625 104-105 27.487499999999997 22.787499999999998 23.8125 25.912499999999998 106-107 26.35 23.474999999999998 23.150000000000002 27.025 108-109 25.2875 23.6125 24.5125 26.5875 110-111 26.5875 24.3625 23.325000000000003 25.724999999999998 112-113 26.5375 23.474999999999998 23.4625 26.525 114-115 25.974999999999998 23.3625 24.125 26.5375 116-117 26.525 23.4625 24.05 25.9625 118-119 26.7125 22.7375 24.6625 25.887500000000003 120-121 25.912499999999998 23.5 23.849999999999998 26.737499999999997 122-123 26.6 23.2625 23.7 26.437500000000004 124-125 27.05 23.474999999999998 23.75 25.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 1.0 26 1.5 27 2.0 28 2.5 29 7.5 30 10.0 31 8.5 32 10.0 33 20.5 34 32.0 35 36.5 36 46.5 37 49.0 38 57.0 39 83.0 40 106.0 41 132.5 42 158.5 43 163.0 44 156.5 45 160.0 46 162.0 47 166.0 48 164.5 49 146.0 50 132.5 51 125.5 52 111.0 53 103.0 54 94.5 55 87.5 56 86.5 57 76.0 58 69.5 59 68.5 60 74.0 61 77.5 62 76.5 63 77.5 64 69.0 65 68.0 66 73.0 67 69.5 68 68.0 69 65.0 70 60.5 71 59.5 72 57.5 73 54.0 74 44.5 75 34.0 76 28.0 77 24.5 78 24.0 79 17.0 80 11.5 81 7.5 82 5.0 83 5.5 84 2.5 85 2.0 86 3.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594878 spots for SRR13662592.sra Written 594878 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra Read 594871 spots for SRR13662592.sra Written 594871 spots for SRR13662592.sra SRR ids: ['SRR13662592.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d49siaxa SRR13662592.sra spots: 11897427 blocks: [[1, 594871], [594872, 1189742], [1189743, 1784613], [1784614, 2379484], [2379485, 2974355], [2974356, 3569226], [3569227, 4164097], [4164098, 4758968], [4758969, 5353839], [5353840, 5948710], [5948711, 6543581], [6543582, 7138452], [7138453, 7733323], [7733324, 8328194], [8328195, 8923065], [8923066, 9517936], [9517937, 10112807], [10112808, 10707678], [10707679, 11302549], [11302550, 11897427]] SRR13662592 file size 3417399 SRR13662592 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662592 SRR13662592_1.fastq SRR13662592_2.fastq Input file: SRR13662592_1.fastq Paired file: SRR13662592_2.fastq trimmed: SRR13662592-trimmed-pair1.fastq, SRR13662592-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:51:58 2024 >> started Tue Dec 10 07:52:09 2024 >> done (11.016s) 11897427 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 156 ( 0.00%) empty read pairs filtered out after trimming by size control 11897271 (100.00%) read pairs available; of these: 1537454 (12.92%) trimmed read pairs available after processing 10359817 (87.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 0 0.00% 33 0 0.00% 34 1 0.00% 35 1 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 1 0.00% 41 0 0.00% 42 1 0.00% 43 1 0.00% 44 0 0.00% 45 0 0.00% 46 1 0.00% 47 0 0.00% 48 1 0.00% 49 1 0.00% 50 1 0.00% 51 1 0.00% 52 0 0.00% 53 0 0.00% 54 1 0.00% 55 1 0.00% 56 0 0.00% 57 2 0.00% 58 2 0.00% 59 2 0.00% 60 5 0.00% 61 2 0.00% 62 4 0.00% 63 30 0.00% 64 54 0.00% 65 83 0.00% 66 101 0.00% 67 123 0.00% 68 144 0.00% 69 145 0.00% 70 187 0.00% 71 200 0.00% 72 257 0.00% 73 238 0.00% 74 315 0.00% 75 317 0.00% 76 354 0.00% 77 419 0.00% 78 420 0.00% 79 473 0.00% 80 506 0.00% 81 558 0.00% 82 611 0.01% 83 662 0.01% 84 669 0.01% 85 748 0.01% 86 847 0.01% 87 889 0.01% 88 998 0.01% 89 1114 0.01% 90 1216 0.01% 91 1379 0.01% 92 1699 0.01% 93 2058 0.02% 94 5116 0.04% 95 5373 0.05% 96 5615 0.05% 97 5851 0.05% 98 6087 0.05% 99 6407 0.05% 100 6539 0.05% 101 6925 0.06% 102 7070 0.06% 103 7365 0.06% 104 7645 0.06% 105 8278 0.07% 106 8712 0.07% 107 9023 0.08% 108 9870 0.08% 109 10430 0.09% 110 11262 0.09% 111 12205 0.10% 112 13562 0.11% 113 15042 0.13% 114 16994 0.14% 115 19335 0.16% 116 43301 0.36% 117 48216 0.41% 118 55923 0.47% 119 66201 0.56% 120 80128 0.67% 121 101896 0.86% 122 144055 1.21% 123 231162 1.94% 124 544019 4.57% 125 10359817 87.08% 11897271 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.51 fanout-score-rank=22 prefix-density=0.27 prefix-fanout=3.6 sequence=TGCAAGTGCGGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=20 fanout-score=178.67 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=22.0 sequence=CGGCGGCGGCGCC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.60 fanout-score-rank=20 prefix-density=0.26 prefix-fanout=3.6 sequence=TGCAAGTGCGGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=186.90 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=20.8 sequence=CCGCCGCCGCCG SRR13662592 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:53:03 Started mapping on | Dec 10 07:53:04 Finished on | Dec 10 07:53:45 Mapping speed, Million of reads per hour | 1044.64 Number of input reads | 11897271 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 11290321 Uniquely mapped reads % | 94.90% Average mapped length | 246.64 Number of splices: Total | 8522938 Number of splices: Annotated (sjdb) | 7974386 Number of splices: GT/AG | 8405477 Number of splices: GC/AG | 99920 Number of splices: AT/AC | 4481 Number of splices: Non-canonical | 13060 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.53 Insertion rate per base | 0.00% Insertion average length | 1.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245993 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 22890 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.71% % of reads unmapped: other | 1.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 361019 361019 361019 N_multimapping 245993 245993 245993 N_noFeature 500960 5787962 5796888 N_ambiguous 258349 27067 27837 UnstrandedReadsAssigned:10531012 PositiveStrandReadsAssigned:5475292 NegativeStrandReadsAssigned:5465596 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662592 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662592-trimmed-pair1.fastq SRR13662592-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,897,271 reads, 10,934,538 reads pseudoaligned [quant] estimated average fragment length: 194.989 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52973 SRR13662592.ke.tsv 35125 SRR13662592.se.tsv 88098 total ==> SRR13662592.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 742.21 0 0 PNS24247 1044 850.011 38.3316 5.62027 PNS24249 1928 1734.01 128.251 9.21792 PNS24246 1044 850.011 38.3316 5.62027 PNS24248 1044 850.011 38.3316 5.62027 PNS24244 1471 1277.01 51.7545 5.05102 PNS24243 293 106.1 36 42.2877 KQK14069 1603 1409.01 8328.23 736.654 KQK14071 474 282.018 1127.53 498.282 ==> SRR13662592.se.tsv <== BRADI_1g14170v3 10198 BRADI_1g53295v3 80 BRADI_1g59795v3 373 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 71 BRADI_1g74790v3 138 BRADI_1g09890v3 0 BRADI_1g77505v3 193 BRADI_1g48960v3 1 SRR13662592 completed mapping pipeline successfully