Starting /dee2/code/volunteer_pipeline.sh SRR13662593 current disk space = 1526715707392 free memory = 1505467980 SRR13662593 SRAfilesize 69fb22490e6fea978f3af8998091a20f SRR13662593.sra SRR13662593.sra file validated SRR13662593 is paired end SRR13662593 is conventional basespace SRR13662593 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662593_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.515 33.0 33.0 34.0 32.0 34.0 2 32.49475 33.0 33.0 34.0 31.0 34.0 3 32.14075 33.0 33.0 34.0 30.0 34.0 4 32.3785 33.0 33.0 34.0 31.0 34.0 5 32.446 33.0 33.0 34.0 31.0 34.0 6 36.11 38.0 36.0 38.0 33.0 38.0 7 36.54975 38.0 37.0 38.0 34.0 38.0 8 36.6405 38.0 38.0 38.0 34.0 38.0 9 36.8165 38.0 38.0 38.0 35.0 38.0 10-11 36.60625 38.0 38.0 38.0 34.0 38.0 12-13 36.569874999999996 38.0 38.0 38.0 34.0 38.0 14-15 36.75975 38.0 38.0 38.0 34.0 38.0 16-17 36.67075 38.0 38.0 38.0 34.0 38.0 18-19 36.820499999999996 38.0 38.0 38.0 35.0 38.0 20-21 36.77 38.0 38.0 38.0 34.0 38.0 22-23 36.74425 38.0 38.0 38.0 34.0 38.0 24-25 36.827625 38.0 38.0 38.0 35.0 38.0 26-27 36.774249999999995 38.0 38.0 38.0 34.5 38.0 28-29 36.802875 38.0 38.0 38.0 34.5 38.0 30-31 36.738125 38.0 38.0 38.0 34.5 38.0 32-33 36.656375 38.0 38.0 38.0 34.0 38.0 34-35 36.60075 38.0 38.0 38.0 34.0 38.0 36-37 36.702875000000006 38.0 38.0 38.0 34.0 38.0 38-39 36.696625 38.0 38.0 38.0 34.0 38.0 40-41 36.717375000000004 38.0 38.0 38.0 34.5 38.0 42-43 36.50425 38.0 38.0 38.0 34.0 38.0 44-45 36.540499999999994 38.0 38.0 38.0 34.0 38.0 46-47 36.6455 38.0 38.0 38.0 34.0 38.0 48-49 36.515125 38.0 38.0 38.0 34.0 38.0 50-51 36.435375 38.0 38.0 38.0 33.5 38.0 52-53 36.436499999999995 38.0 38.0 38.0 33.5 38.0 54-55 36.63475 38.0 38.0 38.0 34.0 38.0 56-57 36.50425 38.0 38.0 38.0 33.5 38.0 58-59 36.66475 38.0 38.0 38.0 34.0 38.0 60-61 36.635875 38.0 38.0 38.0 34.0 38.0 62-63 36.431375 38.0 38.0 38.0 33.5 38.0 64-65 36.29875 38.0 38.0 38.0 33.0 38.0 66-67 36.345875 38.0 38.0 38.0 33.5 38.0 68-69 36.4985 38.0 38.0 38.0 34.0 38.0 70-71 36.438375 38.0 38.0 38.0 33.5 38.0 72-73 36.075125 38.0 37.5 38.0 32.5 38.0 74-75 36.359624999999994 38.0 38.0 38.0 33.5 38.0 76-77 36.472125 38.0 38.0 38.0 34.0 38.0 78-79 36.191125 38.0 38.0 38.0 33.0 38.0 80-81 36.278625 38.0 38.0 38.0 33.0 38.0 82-83 36.070875 38.0 37.5 38.0 32.0 38.0 84-85 36.235625 38.0 37.5 38.0 33.5 38.0 86-87 35.96125 38.0 37.5 38.0 31.5 38.0 88-89 35.868875 38.0 37.5 38.0 32.0 38.0 90-91 35.940749999999994 38.0 37.5 38.0 32.0 38.0 92-93 35.7305 38.0 37.0 38.0 31.0 38.0 94-95 35.813500000000005 38.0 37.0 38.0 32.0 38.0 96-97 35.665499999999994 38.0 37.0 38.0 31.0 38.0 98-99 35.884625 38.0 37.0 38.0 32.5 38.0 100-101 35.684250000000006 38.0 37.0 38.0 31.0 38.0 102-103 35.54875 38.0 36.5 38.0 30.5 38.0 104-105 35.70725 38.0 37.0 38.0 31.0 38.0 106-107 35.21 38.0 36.0 38.0 28.5 38.0 108-109 35.59 38.0 36.5 38.0 31.0 38.0 110-111 35.54025 38.0 37.0 38.0 31.0 38.0 112-113 35.596125 38.0 36.5 38.0 31.0 38.0 114-115 35.204 38.0 36.0 38.0 29.5 38.0 116-117 35.091499999999996 38.0 36.0 38.0 29.5 38.0 118-119 34.964625 38.0 36.0 38.0 28.0 38.0 120-121 34.631375 38.0 35.5 38.0 26.0 38.0 122-123 34.169124999999994 38.0 35.0 38.0 23.5 38.0 124-125 33.739875 38.0 35.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 2.0 17 1.0 18 3.0 19 2.0 20 3.0 21 7.0 22 4.0 23 8.0 24 16.0 25 16.0 26 32.0 27 33.0 28 59.0 29 54.0 30 64.0 31 72.0 32 105.0 33 157.0 34 194.0 35 266.0 36 564.0 37 2336.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.825 11.175 9.3 37.7 2 32.975 16.175 28.225 22.625 3 29.125 23.849999999999998 18.775 28.249999999999996 4 33.650000000000006 26.825 16.150000000000002 23.375 5 31.25 30.325000000000003 17.974999999999998 20.45 6 24.45 33.675 19.225 22.650000000000002 7 22.125 16.55 36.85 24.474999999999998 8 23.425 20.474999999999998 25.25 30.85 9 23.849999999999998 19.625 28.575 27.950000000000003 10-11 27.900000000000002 27.9125 19.112499999999997 25.074999999999996 12-13 26.275 21.4875 25.374999999999996 26.8625 14-15 25.2125 23.5875 24.375 26.825 16-17 26.9125 22.575 23.325000000000003 27.187499999999996 18-19 26.237500000000004 22.875 24.375 26.5125 20-21 26.7125 23.4375 23.8875 25.9625 22-23 27.037499999999998 23.2375 23.275000000000002 26.450000000000003 24-25 27.150000000000002 23.65 22.2625 26.937499999999996 26-27 27.075 23.925 22.6 26.400000000000002 28-29 27.3625 23.599999999999998 22.275 26.7625 30-31 26.787499999999998 22.9625 23.474999999999998 26.775 32-33 26.85 24.275 22.4375 26.437500000000004 34-35 26.687499999999996 23.425 22.75 27.1375 36-37 26.237500000000004 23.35 22.975 27.437499999999996 38-39 26.724999999999998 23.4625 23.5375 26.275 40-41 27.0125 24.1375 22.85 26.0 42-43 27.3125 22.925 23.0 26.7625 44-45 26.375 24.525 22.4875 26.6125 46-47 27.462500000000002 23.3125 22.8375 26.387500000000003 48-49 26.4125 23.05 23.0625 27.474999999999998 50-51 27.075 23.150000000000002 23.0875 26.687499999999996 52-53 27.0625 23.75 23.3 25.887500000000003 54-55 27.900000000000002 22.875 22.575 26.650000000000002 56-57 27.0625 23.9125 22.8375 26.187500000000004 58-59 27.500000000000004 23.35 22.2 26.950000000000003 60-61 26.85 23.5875 22.425 27.1375 62-63 27.187499999999996 22.8 23.3 26.7125 64-65 26.525 23.2875 22.9625 27.224999999999998 66-67 26.2625 22.75 23.4625 27.525 68-69 26.85 23.6375 22.525000000000002 26.987499999999997 70-71 27.025 23.175 21.762500000000003 28.037499999999998 72-73 27.0125 23.549999999999997 22.45 26.987499999999997 74-75 27.3 22.575 23.1125 27.0125 76-77 27.287499999999998 23.425 22.7125 26.575 78-79 26.787499999999998 22.825 22.875 27.5125 80-81 26.6625 22.975 22.7375 27.625 82-83 26.974999999999998 23.1625 22.95 26.9125 84-85 27.750000000000004 22.55 22.5 27.200000000000003 86-87 27.0125 22.900000000000002 22.525000000000002 27.5625 88-89 27.5875 22.8 22.6 27.0125 90-91 27.400000000000002 23.200000000000003 22.3625 27.037499999999998 92-93 26.9625 23.35 22.650000000000002 27.037499999999998 94-95 26.8 23.0875 22.2125 27.900000000000002 96-97 26.724999999999998 23.275000000000002 22.35 27.650000000000002 98-99 27.55 22.875 22.875 26.700000000000003 100-101 27.787499999999998 22.537499999999998 22.725 26.950000000000003 102-103 26.450000000000003 22.5875 22.275 28.6875 104-105 26.85 23.1375 22.912499999999998 27.1 106-107 26.3625 22.9375 23.1125 27.5875 108-109 27.0625 22.075 23.5 27.3625 110-111 26.400000000000002 23.1875 22.55 27.8625 112-113 27.1625 22.9875 22.55 27.3 114-115 26.5875 22.8375 22.8625 27.712500000000002 116-117 27.250000000000004 22.675 22.8375 27.237499999999997 118-119 26.3125 22.650000000000002 22.45 28.5875 120-121 26.737499999999997 23.3125 22.675 27.275 122-123 27.1625 22.95 22.4625 27.425 124-125 27.1125 23.0 22.95 26.937499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 1.0 27 2.0 28 2.5 29 4.0 30 7.5 31 9.5 32 11.0 33 17.0 34 20.0 35 25.0 36 31.5 37 45.0 38 62.0 39 70.5 40 94.5 41 112.5 42 122.0 43 135.0 44 135.0 45 135.5 46 146.0 47 141.0 48 128.0 49 125.5 50 122.0 51 113.0 52 103.0 53 105.5 54 106.0 55 102.5 56 98.5 57 92.0 58 100.5 59 96.5 60 86.5 61 94.0 62 90.5 63 87.0 64 99.5 65 91.0 66 80.0 67 81.5 68 74.0 69 76.0 70 75.5 71 66.0 72 59.5 73 54.0 74 48.0 75 44.0 76 37.0 77 32.5 78 27.0 79 17.5 80 15.0 81 11.5 82 6.0 83 5.5 84 5.5 85 4.0 86 2.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662593 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662593_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.49125 33.0 32.0 34.0 27.0 34.0 2 31.29225 33.0 32.0 34.0 25.0 34.0 3 31.372 33.0 32.0 34.0 25.0 34.0 4 31.30725 33.0 32.0 34.0 27.0 34.0 5 31.0085 33.0 32.0 34.0 25.0 34.0 6 34.85 38.0 35.0 38.0 26.0 38.0 7 34.7755 38.0 36.0 38.0 26.0 38.0 8 34.99725 38.0 36.0 38.0 27.0 38.0 9 34.29 38.0 35.0 38.0 16.0 38.0 10-11 34.790875 38.0 35.5 38.0 26.5 38.0 12-13 35.116 38.0 36.0 38.0 27.5 38.0 14-15 34.996375 38.0 36.0 38.0 27.0 38.0 16-17 35.1215 38.0 36.0 38.0 27.5 38.0 18-19 34.717875 38.0 35.0 38.0 25.5 38.0 20-21 34.886125 38.0 36.0 38.0 26.0 38.0 22-23 35.132625 38.0 36.0 38.0 27.0 38.0 24-25 34.878 38.0 36.0 38.0 26.0 38.0 26-27 35.109125000000006 38.0 36.0 38.0 27.0 38.0 28-29 34.739374999999995 38.0 35.5 38.0 25.5 38.0 30-31 34.583625 38.0 35.5 38.0 20.5 38.0 32-33 34.810375 38.0 35.5 38.0 26.0 38.0 34-35 35.161375 38.0 36.0 38.0 27.0 38.0 36-37 34.56925 38.0 35.5 38.0 20.5 38.0 38-39 34.409375 38.0 34.5 38.0 20.5 38.0 40-41 34.854 38.0 35.5 38.0 26.0 38.0 42-43 35.093374999999995 38.0 36.0 38.0 27.0 38.0 44-45 35.10325 38.0 36.0 38.0 27.0 38.0 46-47 34.957375 38.0 36.0 38.0 26.0 38.0 48-49 34.762 38.0 35.5 38.0 25.0 38.0 50-51 34.545 38.0 35.0 38.0 24.5 38.0 52-53 35.303875000000005 38.0 36.0 38.0 28.0 38.0 54-55 35.4725 38.0 36.5 38.0 28.5 38.0 56-57 35.441874999999996 38.0 37.0 38.0 28.5 38.0 58-59 35.526875000000004 38.0 36.5 38.0 28.5 38.0 60-61 35.562124999999995 38.0 36.5 38.0 29.0 38.0 62-63 35.19025 38.0 36.0 38.0 27.5 38.0 64-65 35.006875 38.0 35.5 38.0 26.0 38.0 66-67 34.667 38.0 35.5 38.0 25.0 38.0 68-69 35.4725 38.0 36.0 38.0 28.5 38.0 70-71 35.313125 38.0 36.0 38.0 28.0 38.0 72-73 35.097875 38.0 36.0 38.0 27.0 38.0 74-75 35.170625 38.0 36.0 38.0 27.5 38.0 76-77 35.395125 38.0 36.5 38.0 28.0 38.0 78-79 35.011250000000004 38.0 35.5 38.0 26.5 38.0 80-81 35.0645 38.0 35.5 38.0 27.0 38.0 82-83 34.91175 38.0 36.0 38.0 26.0 38.0 84-85 35.17575 38.0 36.0 38.0 27.5 38.0 86-87 34.991875 38.0 36.0 38.0 27.0 38.0 88-89 34.781375 38.0 36.0 38.0 25.0 38.0 90-91 35.246625 38.0 36.0 38.0 28.5 38.0 92-93 35.16375 38.0 36.0 38.0 28.0 38.0 94-95 35.2545 38.0 36.0 38.0 29.0 38.0 96-97 34.921375 38.0 35.5 38.0 27.0 38.0 98-99 34.786625 38.0 35.5 38.0 26.0 38.0 100-101 34.474125 38.0 35.0 38.0 24.0 38.0 102-103 34.462 38.0 35.0 38.0 24.0 38.0 104-105 34.31 38.0 35.0 38.0 22.5 38.0 106-107 34.48375 38.0 35.0 38.0 23.5 38.0 108-109 34.132125 38.0 35.0 38.0 22.0 38.0 110-111 34.5465 38.0 35.0 38.0 24.5 38.0 112-113 34.5475 38.0 35.0 38.0 25.0 38.0 114-115 33.99025 38.0 35.0 38.0 22.0 38.0 116-117 34.50512500000001 38.0 35.0 38.0 26.0 38.0 118-119 34.029375 38.0 35.0 38.0 22.0 38.0 120-121 33.8115 38.0 35.0 38.0 22.0 38.0 122-123 33.47325 38.0 35.0 38.0 18.0 38.0 124-125 32.95725 38.0 34.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 3.0 14 5.0 15 7.0 16 10.0 17 6.0 18 13.0 19 10.0 20 19.0 21 23.0 22 35.0 23 37.0 24 37.0 25 52.0 26 59.0 27 73.0 28 84.0 29 82.0 30 104.0 31 127.0 32 155.0 33 184.0 34 221.0 35 291.0 36 458.0 37 1903.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.150000000000006 10.85 9.775 39.225 2 31.275 16.625 29.325000000000003 22.775000000000002 3 29.349999999999998 21.95 19.55 29.15 4 30.9 29.65 16.900000000000002 22.55 5 31.225 29.675 19.375 19.725 6 23.674999999999997 33.175 19.875 23.275000000000002 7 22.975 15.65 36.875 24.5 8 23.025000000000002 20.05 26.25 30.675 9 24.0 18.5 28.299999999999997 29.2 10-11 27.762500000000003 28.499999999999996 19.5 24.2375 12-13 24.9125 20.6875 26.025 28.375 14-15 25.4875 22.75 25.0625 26.700000000000003 16-17 27.187499999999996 23.3625 23.45 26.0 18-19 26.424999999999997 22.45 24.15 26.974999999999998 20-21 26.174999999999997 23.474999999999998 24.087500000000002 26.2625 22-23 26.575 24.025 23.25 26.150000000000002 24-25 27.3375 23.4125 23.7375 25.5125 26-27 26.9625 23.3125 23.35 26.375 28-29 26.8 23.3375 23.674999999999997 26.187500000000004 30-31 26.55 23.45 22.95 27.05 32-33 27.187499999999996 23.8375 22.475 26.5 34-35 26.924999999999997 24.2375 22.662499999999998 26.174999999999997 36-37 26.637499999999996 22.925 23.4375 27.0 38-39 26.8125 23.5 23.150000000000002 26.5375 40-41 28.1125 22.275 23.05 26.5625 42-43 25.924999999999997 22.662499999999998 23.6875 27.725 44-45 26.5125 23.225 22.5625 27.700000000000003 46-47 27.1125 23.3375 22.662499999999998 26.887499999999996 48-49 27.1375 22.8125 23.1625 26.887499999999996 50-51 26.75 22.2625 23.875 27.1125 52-53 27.1625 21.9625 23.8375 27.037499999999998 54-55 26.637499999999996 23.7125 22.900000000000002 26.75 56-57 27.075 22.425 23.05 27.450000000000003 58-59 27.625 23.0625 22.75 26.5625 60-61 27.125 22.875 23.4375 26.5625 62-63 27.3 23.3 23.3875 26.0125 64-65 27.425 22.3625 23.2375 26.974999999999998 66-67 26.887499999999996 22.3875 23.4125 27.3125 68-69 27.0625 23.0 23.225 26.7125 70-71 27.437499999999996 22.037499999999998 22.825 27.700000000000003 72-73 27.450000000000003 22.3375 22.7 27.5125 74-75 27.275 22.3625 23.175 27.187499999999996 76-77 27.3375 22.8875 22.675 27.1 78-79 27.212500000000002 22.3875 23.549999999999997 26.85 80-81 26.0 22.6875 23.4375 27.875 82-83 26.900000000000002 23.0875 23.200000000000003 26.8125 84-85 26.9625 22.075 23.65 27.3125 86-87 27.0125 22.3625 22.900000000000002 27.725 88-89 27.725 22.7625 22.7375 26.775 90-91 27.0 22.425 23.325000000000003 27.250000000000004 92-93 27.025 23.200000000000003 22.237499999999997 27.537499999999998 94-95 27.900000000000002 22.9375 22.9375 26.224999999999998 96-97 27.85 22.425 22.8 26.924999999999997 98-99 26.887499999999996 21.9375 23.125 28.050000000000004 100-101 27.150000000000002 22.9625 22.6875 27.200000000000003 102-103 27.325 22.4625 22.787499999999998 27.425 104-105 26.9625 23.474999999999998 22.6375 26.924999999999997 106-107 26.724999999999998 23.075000000000003 23.5 26.700000000000003 108-109 26.85 22.275 23.325000000000003 27.55 110-111 27.762500000000003 22.787499999999998 22.6875 26.7625 112-113 27.675 22.8375 23.1375 26.35 114-115 26.55 22.787499999999998 23.5125 27.150000000000002 116-117 27.2625 22.8 22.237499999999997 27.700000000000003 118-119 26.5125 22.4875 23.5875 27.4125 120-121 27.1625 23.425 22.5625 26.85 122-123 27.3625 22.900000000000002 23.525 26.2125 124-125 27.800000000000004 22.525000000000002 23.3 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 5.0 29 7.5 30 9.0 31 10.0 32 9.5 33 12.5 34 17.5 35 24.5 36 35.5 37 53.0 38 67.5 39 76.0 40 83.5 41 93.0 42 112.5 43 125.0 44 137.5 45 138.0 46 140.5 47 141.5 48 129.0 49 128.5 50 127.0 51 127.5 52 121.0 53 112.5 54 110.5 55 102.0 56 92.5 57 86.5 58 87.5 59 82.5 60 81.5 61 94.0 62 103.0 63 107.5 64 100.0 65 94.0 66 84.5 67 75.0 68 87.5 69 87.0 70 70.5 71 66.0 72 57.5 73 48.5 74 48.5 75 40.5 76 28.0 77 27.0 78 20.5 79 12.5 80 14.0 81 12.0 82 10.5 83 8.0 84 2.5 85 3.0 86 3.0 87 1.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32024169184291 98.625 2 0.6545820745216516 1.3 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689871 spots for SRR13662593.sra Written 689871 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra Read 689868 spots for SRR13662593.sra Written 689868 spots for SRR13662593.sra SRR ids: ['SRR13662593.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z7t2u76w SRR13662593.sra spots: 13797363 blocks: [[1, 689868], [689869, 1379736], [1379737, 2069604], [2069605, 2759472], [2759473, 3449340], [3449341, 4139208], [4139209, 4829076], [4829077, 5518944], [5518945, 6208812], [6208813, 6898680], [6898681, 7588548], [7588549, 8278416], [8278417, 8968284], [8968285, 9658152], [9658153, 10348020], [10348021, 11037888], [11037889, 11727756], [11727757, 12417624], [12417625, 13107492], [13107493, 13797363]] SRR13662593 file size 3966599 SRR13662593 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662593 SRR13662593_1.fastq SRR13662593_2.fastq Input file: SRR13662593_1.fastq Paired file: SRR13662593_2.fastq trimmed: SRR13662593-trimmed-pair1.fastq, SRR13662593-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:50:35 2024 >> started Tue Dec 10 07:50:51 2024 >> done (16.669s) 13797363 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 534 ( 0.00%) empty read pairs filtered out after trimming by size control 13796827 (100.00%) read pairs available; of these: 1847534 (13.39%) trimmed read pairs available after processing 11949293 (86.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 2 0.00% 35 0 0.00% 36 0 0.00% 37 1 0.00% 38 0 0.00% 39 1 0.00% 40 1 0.00% 41 1 0.00% 42 2 0.00% 43 0 0.00% 44 0 0.00% 45 1 0.00% 46 1 0.00% 47 0 0.00% 48 2 0.00% 49 1 0.00% 50 0 0.00% 51 1 0.00% 52 2 0.00% 53 2 0.00% 54 3 0.00% 55 1 0.00% 56 6 0.00% 57 9 0.00% 58 10 0.00% 59 4 0.00% 60 12 0.00% 61 7 0.00% 62 14 0.00% 63 35 0.00% 64 71 0.00% 65 84 0.00% 66 93 0.00% 67 130 0.00% 68 157 0.00% 69 147 0.00% 70 202 0.00% 71 235 0.00% 72 265 0.00% 73 273 0.00% 74 292 0.00% 75 346 0.00% 76 368 0.00% 77 423 0.00% 78 432 0.00% 79 508 0.00% 80 530 0.00% 81 577 0.00% 82 624 0.00% 83 671 0.00% 84 803 0.01% 85 825 0.01% 86 954 0.01% 87 989 0.01% 88 1066 0.01% 89 1177 0.01% 90 1314 0.01% 91 1575 0.01% 92 1872 0.01% 93 2237 0.02% 94 5883 0.04% 95 5894 0.04% 96 6246 0.05% 97 6597 0.05% 98 6859 0.05% 99 7421 0.05% 100 7593 0.06% 101 7927 0.06% 102 8173 0.06% 103 8652 0.06% 104 9063 0.07% 105 9360 0.07% 106 10105 0.07% 107 10634 0.08% 108 11057 0.08% 109 12068 0.09% 110 13279 0.10% 111 14795 0.11% 112 16167 0.12% 113 17961 0.13% 114 19701 0.14% 115 22371 0.16% 116 54220 0.39% 117 61472 0.45% 118 69804 0.51% 119 80886 0.59% 120 98303 0.71% 121 124862 0.91% 122 173474 1.26% 123 277826 2.01% 124 649518 4.71% 125 11949293 86.61% 13796827 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=21 prefix-density=0.31 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=143.07 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=19.5 sequence=CGGCGGCGGCGCC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=146.86 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=19.8 sequence=CGGCGGCGGCGCC SRR13662593 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:51:40 Started mapping on | Dec 10 07:51:40 Finished on | Dec 10 07:52:42 Mapping speed, Million of reads per hour | 801.11 Number of input reads | 13796827 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 12583239 Uniquely mapped reads % | 91.20% Average mapped length | 246.27 Number of splices: Total | 9350317 Number of splices: Annotated (sjdb) | 8763100 Number of splices: GT/AG | 9213995 Number of splices: GC/AG | 109859 Number of splices: AT/AC | 4074 Number of splices: Non-canonical | 22389 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443053 % of reads mapped to multiple loci | 3.21% Number of reads mapped to too many loci | 67069 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.29% % of reads unmapped: other | 2.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 770634 770634 770634 N_multimapping 443053 443053 443053 N_noFeature 532025 6440912 6444621 N_ambiguous 291295 32116 33041 UnstrandedReadsAssigned:11759919 PositiveStrandReadsAssigned:6110211 NegativeStrandReadsAssigned:6105577 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662593 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662593-trimmed-pair1.fastq SRR13662593-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,796,827 reads, 12,302,803 reads pseudoaligned [quant] estimated average fragment length: 191.121 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52973 SRR13662593.ke.tsv 35125 SRR13662593.se.tsv 88098 total ==> SRR13662593.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 746.035 0 0 PNS24247 1044 853.879 26.8261 3.24756 PNS24249 1928 1737.88 154.091 9.16542 PNS24246 1044 853.879 26.8261 3.24756 PNS24248 1044 853.879 26.8261 3.24756 PNS24244 1471 1280.88 14.4309 1.16461 PNS24243 293 108.878 12 11.393 KQK14069 1603 1412.88 10022 733.239 KQK14071 474 285.704 1913.56 692.342 ==> SRR13662593.se.tsv <== BRADI_1g14170v3 12789 BRADI_1g53295v3 21 BRADI_1g59795v3 381 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 67 BRADI_1g74790v3 113 BRADI_1g09890v3 0 BRADI_1g77505v3 246 BRADI_1g48960v3 0 SRR13662593 completed mapping pipeline successfully