Starting /dee2/code/volunteer_pipeline.sh SRR13662594 current disk space = 1526755241984 free memory = 1602033664 SRR13662594 SRAfilesize e30844fccfd493f45cabc7a2b865bf08 SRR13662594.sra SRR13662594.sra file validated SRR13662594 is paired end SRR13662594 is conventional basespace SRR13662594 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662594_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.526 33.0 33.0 34.0 31.0 34.0 2 32.65425 34.0 33.0 34.0 31.0 34.0 3 32.63675 34.0 33.0 34.0 31.0 34.0 4 32.592 34.0 33.0 34.0 31.0 34.0 5 32.61075 34.0 33.0 34.0 31.0 34.0 6 36.093 38.0 36.0 38.0 31.0 38.0 7 36.633 38.0 38.0 38.0 34.0 38.0 8 36.76775 38.0 38.0 38.0 34.0 38.0 9 36.927 38.0 38.0 38.0 35.0 38.0 10-11 36.90375 38.0 38.0 38.0 35.0 38.0 12-13 36.876625 38.0 38.0 38.0 34.5 38.0 14-15 36.864 38.0 38.0 38.0 35.0 38.0 16-17 36.889125 38.0 38.0 38.0 35.0 38.0 18-19 36.951625 38.0 38.0 38.0 35.0 38.0 20-21 36.838625 38.0 38.0 38.0 35.0 38.0 22-23 36.834999999999994 38.0 38.0 38.0 35.0 38.0 24-25 36.842124999999996 38.0 38.0 38.0 35.0 38.0 26-27 36.795125 38.0 38.0 38.0 35.0 38.0 28-29 36.786625 38.0 38.0 38.0 35.0 38.0 30-31 36.783249999999995 38.0 38.0 38.0 35.0 38.0 32-33 36.750375000000005 38.0 38.0 38.0 34.5 38.0 34-35 36.755125 38.0 38.0 38.0 34.0 38.0 36-37 36.694625 38.0 38.0 38.0 34.5 38.0 38-39 36.756625 38.0 38.0 38.0 35.0 38.0 40-41 36.691874999999996 38.0 38.0 38.0 34.5 38.0 42-43 36.711875 38.0 38.0 38.0 34.5 38.0 44-45 36.628125 38.0 38.0 38.0 34.0 38.0 46-47 36.66875 38.0 38.0 38.0 34.0 38.0 48-49 36.6935 38.0 38.0 38.0 34.0 38.0 50-51 36.648375 38.0 38.0 38.0 34.0 38.0 52-53 36.632875 38.0 38.0 38.0 34.0 38.0 54-55 36.614875 38.0 38.0 38.0 34.0 38.0 56-57 36.60875 38.0 38.0 38.0 34.0 38.0 58-59 36.569 38.0 38.0 38.0 34.0 38.0 60-61 36.550250000000005 38.0 38.0 38.0 34.0 38.0 62-63 36.503125 38.0 38.0 38.0 34.0 38.0 64-65 36.42475 38.0 38.0 38.0 34.0 38.0 66-67 36.57225 38.0 38.0 38.0 34.0 38.0 68-69 36.57575 38.0 38.0 38.0 34.0 38.0 70-71 36.428 38.0 38.0 38.0 34.0 38.0 72-73 36.44525 38.0 38.0 38.0 34.0 38.0 74-75 36.444874999999996 38.0 38.0 38.0 34.0 38.0 76-77 36.49875 38.0 38.0 38.0 34.0 38.0 78-79 36.403375 38.0 38.0 38.0 33.5 38.0 80-81 36.447500000000005 38.0 38.0 38.0 34.0 38.0 82-83 36.347750000000005 38.0 38.0 38.0 34.0 38.0 84-85 36.270125 38.0 38.0 38.0 34.0 38.0 86-87 36.19525 38.0 38.0 38.0 33.5 38.0 88-89 36.234750000000005 38.0 38.0 38.0 33.0 38.0 90-91 36.190625 38.0 38.0 38.0 33.0 38.0 92-93 36.110749999999996 38.0 38.0 38.0 33.0 38.0 94-95 36.01775000000001 38.0 37.0 38.0 33.0 38.0 96-97 36.070375 38.0 37.5 38.0 33.0 38.0 98-99 35.958749999999995 38.0 37.0 38.0 33.0 38.0 100-101 35.925 38.0 37.5 38.0 32.5 38.0 102-103 35.910875 38.0 37.0 38.0 33.0 38.0 104-105 35.816125 38.0 37.0 38.0 31.5 38.0 106-107 35.74575 38.0 37.0 38.0 31.0 38.0 108-109 35.794624999999996 38.0 37.0 38.0 31.5 38.0 110-111 35.6935 38.0 37.0 38.0 31.0 38.0 112-113 35.755250000000004 38.0 37.0 38.0 32.0 38.0 114-115 35.754875 38.0 37.0 38.0 32.0 38.0 116-117 35.444874999999996 38.0 36.0 38.0 30.0 38.0 118-119 35.24875 38.0 36.0 38.0 29.0 38.0 120-121 35.3475 38.0 36.0 38.0 31.0 38.0 122-123 35.356875 38.0 36.0 38.0 31.0 38.0 124-125 34.927875 38.0 36.0 38.0 31.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 4.0 18 6.0 19 5.0 20 2.0 21 3.0 22 0.0 23 7.0 24 7.0 25 12.0 26 19.0 27 31.0 28 33.0 29 69.0 30 66.0 31 78.0 32 101.0 33 130.0 34 177.0 35 241.0 36 447.0 37 2559.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.725 12.35 9.55 36.375 2 31.125000000000004 17.375 27.950000000000003 23.549999999999997 3 28.425 23.525 18.975 29.075 4 29.557389347336834 29.557389347336834 17.62940735183796 23.25581395348837 5 30.95 29.349999999999998 19.35 20.349999999999998 6 23.775 35.05 18.875 22.3 7 22.275 15.425 37.25 25.05 8 24.175 20.7 24.325 30.8 9 25.05 19.650000000000002 27.625 27.675 10-11 27.025 28.175 19.625 25.174999999999997 12-13 25.900000000000002 21.512500000000003 26.0 26.5875 14-15 25.937500000000004 23.1125 24.325 26.625 16-17 26.6125 23.674999999999997 23.474999999999998 26.237500000000004 18-19 25.900000000000002 24.1375 23.3875 26.575 20-21 25.8125 23.5375 23.962500000000002 26.687499999999996 22-23 26.9125 23.150000000000002 23.400000000000002 26.5375 24-25 26.674999999999997 24.462500000000002 22.237499999999997 26.625 26-27 26.937499999999996 24.099999999999998 22.95 26.0125 28-29 26.987499999999997 23.7625 23.175 26.075 30-31 26.737499999999997 23.575 23.6375 26.05 32-33 26.75 24.887500000000003 22.4875 25.874999999999996 34-35 26.950000000000003 23.925 22.5625 26.5625 36-37 26.5 24.0375 23.0125 26.450000000000003 38-39 26.5625 23.0625 23.5 26.875 40-41 27.187499999999996 23.0625 23.3125 26.437500000000004 42-43 27.125 23.0125 23.1125 26.75 44-45 25.825 23.6375 23.7125 26.825 46-47 26.4125 23.575 23.1625 26.85 48-49 25.9625 23.799999999999997 23.724999999999998 26.5125 50-51 27.0125 23.7625 22.875 26.35 52-53 26.8 23.05 23.4625 26.687499999999996 54-55 25.825 24.05 22.725 27.400000000000002 56-57 28.025 23.45 22.5125 26.0125 58-59 26.7625 23.5125 22.775000000000002 26.950000000000003 60-61 27.2625 24.0125 23.2625 25.4625 62-63 26.825 23.65 22.8375 26.687499999999996 64-65 26.1625 22.95 23.6125 27.275 66-67 25.775 23.1125 23.400000000000002 27.712500000000002 68-69 25.874999999999996 24.0375 22.9625 27.125 70-71 27.400000000000002 23.125 22.3625 27.1125 72-73 26.25 23.1625 23.4875 27.1 74-75 26.0375 23.674999999999997 22.9625 27.325 76-77 27.575 23.35 22.825 26.25 78-79 26.674999999999997 23.5 23.6375 26.187500000000004 80-81 27.125 22.95 23.724999999999998 26.200000000000003 82-83 26.3625 23.2125 22.4875 27.9375 84-85 25.9625 24.325 23.4375 26.275 86-87 25.837500000000002 24.0375 22.575 27.55 88-89 26.0125 23.1375 23.275000000000002 27.575 90-91 27.175 22.9625 23.025000000000002 26.8375 92-93 26.75 23.599999999999998 22.912499999999998 26.737499999999997 94-95 27.3 22.825 23.025000000000002 26.85 96-97 27.075 23.9375 22.275 26.7125 98-99 26.974999999999998 23.375 23.1375 26.5125 100-101 26.525 23.5 23.2875 26.687499999999996 102-103 26.25 23.2625 23.400000000000002 27.0875 104-105 26.3625 23.2875 22.975 27.375 106-107 26.437500000000004 23.375 23.2875 26.900000000000002 108-109 26.3 22.825 23.4625 27.4125 110-111 26.937499999999996 23.7125 22.650000000000002 26.700000000000003 112-113 26.55 23.2125 23.4125 26.825 114-115 26.4125 23.1875 23.3875 27.0125 116-117 26.775 23.7875 23.1125 26.325 118-119 26.85 23.1375 23.150000000000002 26.8625 120-121 26.375 24.4 22.8625 26.3625 122-123 26.200000000000003 24.125 22.7125 26.9625 124-125 27.224999999999998 22.8875 22.175 27.712500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 3.0 27 3.5 28 6.5 29 9.5 30 9.0 31 7.5 32 9.5 33 14.5 34 25.5 35 34.5 36 36.0 37 46.0 38 63.0 39 83.0 40 101.5 41 109.0 42 118.0 43 137.0 44 150.0 45 143.0 46 145.5 47 147.0 48 139.5 49 138.0 50 137.5 51 133.5 52 107.5 53 95.5 54 103.5 55 89.5 56 76.5 57 74.5 58 80.0 59 85.5 60 87.5 61 94.0 62 90.5 63 81.0 64 80.0 65 85.0 66 76.0 67 76.0 68 84.0 69 83.0 70 80.0 71 73.0 72 64.0 73 48.0 74 41.0 75 43.0 76 34.0 77 27.5 78 20.5 79 17.0 80 18.5 81 11.0 82 5.5 83 4.5 84 2.5 85 1.0 86 1.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37106918238993 98.75 2 0.628930817610063 1.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.025 0.0 0.0 100-101 0.0 0.0 0.025 0.0 0.0 102-103 0.0 0.0 0.025 0.0 0.0 104-105 0.0 0.0 0.025 0.0 0.0 106-107 0.0 0.0 0.025 0.0 0.0 108-109 0.0 0.0 0.025 0.0 0.0 110-111 0.0 0.0 0.025 0.0 0.0 112-113 0.0 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGAGC 15 0.0040846216 59.5 84-85 >>END_MODULE SRR13662594 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662594_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.19375 33.0 33.0 34.0 31.0 34.0 2 32.246 33.0 33.0 34.0 31.0 34.0 3 32.317 33.0 33.0 34.0 31.0 34.0 4 32.2375 33.0 33.0 34.0 31.0 34.0 5 32.21075 33.0 33.0 34.0 31.0 34.0 6 36.1535 38.0 38.0 38.0 32.0 38.0 7 36.23775 38.0 38.0 38.0 33.0 38.0 8 36.251 38.0 38.0 38.0 33.0 38.0 9 36.15475 38.0 38.0 38.0 33.0 38.0 10-11 36.209125 38.0 38.0 38.0 33.0 38.0 12-13 36.2175 38.0 38.0 38.0 33.0 38.0 14-15 36.21525 38.0 38.0 38.0 33.0 38.0 16-17 36.23325 38.0 38.0 38.0 33.0 38.0 18-19 36.0665 38.0 38.0 38.0 32.0 38.0 20-21 36.1935 38.0 38.0 38.0 33.0 38.0 22-23 36.130625 38.0 38.0 38.0 32.5 38.0 24-25 36.111875 38.0 38.0 38.0 32.0 38.0 26-27 36.18025 38.0 38.0 38.0 33.0 38.0 28-29 35.99525 38.0 38.0 38.0 31.5 38.0 30-31 36.283500000000004 38.0 38.0 38.0 33.0 38.0 32-33 36.191874999999996 38.0 38.0 38.0 33.0 38.0 34-35 36.18825 38.0 38.0 38.0 33.0 38.0 36-37 36.204750000000004 38.0 38.0 38.0 33.0 38.0 38-39 36.114374999999995 38.0 38.0 38.0 33.0 38.0 40-41 36.191874999999996 38.0 38.0 38.0 32.5 38.0 42-43 36.06525 38.0 37.5 38.0 32.0 38.0 44-45 36.0985 38.0 37.5 38.0 33.0 38.0 46-47 36.20025 38.0 37.5 38.0 33.0 38.0 48-49 36.176500000000004 38.0 38.0 38.0 33.0 38.0 50-51 36.168625 38.0 38.0 38.0 33.0 38.0 52-53 36.073375 38.0 37.0 38.0 32.0 38.0 54-55 36.084875 38.0 37.5 38.0 32.5 38.0 56-57 36.10225 38.0 37.5 38.0 32.0 38.0 58-59 35.966625 38.0 37.0 38.0 31.0 38.0 60-61 36.07 38.0 37.0 38.0 32.5 38.0 62-63 36.025375 38.0 37.0 38.0 32.0 38.0 64-65 36.071875000000006 38.0 37.5 38.0 32.5 38.0 66-67 35.96775 38.0 37.0 38.0 31.0 38.0 68-69 35.959125 38.0 37.0 38.0 31.0 38.0 70-71 35.97725 38.0 37.0 38.0 31.0 38.0 72-73 35.910375 38.0 37.0 38.0 31.5 38.0 74-75 35.93625 38.0 37.0 38.0 31.5 38.0 76-77 35.812124999999995 38.0 37.0 38.0 31.0 38.0 78-79 35.785624999999996 38.0 37.0 38.0 31.0 38.0 80-81 35.5295 38.0 37.0 38.0 29.5 38.0 82-83 35.589625 38.0 37.0 38.0 29.5 38.0 84-85 35.593875 38.0 37.0 38.0 30.5 38.0 86-87 35.603875 38.0 37.0 38.0 31.0 38.0 88-89 35.689750000000004 38.0 37.0 38.0 30.5 38.0 90-91 35.51925 38.0 37.0 38.0 30.0 38.0 92-93 35.45975 38.0 36.5 38.0 30.0 38.0 94-95 35.588125 38.0 37.0 38.0 31.0 38.0 96-97 35.40175 38.0 36.5 38.0 30.0 38.0 98-99 35.237125 38.0 36.0 38.0 29.0 38.0 100-101 35.103875 38.0 36.0 38.0 28.0 38.0 102-103 35.187124999999995 38.0 36.0 38.0 28.5 38.0 104-105 35.165375 38.0 36.0 38.0 28.0 38.0 106-107 34.929375 38.0 35.5 38.0 26.5 38.0 108-109 34.890625 38.0 36.0 38.0 27.0 38.0 110-111 34.843875 38.0 35.5 38.0 27.0 38.0 112-113 34.814625 38.0 36.0 38.0 27.5 38.0 114-115 34.725875 38.0 35.0 38.0 26.5 38.0 116-117 34.591499999999996 38.0 35.0 38.0 25.5 38.0 118-119 34.483625 38.0 35.0 38.0 24.0 38.0 120-121 34.5245 38.0 35.0 38.0 25.5 38.0 122-123 34.126000000000005 38.0 35.0 38.0 23.5 38.0 124-125 33.9065 38.0 35.0 38.0 23.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 2.0 15 5.0 16 6.0 17 9.0 18 7.0 19 5.0 20 7.0 21 16.0 22 9.0 23 25.0 24 23.0 25 28.0 26 38.0 27 51.0 28 65.0 29 74.0 30 76.0 31 119.0 32 106.0 33 115.0 34 178.0 35 251.0 36 481.0 37 2302.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.275 10.875 10.65 36.199999999999996 2 33.074999999999996 16.900000000000002 26.974999999999998 23.05 3 27.950000000000003 23.3 20.225 28.525 4 32.175 28.599999999999998 16.025 23.200000000000003 5 31.025000000000002 30.45 18.85 19.675 6 24.95 33.4 19.175 22.475 7 22.675 15.950000000000001 36.65 24.725 8 24.5 20.275000000000002 24.75 30.475 9 25.575 19.7 26.625 28.1 10-11 26.6625 28.975 19.575 24.7875 12-13 25.4875 22.3125 25.900000000000002 26.3 14-15 26.5375 23.25 24.4875 25.724999999999998 16-17 26.5625 23.474999999999998 23.1 26.8625 18-19 26.224999999999998 23.8375 23.3375 26.6 20-21 26.35 24.1375 23.5 26.0125 22-23 26.275 24.087500000000002 23.45 26.187500000000004 24-25 26.5875 23.775 23.6375 26.0 26-27 27.3375 23.962500000000002 23.2125 25.4875 28-29 27.987499999999997 23.6875 22.287499999999998 26.0375 30-31 26.950000000000003 23.875 22.6875 26.487500000000004 32-33 26.3625 23.849999999999998 23.0625 26.724999999999998 34-35 26.0125 23.4375 23.425 27.125 36-37 26.7125 23.4625 23.325000000000003 26.5 38-39 26.75 24.0 22.8 26.450000000000003 40-41 27.224999999999998 22.6875 23.275000000000002 26.8125 42-43 26.8 23.0625 23.425 26.7125 44-45 27.075 23.1 23.474999999999998 26.35 46-47 26.650000000000002 23.3375 23.225 26.787499999999998 48-49 26.6 23.9875 23.6875 25.724999999999998 50-51 26.950000000000003 23.2375 23.7 26.1125 52-53 27.187499999999996 22.725 22.475 27.6125 54-55 26.75 22.912499999999998 23.1375 27.200000000000003 56-57 27.037499999999998 23.9125 22.662499999999998 26.387500000000003 58-59 27.2625 23.1625 23.525 26.05 60-61 26.1 23.5 23.6125 26.787499999999998 62-63 26.825 23.225 23.4125 26.5375 64-65 27.962500000000002 22.4875 22.85 26.700000000000003 66-67 27.6 23.0875 22.662499999999998 26.650000000000002 68-69 26.650000000000002 23.6875 22.775000000000002 26.887499999999996 70-71 28.075 22.6375 22.912499999999998 26.375 72-73 26.85 23.3875 23.5375 26.224999999999998 74-75 27.0625 23.2625 23.724999999999998 25.95 76-77 27.462500000000002 22.8125 23.2375 26.487500000000004 78-79 26.137500000000003 23.9 23.3 26.6625 80-81 27.474999999999998 22.912499999999998 23.400000000000002 26.2125 82-83 27.375 22.4375 23.3625 26.825 84-85 27.5625 22.425 22.912499999999998 27.1 86-87 26.5 23.6625 23.7375 26.1 88-89 26.6 22.8125 23.5 27.0875 90-91 26.7625 22.425 23.549999999999997 27.2625 92-93 27.487499999999997 22.7375 23.4125 26.3625 94-95 28.5625 22.4875 23.3 25.650000000000002 96-97 26.5875 22.787499999999998 23.1875 27.437499999999996 98-99 26.724999999999998 23.325000000000003 23.3625 26.5875 100-101 26.7125 23.35 22.825 27.1125 102-103 26.974999999999998 22.85 23.65 26.525 104-105 27.037499999999998 22.55 23.3125 27.1 106-107 27.1125 23.6375 23.3625 25.887500000000003 108-109 26.56465571303148 22.174840085287848 24.106358961495044 27.154145240185628 110-111 26.466900702106315 22.94383149448345 23.219658976930795 27.369608826479435 112-113 27.735849056603772 22.427672955974842 22.855345911949684 26.9811320754717 114-115 26.983331244516854 22.697079834565734 23.687178844466725 26.632410076450686 116-117 26.5375 23.1875 23.4875 26.787499999999998 118-119 26.900000000000002 22.5 23.5 27.1 120-121 26.724999999999998 23.5125 23.35 26.4125 122-123 27.1625 23.8875 22.725 26.224999999999998 124-125 26.4125 23.200000000000003 23.3375 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.5 27 3.0 28 3.5 29 5.0 30 8.0 31 8.5 32 10.0 33 17.0 34 20.0 35 26.5 36 38.5 37 54.0 38 66.5 39 81.0 40 104.5 41 116.5 42 118.0 43 125.5 44 140.0 45 154.0 46 162.0 47 155.0 48 153.5 49 134.0 50 112.5 51 106.0 52 98.0 53 97.0 54 95.5 55 94.0 56 83.5 57 76.5 58 78.5 59 86.0 60 89.5 61 90.5 62 95.0 63 101.5 64 90.5 65 78.0 66 86.5 67 89.5 68 78.5 69 77.0 70 74.5 71 61.5 72 58.5 73 56.5 74 47.0 75 38.0 76 33.5 77 29.0 78 21.5 79 14.0 80 13.5 81 15.0 82 9.5 83 3.0 84 4.0 85 4.5 86 2.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.3375 110-111 0.3 112-113 0.625 114-115 0.2625 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565296 spots for SRR13662594.sra Written 565296 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra Read 565285 spots for SRR13662594.sra Written 565285 spots for SRR13662594.sra SRR ids: ['SRR13662594.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_msy914in SRR13662594.sra spots: 11305711 blocks: [[1, 565285], [565286, 1130570], [1130571, 1695855], [1695856, 2261140], [2261141, 2826425], [2826426, 3391710], [3391711, 3956995], [3956996, 4522280], [4522281, 5087565], [5087566, 5652850], [5652851, 6218135], [6218136, 6783420], [6783421, 7348705], [7348706, 7913990], [7913991, 8479275], [8479276, 9044560], [9044561, 9609845], [9609846, 10175130], [10175131, 10740415], [10740416, 11305711]] SRR13662594 file size 3246356 SRR13662594 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662594 SRR13662594_1.fastq SRR13662594_2.fastq Input file: SRR13662594_1.fastq Paired file: SRR13662594_2.fastq trimmed: SRR13662594-trimmed-pair1.fastq, SRR13662594-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:52:09 2024 >> started Tue Dec 10 07:52:21 2024 >> done (11.095s) 11305711 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 348 ( 0.00%) empty read pairs filtered out after trimming by size control 11305363 (100.00%) read pairs available; of these: 1458382 (12.90%) trimmed read pairs available after processing 9846981 (87.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 2 0.00% 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 1 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 1 0.00% 42 0 0.00% 43 0 0.00% 44 1 0.00% 45 1 0.00% 46 1 0.00% 47 0 0.00% 48 1 0.00% 49 1 0.00% 50 0 0.00% 51 0 0.00% 52 0 0.00% 53 2 0.00% 54 0 0.00% 55 2 0.00% 56 1 0.00% 57 4 0.00% 58 3 0.00% 59 2 0.00% 60 6 0.00% 61 4 0.00% 62 4 0.00% 63 22 0.00% 64 57 0.00% 65 62 0.00% 66 88 0.00% 67 121 0.00% 68 116 0.00% 69 140 0.00% 70 157 0.00% 71 169 0.00% 72 206 0.00% 73 226 0.00% 74 250 0.00% 75 251 0.00% 76 281 0.00% 77 313 0.00% 78 373 0.00% 79 382 0.00% 80 461 0.00% 81 489 0.00% 82 512 0.00% 83 553 0.00% 84 619 0.01% 85 714 0.01% 86 706 0.01% 87 807 0.01% 88 930 0.01% 89 996 0.01% 90 1087 0.01% 91 1238 0.01% 92 1537 0.01% 93 1818 0.02% 94 4609 0.04% 95 4757 0.04% 96 5007 0.04% 97 5061 0.04% 98 5385 0.05% 99 5677 0.05% 100 5813 0.05% 101 6188 0.05% 102 6423 0.06% 103 6612 0.06% 104 6924 0.06% 105 7336 0.06% 106 7677 0.07% 107 8027 0.07% 108 8724 0.08% 109 9284 0.08% 110 10232 0.09% 111 11300 0.10% 112 12338 0.11% 113 14075 0.12% 114 15622 0.14% 115 17854 0.16% 116 42320 0.37% 117 47616 0.42% 118 54093 0.48% 119 63312 0.56% 120 77608 0.69% 121 98066 0.87% 122 137067 1.21% 123 217937 1.93% 124 519714 4.60% 125 9846981 87.10% 11305363 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=21 prefix-density=0.26 prefix-fanout=3.3 sequence=TGCAAGTGCGGCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=25 fanout-score=185.11 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=19.7 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.32 fanout-score-rank=18 prefix-density=0.25 prefix-fanout=3.5 sequence=TGCAAGTGCGGCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=184.99 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=19.6 sequence=CCGCCGCCGCCG SRR13662594 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:53:06 Started mapping on | Dec 10 07:53:06 Finished on | Dec 10 07:53:46 Mapping speed, Million of reads per hour | 1017.48 Number of input reads | 11305363 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 10792897 Uniquely mapped reads % | 95.47% Average mapped length | 246.61 Number of splices: Total | 8080434 Number of splices: Annotated (sjdb) | 7565414 Number of splices: GT/AG | 7966532 Number of splices: GC/AG | 93878 Number of splices: AT/AC | 3765 Number of splices: Non-canonical | 16259 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.97 Insertion rate per base | 0.01% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 193482 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 17774 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 319041 319041 319041 N_multimapping 193482 193482 193482 N_noFeature 424452 5508520 5511685 N_ambiguous 247672 26430 27060 UnstrandedReadsAssigned:10120773 PositiveStrandReadsAssigned:5257947 NegativeStrandReadsAssigned:5254152 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662594 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662594-trimmed-pair1.fastq SRR13662594-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,305,363 reads, 10,448,222 reads pseudoaligned [quant] estimated average fragment length: 193.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52973 SRR13662594.ke.tsv 35125 SRR13662594.se.tsv 88098 total ==> SRR13662594.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.096 0 0 PNS24247 1044 851.915 30.0188 4.49437 PNS24249 1928 1735.91 157.211 11.5512 PNS24246 1044 851.915 30.0188 4.49437 PNS24248 1044 851.915 30.0188 4.49437 PNS24244 1471 1278.91 30.7327 3.065 PNS24243 293 107.376 24 28.5084 KQK14069 1603 1410.91 7582.84 685.493 KQK14071 474 283.815 1126.51 506.259 ==> SRR13662594.se.tsv <== BRADI_1g14170v3 9412 BRADI_1g53295v3 36 BRADI_1g59795v3 465 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 83 BRADI_1g74790v3 81 BRADI_1g09890v3 1 BRADI_1g77505v3 231 BRADI_1g48960v3 0 SRR13662594 completed mapping pipeline successfully