Starting /dee2/code/volunteer_pipeline.sh SRR13662596 current disk space = 1515020169216 free memory = 1587701732 SRR13662596 SRAfilesize 37988395ca704b905e4111e0c8cdd898 SRR13662596.sra SRR13662596.sra file validated SRR13662596 is paired end SRR13662596 is conventional basespace SRR13662596 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662596_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.41475 33.0 33.0 34.0 31.0 34.0 2 32.473 33.0 33.0 34.0 31.0 34.0 3 32.084 33.0 33.0 34.0 30.0 34.0 4 32.28 33.0 33.0 34.0 31.0 34.0 5 32.32975 33.0 33.0 34.0 31.0 34.0 6 36.11425 38.0 36.0 38.0 33.0 38.0 7 36.5295 38.0 37.0 38.0 34.0 38.0 8 36.6575 38.0 38.0 38.0 34.0 38.0 9 36.70375 38.0 38.0 38.0 34.0 38.0 10-11 36.6725 38.0 38.0 38.0 34.0 38.0 12-13 36.60575 38.0 38.0 38.0 34.0 38.0 14-15 36.660375 38.0 38.0 38.0 34.0 38.0 16-17 36.65325 38.0 38.0 38.0 34.0 38.0 18-19 36.75625 38.0 38.0 38.0 34.0 38.0 20-21 36.828875 38.0 38.0 38.0 34.5 38.0 22-23 36.7775 38.0 38.0 38.0 34.5 38.0 24-25 36.829 38.0 38.0 38.0 35.0 38.0 26-27 36.726375000000004 38.0 38.0 38.0 34.5 38.0 28-29 36.748875 38.0 38.0 38.0 34.5 38.0 30-31 36.690625 38.0 38.0 38.0 34.0 38.0 32-33 36.642250000000004 38.0 38.0 38.0 34.0 38.0 34-35 36.604875 38.0 38.0 38.0 34.0 38.0 36-37 36.7005 38.0 38.0 38.0 34.0 38.0 38-39 36.63275 38.0 38.0 38.0 34.0 38.0 40-41 36.655375 38.0 38.0 38.0 34.0 38.0 42-43 36.588499999999996 38.0 38.0 38.0 34.0 38.0 44-45 36.56125 38.0 38.0 38.0 34.0 38.0 46-47 36.643125 38.0 38.0 38.0 34.0 38.0 48-49 36.593875 38.0 38.0 38.0 34.0 38.0 50-51 36.4395 38.0 38.0 38.0 34.0 38.0 52-53 36.309 38.0 38.0 38.0 33.5 38.0 54-55 36.520250000000004 38.0 38.0 38.0 34.0 38.0 56-57 36.500625 38.0 38.0 38.0 34.0 38.0 58-59 36.605375 38.0 38.0 38.0 34.0 38.0 60-61 36.580124999999995 38.0 38.0 38.0 34.0 38.0 62-63 36.391000000000005 38.0 38.0 38.0 33.5 38.0 64-65 36.341499999999996 38.0 38.0 38.0 33.0 38.0 66-67 36.422625 38.0 38.0 38.0 34.0 38.0 68-69 36.528999999999996 38.0 38.0 38.0 34.0 38.0 70-71 36.437125 38.0 38.0 38.0 34.0 38.0 72-73 36.21275 38.0 38.0 38.0 33.0 38.0 74-75 36.336875 38.0 38.0 38.0 33.5 38.0 76-77 36.545625 38.0 38.0 38.0 34.0 38.0 78-79 36.262 38.0 38.0 38.0 33.5 38.0 80-81 36.300250000000005 38.0 38.0 38.0 33.0 38.0 82-83 36.047124999999994 38.0 37.5 38.0 32.0 38.0 84-85 36.273375 38.0 38.0 38.0 33.5 38.0 86-87 35.992374999999996 38.0 37.5 38.0 32.5 38.0 88-89 35.90575 38.0 37.5 38.0 32.0 38.0 90-91 35.9785 38.0 37.5 38.0 32.5 38.0 92-93 35.85724999999999 38.0 37.0 38.0 31.5 38.0 94-95 35.897625000000005 38.0 37.0 38.0 32.0 38.0 96-97 35.76225 38.0 37.0 38.0 31.5 38.0 98-99 35.908874999999995 38.0 37.0 38.0 32.5 38.0 100-101 35.794375 38.0 37.0 38.0 31.0 38.0 102-103 35.571 38.0 36.5 38.0 30.5 38.0 104-105 35.684375 38.0 37.0 38.0 31.0 38.0 106-107 35.1385 38.0 36.0 38.0 28.5 38.0 108-109 35.580749999999995 38.0 36.5 38.0 31.0 38.0 110-111 35.626625000000004 38.0 37.0 38.0 31.5 38.0 112-113 35.631625 38.0 37.0 38.0 32.0 38.0 114-115 35.285 38.0 36.0 38.0 30.0 38.0 116-117 35.182625 38.0 36.0 38.0 29.0 38.0 118-119 34.913875000000004 38.0 35.5 38.0 28.0 38.0 120-121 34.555 38.0 35.5 38.0 25.5 38.0 122-123 34.30475 38.0 35.0 38.0 25.0 38.0 124-125 34.070375 38.0 35.5 38.0 26.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 4.0 18 4.0 19 2.0 20 3.0 21 11.0 22 6.0 23 10.0 24 12.0 25 14.0 26 16.0 27 41.0 28 42.0 29 48.0 30 78.0 31 80.0 32 109.0 33 155.0 34 214.0 35 266.0 36 495.0 37 2388.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.775 11.425 10.75 38.05 2 29.775000000000002 17.775 29.925 22.525000000000002 3 26.625 22.875 20.45 30.049999999999997 4 32.05 28.849999999999998 15.6 23.5 5 30.4 29.849999999999998 19.125 20.625 6 24.5 33.225 20.375 21.9 7 22.15 15.9 36.725 25.224999999999998 8 24.075 20.549999999999997 24.75 30.625000000000004 9 24.375 18.3 28.349999999999998 28.975 10-11 27.237499999999997 28.537499999999998 19.3125 24.9125 12-13 25.674999999999997 21.625 24.6125 28.0875 14-15 25.8125 22.975 23.95 27.2625 16-17 26.75 22.3125 23.724999999999998 27.212500000000002 18-19 26.5625 23.1125 23.5625 26.7625 20-21 26.5 23.0375 23.625 26.8375 22-23 26.737499999999997 23.4375 23.3875 26.437500000000004 24-25 26.137500000000003 23.075000000000003 23.0875 27.700000000000003 26-27 25.825 23.4125 23.175 27.5875 28-29 27.125 22.7625 23.25 26.8625 30-31 26.6125 22.8375 23.1375 27.4125 32-33 26.0375 24.55 22.675 26.737499999999997 34-35 26.8625 24.125 22.7 26.3125 36-37 26.737499999999997 23.125 23.3875 26.75 38-39 27.6125 24.125 21.9375 26.325 40-41 26.5875 23.549999999999997 23.275000000000002 26.5875 42-43 25.912499999999998 23.4375 23.474999999999998 27.175 44-45 26.987499999999997 23.5625 23.175 26.275 46-47 26.55 24.2 22.8375 26.4125 48-49 25.825 24.4 22.5625 27.212500000000002 50-51 26.7125 23.4625 22.525000000000002 27.3 52-53 27.1 22.85 22.5625 27.487499999999997 54-55 26.85 23.225 22.6125 27.3125 56-57 27.1 23.4125 22.6125 26.875 58-59 26.387500000000003 24.325 22.125 27.1625 60-61 27.187499999999996 22.8125 22.425 27.575 62-63 26.924999999999997 22.9375 23.549999999999997 26.5875 64-65 27.05 22.525000000000002 23.775 26.650000000000002 66-67 27.1625 23.1625 22.662499999999998 27.0125 68-69 26.8 22.912499999999998 23.7375 26.55 70-71 27.250000000000004 23.175 22.375 27.200000000000003 72-73 26.325 23.375 23.7125 26.5875 74-75 26.8125 23.9125 22.5125 26.7625 76-77 27.675 24.2 22.35 25.775 78-79 26.8375 23.0125 23.1375 27.0125 80-81 27.462500000000002 23.5 22.5125 26.525 82-83 26.6625 23.7875 21.837500000000002 27.712500000000002 84-85 26.474999999999998 23.65 22.6875 27.187499999999996 86-87 27.800000000000004 23.05 22.85 26.3 88-89 26.8125 23.6625 22.3625 27.1625 90-91 26.687499999999996 22.775000000000002 23.150000000000002 27.3875 92-93 27.037499999999998 23.3125 22.95 26.700000000000003 94-95 27.250000000000004 23.4375 22.5125 26.8 96-97 27.125 22.7375 22.412499999999998 27.725 98-99 27.125 23.05 23.525 26.3 100-101 27.3625 22.9875 22.225 27.425 102-103 26.775 22.8375 23.575 26.8125 104-105 26.7625 22.9875 23.0875 27.1625 106-107 27.5125 23.1 23.125 26.2625 108-109 26.775 22.8125 22.7375 27.675 110-111 26.5 23.6375 23.275000000000002 26.5875 112-113 26.3625 23.025000000000002 23.325000000000003 27.287499999999998 114-115 26.375 22.3 23.875 27.450000000000003 116-117 28.0875 22.8 22.912499999999998 26.200000000000003 118-119 26.974999999999998 22.5 23.025000000000002 27.500000000000004 120-121 25.937500000000004 22.9625 23.724999999999998 27.375 122-123 26.937499999999996 23.6125 22.400000000000002 27.05 124-125 27.450000000000003 22.25 23.1 27.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 2.0 29 2.0 30 2.5 31 5.0 32 8.5 33 11.5 34 17.5 35 23.5 36 25.5 37 33.5 38 47.0 39 65.0 40 72.5 41 83.5 42 108.0 43 119.0 44 136.5 45 146.5 46 155.0 47 165.5 48 173.0 49 154.5 50 130.5 51 136.0 52 127.0 53 136.0 54 136.5 55 109.5 56 104.0 57 104.5 58 102.0 59 95.5 60 93.0 61 89.0 62 78.0 63 83.0 64 91.0 65 85.0 66 76.5 67 76.5 68 76.5 69 78.0 70 75.5 71 57.5 72 46.0 73 50.5 74 48.5 75 37.5 76 30.0 77 21.5 78 15.0 79 15.5 80 12.5 81 9.5 82 5.5 83 2.0 84 1.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662596 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662596_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.47125 33.0 32.0 34.0 25.0 34.0 2 31.3775 33.0 32.0 34.0 25.0 34.0 3 31.60925 33.0 32.0 34.0 27.0 34.0 4 31.30325 33.0 32.0 34.0 27.0 34.0 5 31.06 33.0 32.0 34.0 25.0 34.0 6 34.922 38.0 36.0 38.0 26.0 38.0 7 34.68725 38.0 36.0 38.0 26.0 38.0 8 34.92325 38.0 36.0 38.0 26.0 38.0 9 34.27725 38.0 35.0 38.0 16.0 38.0 10-11 34.860375000000005 38.0 35.5 38.0 26.5 38.0 12-13 35.14725 38.0 36.0 38.0 27.5 38.0 14-15 35.02475 38.0 36.0 38.0 27.0 38.0 16-17 35.146125 38.0 36.0 38.0 27.5 38.0 18-19 34.719125 38.0 35.5 38.0 26.0 38.0 20-21 34.953 38.0 35.5 38.0 27.0 38.0 22-23 35.146875 38.0 36.0 38.0 27.0 38.0 24-25 34.972125000000005 38.0 36.0 38.0 26.5 38.0 26-27 35.166624999999996 38.0 36.0 38.0 27.5 38.0 28-29 34.798625 38.0 36.0 38.0 26.0 38.0 30-31 34.681375 38.0 35.5 38.0 24.5 38.0 32-33 34.8765 38.0 36.0 38.0 26.0 38.0 34-35 35.237625 38.0 36.0 38.0 27.5 38.0 36-37 34.7065 38.0 35.5 38.0 25.0 38.0 38-39 34.524249999999995 38.0 35.0 38.0 24.5 38.0 40-41 34.94875 38.0 35.5 38.0 26.0 38.0 42-43 35.162875 38.0 36.0 38.0 27.0 38.0 44-45 35.28875 38.0 36.0 38.0 27.5 38.0 46-47 35.0405 38.0 36.0 38.0 27.0 38.0 48-49 34.907375 38.0 35.5 38.0 26.0 38.0 50-51 34.625875 38.0 35.0 38.0 25.0 38.0 52-53 35.21025 38.0 36.0 38.0 27.0 38.0 54-55 35.489125 38.0 36.0 38.0 28.5 38.0 56-57 35.444375 38.0 36.0 38.0 29.0 38.0 58-59 35.4825 38.0 36.5 38.0 28.5 38.0 60-61 35.424125000000004 38.0 36.0 38.0 28.5 38.0 62-63 35.15875 38.0 36.0 38.0 27.0 38.0 64-65 35.147999999999996 38.0 36.0 38.0 27.5 38.0 66-67 34.805875 38.0 35.5 38.0 26.0 38.0 68-69 35.4615 38.0 36.0 38.0 28.5 38.0 70-71 35.441625 38.0 36.5 38.0 28.5 38.0 72-73 35.194375 38.0 36.0 38.0 27.5 38.0 74-75 35.185 38.0 36.0 38.0 27.5 38.0 76-77 35.44825 38.0 36.5 38.0 28.5 38.0 78-79 35.097375 38.0 36.0 38.0 27.0 38.0 80-81 35.102000000000004 38.0 36.0 38.0 27.5 38.0 82-83 35.026875000000004 38.0 36.0 38.0 27.0 38.0 84-85 35.321875000000006 38.0 36.0 38.0 29.0 38.0 86-87 35.074749999999995 38.0 36.0 38.0 27.5 38.0 88-89 34.779624999999996 38.0 36.0 38.0 25.0 38.0 90-91 35.243625 38.0 36.0 38.0 28.5 38.0 92-93 35.313375 38.0 36.0 38.0 28.5 38.0 94-95 35.35775 38.0 36.0 38.0 29.0 38.0 96-97 34.904875000000004 38.0 35.5 38.0 26.5 38.0 98-99 34.932249999999996 38.0 35.0 38.0 27.0 38.0 100-101 34.552875 38.0 35.0 38.0 25.0 38.0 102-103 34.742374999999996 38.0 35.0 38.0 25.0 38.0 104-105 34.542375 38.0 35.0 38.0 24.5 38.0 106-107 34.548500000000004 38.0 35.0 38.0 23.5 38.0 108-109 34.2825 38.0 35.0 38.0 22.5 38.0 110-111 34.65875 38.0 35.0 38.0 26.0 38.0 112-113 34.605875 38.0 35.0 38.0 25.5 38.0 114-115 34.127250000000004 38.0 35.0 38.0 22.0 38.0 116-117 34.571 38.0 35.0 38.0 26.0 38.0 118-119 34.10425 38.0 35.0 38.0 23.0 38.0 120-121 33.9465 38.0 35.0 38.0 23.0 38.0 122-123 33.654375 38.0 35.0 38.0 21.0 38.0 124-125 33.13175 38.0 35.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 2.0 15 5.0 16 7.0 17 8.0 18 7.0 19 9.0 20 12.0 21 20.0 22 25.0 23 38.0 24 52.0 25 44.0 26 66.0 27 78.0 28 93.0 29 105.0 30 101.0 31 118.0 32 140.0 33 174.0 34 228.0 35 277.0 36 473.0 37 1915.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.475 10.525 11.1 38.9 2 31.15 17.7 28.65 22.5 3 27.275 22.025 21.3 29.4 4 30.65 29.15 16.1 24.099999999999998 5 30.125 29.925 19.625 20.325 6 24.4 33.35 19.25 23.0 7 21.2 16.625 35.375 26.8 8 24.675 20.025000000000002 25.174999999999997 30.125 9 24.05 18.825 28.4 28.725 10-11 27.85 28.175 18.725 25.25 12-13 25.224999999999998 21.475 25.724999999999998 27.575 14-15 25.587500000000002 23.549999999999997 24.55 26.3125 16-17 26.387500000000003 23.1875 23.150000000000002 27.275 18-19 25.8 23.8375 24.2625 26.1 20-21 26.5375 22.912499999999998 23.1375 27.4125 22-23 26.5375 24.1125 22.6375 26.7125 24-25 26.1125 23.375 23.4875 27.025 26-27 26.3 24.3875 23.0375 26.275 28-29 27.450000000000003 21.4875 23.7125 27.35 30-31 26.0375 23.1125 23.225 27.625 32-33 26.237500000000004 23.325000000000003 22.9375 27.500000000000004 34-35 26.7625 22.95 23.575 26.7125 36-37 26.7125 22.45 22.9625 27.875 38-39 26.400000000000002 23.150000000000002 23.225 27.224999999999998 40-41 26.950000000000003 23.375 22.1375 27.537499999999998 42-43 26.237500000000004 23.2375 23.8375 26.687499999999996 44-45 26.5125 23.575 22.525000000000002 27.3875 46-47 26.937499999999996 23.1 23.075000000000003 26.887499999999996 48-49 27.0875 22.9625 22.85 27.1 50-51 26.2125 23.375 24.3625 26.05 52-53 26.474999999999998 23.0875 22.575 27.8625 54-55 27.037499999999998 22.6125 23.3125 27.037499999999998 56-57 26.8625 23.400000000000002 22.625 27.1125 58-59 27.1125 22.75 23.6625 26.474999999999998 60-61 27.150000000000002 22.912499999999998 23.3 26.637499999999996 62-63 26.924999999999997 22.6 23.1375 27.3375 64-65 27.6 22.85 22.475 27.075 66-67 25.7875 23.1625 23.35 27.700000000000003 68-69 26.787499999999998 23.575 23.175 26.4625 70-71 27.0625 24.1125 22.900000000000002 25.924999999999997 72-73 26.787499999999998 23.5625 23.125 26.525 74-75 26.6625 22.35 23.8375 27.150000000000002 76-77 27.05 22.725 23.425 26.8 78-79 26.8375 22.8375 22.7125 27.6125 80-81 26.487500000000004 23.0875 23.5625 26.8625 82-83 27.650000000000002 21.987499999999997 22.6125 27.750000000000004 84-85 27.212500000000002 22.8 23.5375 26.450000000000003 86-87 26.775 23.225 23.35 26.650000000000002 88-89 26.7125 22.35 23.1375 27.800000000000004 90-91 26.7125 22.0125 23.4125 27.8625 92-93 27.1625 23.65 22.8125 26.375 94-95 26.887499999999996 22.875 23.325000000000003 26.9125 96-97 26.637499999999996 22.125 23.925 27.3125 98-99 26.6125 23.3625 22.875 27.150000000000002 100-101 26.325 22.8375 23.599999999999998 27.237499999999997 102-103 26.275 22.6375 23.425 27.6625 104-105 27.3375 23.1375 22.925 26.6 106-107 27.0625 22.4625 23.225 27.250000000000004 108-109 27.075 23.3 23.5125 26.1125 110-111 26.25 23.4125 22.787499999999998 27.55 112-113 27.1375 23.0875 22.900000000000002 26.875 114-115 27.85 23.2125 22.175 26.7625 116-117 26.700000000000003 23.1 23.5875 26.6125 118-119 27.05 22.75 22.575 27.625 120-121 28.3375 22.412499999999998 23.0375 26.2125 122-123 27.1125 23.7875 22.7375 26.3625 124-125 27.400000000000002 23.35 22.6 26.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 1.5 29 2.0 30 3.5 31 5.0 32 8.0 33 10.5 34 14.0 35 20.5 36 26.0 37 33.5 38 50.5 39 64.5 40 77.5 41 98.0 42 114.5 43 128.0 44 133.5 45 140.5 46 156.0 47 172.5 48 163.0 49 145.5 50 141.0 51 126.0 52 124.0 53 125.5 54 112.5 55 111.5 56 114.5 57 96.0 58 83.0 59 92.0 60 98.5 61 99.5 62 105.0 63 98.5 64 82.5 65 80.0 66 75.0 67 70.0 68 69.0 69 70.0 70 73.5 71 71.0 72 61.0 73 51.5 74 40.0 75 30.0 76 30.5 77 27.0 78 19.5 79 12.5 80 12.5 81 10.0 82 5.0 83 3.5 84 1.5 85 1.0 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCTGT 20 7.8725006E-4 89.24999 3 >>END_MODULE Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604499 spots for SRR13662596.sra Written 604499 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra Read 604492 spots for SRR13662596.sra Written 604492 spots for SRR13662596.sra SRR ids: ['SRR13662596.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fjydxto8 SRR13662596.sra spots: 12089847 blocks: [[1, 604492], [604493, 1208984], [1208985, 1813476], [1813477, 2417968], [2417969, 3022460], [3022461, 3626952], [3626953, 4231444], [4231445, 4835936], [4835937, 5440428], [5440429, 6044920], [6044921, 6649412], [6649413, 7253904], [7253905, 7858396], [7858397, 8462888], [8462889, 9067380], [9067381, 9671872], [9671873, 10276364], [10276365, 10880856], [10880857, 11485348], [11485349, 12089847]] SRR13662596 file size 3473021 SRR13662596 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662596 SRR13662596_1.fastq SRR13662596_2.fastq Input file: SRR13662596_1.fastq Paired file: SRR13662596_2.fastq trimmed: SRR13662596-trimmed-pair1.fastq, SRR13662596-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 03:29:54 2024 >> started Thu Dec 12 03:30:05 2024 >> done (11.636s) 12089847 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 120 ( 0.00%) empty read pairs filtered out after trimming by size control 12089727 (100.00%) read pairs available; of these: 1584586 (13.11%) trimmed read pairs available after processing 10505141 (86.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 2 0.00% 33 1 0.00% 34 1 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 1 0.00% 42 0 0.00% 43 2 0.00% 44 1 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 1 0.00% 50 3 0.00% 51 1 0.00% 52 1 0.00% 53 0 0.00% 54 1 0.00% 55 2 0.00% 56 1 0.00% 57 1 0.00% 58 5 0.00% 59 4 0.00% 60 3 0.00% 61 3 0.00% 62 2 0.00% 63 20 0.00% 64 31 0.00% 65 35 0.00% 66 55 0.00% 67 63 0.00% 68 90 0.00% 69 98 0.00% 70 111 0.00% 71 143 0.00% 72 174 0.00% 73 199 0.00% 74 184 0.00% 75 237 0.00% 76 231 0.00% 77 286 0.00% 78 291 0.00% 79 337 0.00% 80 346 0.00% 81 392 0.00% 82 438 0.00% 83 487 0.00% 84 530 0.00% 85 594 0.00% 86 596 0.00% 87 780 0.01% 88 822 0.01% 89 869 0.01% 90 1051 0.01% 91 1174 0.01% 92 1389 0.01% 93 1716 0.01% 94 4780 0.04% 95 4920 0.04% 96 5254 0.04% 97 5561 0.05% 98 5844 0.05% 99 6201 0.05% 100 6498 0.05% 101 6912 0.06% 102 7076 0.06% 103 7489 0.06% 104 7818 0.06% 105 8118 0.07% 106 8776 0.07% 107 9260 0.08% 108 9742 0.08% 109 10805 0.09% 110 11549 0.10% 111 12948 0.11% 112 14354 0.12% 113 15900 0.13% 114 17881 0.15% 115 20217 0.17% 116 42241 0.35% 117 47569 0.39% 118 55212 0.46% 119 65287 0.54% 120 79912 0.66% 121 104246 0.86% 122 147334 1.22% 123 241863 2.00% 124 579211 4.79% 125 10505141 86.89% 12089727 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=308.13 fanout-score-rank=7 prefix-density=1.15 prefix-fanout=29.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=509.74 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=29.9 sequence=GCGGCGGCGGCC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=103.02 fanout-score-rank=17 prefix-density=0.47 prefix-fanout=23.4 sequence=CGCCGGCGCCGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=27 fanout-score=515.74 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=30.3 sequence=CGCCGCCGCCGA SRR13662596 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 03:31:01 Started mapping on | Dec 12 03:31:01 Finished on | Dec 12 03:32:13 Mapping speed, Million of reads per hour | 604.49 Number of input reads | 12089727 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 10775106 Uniquely mapped reads % | 89.13% Average mapped length | 246.42 Number of splices: Total | 7439490 Number of splices: Annotated (sjdb) | 7005939 Number of splices: GT/AG | 7335041 Number of splices: GC/AG | 79068 Number of splices: AT/AC | 4180 Number of splices: Non-canonical | 21201 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.32 Insertion rate per base | 0.01% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342981 % of reads mapped to multiple loci | 2.84% Number of reads mapped to too many loci | 26831 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.57% % of reads unmapped: other | 1.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 971695 971695 971695 N_multimapping 342981 342981 342981 N_noFeature 311533 5452383 5440153 N_ambiguous 229163 19233 19153 UnstrandedReadsAssigned:10234410 PositiveStrandReadsAssigned:5303490 NegativeStrandReadsAssigned:5315800 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662596 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662596-trimmed-pair1.fastq SRR13662596-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,089,727 reads, 10,664,725 reads pseudoaligned [quant] estimated average fragment length: 197.192 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52973 SRR13662596.ke.tsv 35125 SRR13662596.se.tsv 88098 total ==> SRR13662596.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 740.001 0 0 PNS24247 1044 847.808 43.1634 6.69946 PNS24249 1928 1731.81 259.147 19.691 PNS24246 1044 847.808 43.1634 6.69946 PNS24248 1044 847.808 43.1634 6.69946 PNS24244 1471 1274.81 65.3627 6.74695 PNS24243 293 103.837 11 13.94 KQK14069 1603 1406.81 2968.89 277.703 KQK14071 474 279.574 206.034 96.9764 ==> SRR13662596.se.tsv <== BRADI_1g14170v3 3337 BRADI_1g53295v3 29 BRADI_1g59795v3 106 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 199 BRADI_1g74790v3 484 BRADI_1g09890v3 2 BRADI_1g77505v3 137 BRADI_1g48960v3 1 SRR13662596 completed mapping pipeline successfully