Starting /dee2/code/volunteer_pipeline.sh SRR13662597 current disk space = 1526666231808 free memory = 1392749652 SRR13662597 SRAfilesize 4b7b71abe299c5e99a1551739f8bad0b SRR13662597.sra SRR13662597.sra file validated SRR13662597 is paired end SRR13662597 is conventional basespace SRR13662597 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662597_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35 33.0 33.0 34.0 31.0 34.0 2 32.37075 33.0 33.0 34.0 31.0 34.0 3 32.066 33.0 32.0 34.0 28.0 34.0 4 32.30625 33.0 33.0 34.0 31.0 34.0 5 32.40325 33.0 33.0 34.0 31.0 34.0 6 36.11175 38.0 37.0 38.0 33.0 38.0 7 36.581 38.0 37.0 38.0 34.0 38.0 8 36.7635 38.0 38.0 38.0 34.0 38.0 9 36.7665 38.0 38.0 38.0 34.0 38.0 10-11 36.648375 38.0 38.0 38.0 34.0 38.0 12-13 36.516999999999996 38.0 38.0 38.0 34.0 38.0 14-15 36.572874999999996 38.0 38.0 38.0 34.0 38.0 16-17 36.675875000000005 38.0 38.0 38.0 34.0 38.0 18-19 36.762625 38.0 38.0 38.0 34.5 38.0 20-21 36.755875 38.0 38.0 38.0 34.0 38.0 22-23 36.794375 38.0 38.0 38.0 34.5 38.0 24-25 36.77275 38.0 38.0 38.0 34.5 38.0 26-27 36.730625 38.0 38.0 38.0 34.0 38.0 28-29 36.730999999999995 38.0 38.0 38.0 34.5 38.0 30-31 36.692875 38.0 38.0 38.0 34.5 38.0 32-33 36.672 38.0 38.0 38.0 34.5 38.0 34-35 36.618875 38.0 38.0 38.0 34.0 38.0 36-37 36.6855 38.0 38.0 38.0 34.0 38.0 38-39 36.684125 38.0 38.0 38.0 34.0 38.0 40-41 36.73775 38.0 38.0 38.0 34.5 38.0 42-43 36.53575 38.0 38.0 38.0 34.0 38.0 44-45 36.493 38.0 38.0 38.0 34.0 38.0 46-47 36.609875 38.0 38.0 38.0 34.0 38.0 48-49 36.56275 38.0 38.0 38.0 34.0 38.0 50-51 36.475125000000006 38.0 38.0 38.0 34.0 38.0 52-53 36.376625000000004 38.0 38.0 38.0 33.5 38.0 54-55 36.547250000000005 38.0 38.0 38.0 34.0 38.0 56-57 36.574 38.0 38.0 38.0 34.0 38.0 58-59 36.643375 38.0 38.0 38.0 34.0 38.0 60-61 36.6515 38.0 38.0 38.0 34.0 38.0 62-63 36.46575 38.0 38.0 38.0 33.5 38.0 64-65 36.255875 38.0 38.0 38.0 33.0 38.0 66-67 36.45625 38.0 38.0 38.0 34.0 38.0 68-69 36.490375 38.0 38.0 38.0 34.0 38.0 70-71 36.3875 38.0 38.0 38.0 33.5 38.0 72-73 36.231375 38.0 37.5 38.0 33.0 38.0 74-75 36.296625000000006 38.0 38.0 38.0 33.0 38.0 76-77 36.506125 38.0 38.0 38.0 34.0 38.0 78-79 36.171875 38.0 37.5 38.0 32.5 38.0 80-81 36.214625 38.0 38.0 38.0 33.0 38.0 82-83 36.11475 38.0 37.5 38.0 33.0 38.0 84-85 36.301625 38.0 38.0 38.0 33.0 38.0 86-87 35.915125 38.0 37.0 38.0 31.5 38.0 88-89 35.879 38.0 37.0 38.0 32.0 38.0 90-91 35.960875 38.0 37.0 38.0 31.5 38.0 92-93 35.75725 38.0 37.0 38.0 31.0 38.0 94-95 35.84975 38.0 37.0 38.0 32.0 38.0 96-97 35.760000000000005 38.0 37.0 38.0 31.5 38.0 98-99 36.0055 38.0 37.5 38.0 33.0 38.0 100-101 35.861625000000004 38.0 37.0 38.0 31.5 38.0 102-103 35.643625 38.0 37.0 38.0 31.0 38.0 104-105 35.719750000000005 38.0 37.0 38.0 31.5 38.0 106-107 35.27 38.0 36.0 38.0 29.0 38.0 108-109 35.581125 38.0 36.5 38.0 31.0 38.0 110-111 35.5185 38.0 36.5 38.0 31.0 38.0 112-113 35.56125 38.0 36.0 38.0 31.0 38.0 114-115 35.22825 38.0 36.0 38.0 30.0 38.0 116-117 35.127250000000004 38.0 36.0 38.0 28.5 38.0 118-119 34.90525 38.0 35.5 38.0 28.0 38.0 120-121 34.548125 38.0 35.0 38.0 26.5 38.0 122-123 34.202 38.0 35.0 38.0 24.0 38.0 124-125 33.875125 38.0 35.0 38.0 23.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 1.0 17 5.0 18 1.0 19 5.0 20 1.0 21 3.0 22 6.0 23 8.0 24 17.0 25 23.0 26 15.0 27 34.0 28 39.0 29 60.0 30 64.0 31 84.0 32 112.0 33 134.0 34 209.0 35 297.0 36 568.0 37 2311.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.65 11.924999999999999 10.299999999999999 37.125 2 32.0 18.075 27.3 22.625 3 28.175 22.925 19.7 29.2 4 28.925 29.9 16.900000000000002 24.275 5 31.4 29.325000000000003 18.925 20.349999999999998 6 23.474999999999998 33.15 19.8 23.575 7 21.6 16.85 36.9 24.65 8 24.425 20.474999999999998 24.474999999999998 30.625000000000004 9 24.875 19.225 26.150000000000002 29.75 10-11 27.237499999999997 28.325 19.525000000000002 24.9125 12-13 24.9375 21.725 25.6 27.737499999999997 14-15 26.1125 22.775000000000002 24.0 27.1125 16-17 27.200000000000003 23.1125 23.325000000000003 26.3625 18-19 26.224999999999998 23.0 23.525 27.250000000000004 20-21 27.450000000000003 23.0875 22.85 26.6125 22-23 27.4125 23.775 23.25 25.5625 24-25 26.724999999999998 23.474999999999998 22.7 27.1 26-27 25.8625 23.5125 23.7 26.924999999999997 28-29 27.375 23.025000000000002 23.05 26.55 30-31 26.875 23.150000000000002 23.5875 26.387500000000003 32-33 24.962500000000002 23.3875 24.1125 27.537499999999998 34-35 26.6625 23.474999999999998 22.7625 27.1 36-37 26.35 24.125 23.2875 26.237500000000004 38-39 27.150000000000002 23.0 23.075000000000003 26.775 40-41 25.924999999999997 23.799999999999997 22.775000000000002 27.500000000000004 42-43 26.25 23.125 23.474999999999998 27.150000000000002 44-45 26.8375 22.8 23.825 26.5375 46-47 26.2875 24.4 22.225 27.0875 48-49 26.787499999999998 23.9375 22.650000000000002 26.625 50-51 26.825 24.025 23.2375 25.912499999999998 52-53 26.937499999999996 22.5875 24.3625 26.1125 54-55 26.387500000000003 23.7125 23.025000000000002 26.875 56-57 26.5875 23.400000000000002 22.925 27.0875 58-59 27.0125 22.6875 22.400000000000002 27.900000000000002 60-61 27.3125 23.1 22.275 27.3125 62-63 27.2625 23.1 22.5125 27.125 64-65 26.437500000000004 23.1125 23.2375 27.212500000000002 66-67 26.7625 23.8375 23.400000000000002 26.0 68-69 27.1375 22.7375 23.5875 26.5375 70-71 26.924999999999997 22.425 23.5125 27.1375 72-73 26.900000000000002 23.275000000000002 22.85 26.974999999999998 74-75 27.5875 22.675 23.0125 26.724999999999998 76-77 27.5875 23.724999999999998 22.05 26.637499999999996 78-79 27.0 23.3375 23.0125 26.650000000000002 80-81 27.3125 21.987499999999997 23.325000000000003 27.375 82-83 27.6375 22.8125 22.675 26.875 84-85 26.437500000000004 23.599999999999998 23.275000000000002 26.687499999999996 86-87 26.900000000000002 23.0375 23.0 27.0625 88-89 25.674999999999997 23.375 23.4875 27.462500000000002 90-91 26.9125 23.0 23.05 27.037499999999998 92-93 26.6 22.6 23.375 27.425 94-95 27.3125 22.475 23.0 27.212500000000002 96-97 27.275 23.2375 22.6 26.887499999999996 98-99 26.737499999999997 23.25 23.0125 27.0 100-101 27.474999999999998 22.6 22.95 26.974999999999998 102-103 26.5375 22.900000000000002 24.3875 26.174999999999997 104-105 26.025 22.8125 23.6625 27.500000000000004 106-107 27.5625 21.712500000000002 23.5125 27.212500000000002 108-109 26.2625 22.6125 24.4375 26.687499999999996 110-111 27.2625 22.375 22.7625 27.6 112-113 26.474999999999998 23.4125 23.3875 26.724999999999998 114-115 26.5625 22.237499999999997 23.849999999999998 27.35 116-117 26.525 23.1375 23.425 26.9125 118-119 26.3125 23.05 23.2375 27.400000000000002 120-121 26.5625 22.45 24.6 26.387500000000003 122-123 26.6625 22.2 23.8375 27.3 124-125 27.650000000000002 23.05 22.475 26.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.0 27 2.5 28 2.0 29 2.5 30 4.0 31 7.5 32 9.5 33 11.0 34 12.5 35 19.5 36 38.0 37 46.0 38 55.0 39 72.5 40 81.5 41 97.5 42 121.0 43 133.0 44 142.5 45 154.0 46 154.0 47 156.5 48 148.0 49 132.0 50 129.0 51 135.5 52 136.5 53 116.0 54 102.0 55 99.5 56 100.5 57 93.0 58 86.0 59 81.5 60 78.0 61 84.5 62 86.0 63 89.0 64 83.0 65 83.0 66 90.0 67 83.5 68 76.5 69 72.0 70 75.0 71 76.5 72 63.5 73 50.5 74 45.0 75 37.5 76 30.0 77 25.5 78 23.0 79 19.5 80 12.5 81 7.0 82 6.5 83 5.0 84 2.5 85 1.0 86 0.0 87 0.0 88 1.5 89 1.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0 0.0 0.0 0.0 0.025 78-79 0.0 0.0 0.0 0.0 0.025 80-81 0.0 0.0 0.0 0.0 0.025 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88-89 0.0 0.0 0.0 0.0 0.025 90-91 0.0 0.0 0.0 0.0 0.025 92-93 0.0 0.0 0.0 0.0 0.025 94-95 0.0 0.0 0.0 0.0 0.025 96-97 0.0 0.0 0.0 0.0 0.025 98-99 0.0 0.0 0.0 0.0 0.025 100-101 0.0 0.0 0.0 0.0 0.025 102-103 0.0 0.0 0.0 0.0 0.025 104-105 0.0 0.0 0.0 0.0 0.025 106-107 0.0 0.0 0.0 0.0 0.025 108-109 0.0 0.0 0.0 0.0 0.025 110-111 0.0 0.0 0.0 0.0 0.025 112-113 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGCCTC 15 0.0040846216 59.5 102-103 >>END_MODULE SRR13662597 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662597_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.53425 33.0 32.0 34.0 27.0 34.0 2 31.44275 33.0 32.0 34.0 25.0 34.0 3 31.493 33.0 32.0 34.0 27.0 34.0 4 31.3805 33.0 32.0 34.0 27.0 34.0 5 31.1985 33.0 32.0 34.0 25.0 34.0 6 35.19075 38.0 36.0 38.0 28.0 38.0 7 34.991 38.0 36.0 38.0 27.0 38.0 8 35.256 38.0 36.0 38.0 28.0 38.0 9 34.56375 38.0 35.0 38.0 26.0 38.0 10-11 35.0115 38.0 36.0 38.0 27.0 38.0 12-13 35.28475 38.0 36.0 38.0 28.0 38.0 14-15 35.168000000000006 38.0 36.0 38.0 27.5 38.0 16-17 35.355625 38.0 36.5 38.0 28.0 38.0 18-19 34.917249999999996 38.0 36.0 38.0 26.5 38.0 20-21 35.18 38.0 36.0 38.0 28.0 38.0 22-23 35.374125 38.0 36.5 38.0 28.0 38.0 24-25 35.228624999999994 38.0 36.0 38.0 27.5 38.0 26-27 35.291875000000005 38.0 36.0 38.0 27.5 38.0 28-29 35.0315 38.0 36.0 38.0 26.0 38.0 30-31 34.863625 38.0 35.5 38.0 26.0 38.0 32-33 35.10825 38.0 36.0 38.0 27.0 38.0 34-35 35.305 38.0 36.0 38.0 27.5 38.0 36-37 34.742999999999995 38.0 35.5 38.0 26.0 38.0 38-39 34.931 38.0 35.5 38.0 26.0 38.0 40-41 35.14175 38.0 36.0 38.0 27.5 38.0 42-43 35.22175 38.0 36.0 38.0 27.0 38.0 44-45 35.42725 38.0 36.0 38.0 28.5 38.0 46-47 35.186625 38.0 36.0 38.0 27.0 38.0 48-49 35.160125 38.0 36.0 38.0 27.0 38.0 50-51 34.721375 38.0 35.5 38.0 24.5 38.0 52-53 35.377625 38.0 36.0 38.0 27.5 38.0 54-55 35.597125000000005 38.0 36.5 38.0 29.0 38.0 56-57 35.605375 38.0 37.0 38.0 29.0 38.0 58-59 35.387375000000006 38.0 36.5 38.0 27.5 38.0 60-61 35.649 38.0 37.0 38.0 29.0 38.0 62-63 35.394499999999994 38.0 36.0 38.0 29.0 38.0 64-65 35.264125 38.0 36.0 38.0 28.0 38.0 66-67 34.895250000000004 38.0 35.5 38.0 26.0 38.0 68-69 35.56175 38.0 36.5 38.0 28.5 38.0 70-71 35.572874999999996 38.0 37.0 38.0 29.0 38.0 72-73 35.3895 38.0 36.5 38.0 28.0 38.0 74-75 35.2695 38.0 36.0 38.0 27.5 38.0 76-77 35.577124999999995 38.0 36.5 38.0 29.5 38.0 78-79 35.14975 38.0 36.0 38.0 27.5 38.0 80-81 35.1455 38.0 36.0 38.0 28.0 38.0 82-83 35.0655 38.0 36.0 38.0 27.0 38.0 84-85 35.3995 38.0 36.5 38.0 29.0 38.0 86-87 35.2015 38.0 36.0 38.0 28.0 38.0 88-89 34.93075 38.0 36.0 38.0 26.5 38.0 90-91 35.260999999999996 38.0 36.5 38.0 28.5 38.0 92-93 35.175124999999994 38.0 36.0 38.0 28.5 38.0 94-95 35.34975 38.0 36.0 38.0 30.0 38.0 96-97 34.98075 38.0 35.5 38.0 27.5 38.0 98-99 34.947125 38.0 36.0 38.0 27.0 38.0 100-101 34.6315 38.0 35.0 38.0 25.0 38.0 102-103 34.80575 38.0 35.5 38.0 26.5 38.0 104-105 34.609875 38.0 35.5 38.0 24.5 38.0 106-107 34.6475 38.0 35.0 38.0 25.5 38.0 108-109 34.5005 38.0 35.0 38.0 24.0 38.0 110-111 34.6565 38.0 35.0 38.0 25.5 38.0 112-113 34.600375 38.0 35.0 38.0 25.5 38.0 114-115 34.132999999999996 38.0 35.0 38.0 23.0 38.0 116-117 34.62825 38.0 35.0 38.0 26.0 38.0 118-119 34.30525 38.0 35.0 38.0 23.5 38.0 120-121 34.040875 38.0 35.0 38.0 23.0 38.0 122-123 33.887375 38.0 35.0 38.0 23.0 38.0 124-125 33.308375 38.0 35.0 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 3.0 13 4.0 14 4.0 15 3.0 16 5.0 17 12.0 18 9.0 19 12.0 20 15.0 21 19.0 22 27.0 23 22.0 24 42.0 25 39.0 26 65.0 27 69.0 28 68.0 29 88.0 30 103.0 31 123.0 32 145.0 33 163.0 34 222.0 35 276.0 36 515.0 37 1946.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.875 11.924999999999999 10.15 37.05 2 30.85 19.400000000000002 28.15 21.6 3 28.825 23.35 19.0 28.825 4 31.3 29.45 15.275 23.974999999999998 5 31.6 30.975 18.175 19.25 6 22.925 33.725 20.775 22.575 7 22.900000000000002 15.45 35.949999999999996 25.7 8 22.775000000000002 20.7 25.6 30.925000000000004 9 24.55 20.125 26.700000000000003 28.625 10-11 28.249999999999996 28.4125 18.7625 24.575 12-13 25.2 21.575 25.7625 27.462500000000002 14-15 25.8125 23.7875 24.462500000000002 25.937500000000004 16-17 27.3 23.3125 22.7375 26.650000000000002 18-19 26.174999999999997 23.200000000000003 24.087500000000002 26.5375 20-21 26.825 23.4625 23.05 26.6625 22-23 26.125 25.25 22.625 26.0 24-25 26.1125 23.1625 24.474999999999998 26.25 26-27 25.924999999999997 23.8375 23.45 26.787499999999998 28-29 27.987499999999997 23.2125 22.3375 26.4625 30-31 26.125 24.087500000000002 23.4625 26.325 32-33 26.737499999999997 24.224999999999998 22.3875 26.650000000000002 34-35 26.825 24.0375 22.275 26.8625 36-37 26.924999999999997 23.9375 22.525000000000002 26.6125 38-39 25.95 24.087500000000002 24.0125 25.95 40-41 26.575 23.025000000000002 23.275000000000002 27.125 42-43 27.250000000000004 23.1375 23.5625 26.05 44-45 27.0625 24.1375 23.0375 25.7625 46-47 26.687499999999996 22.900000000000002 23.0375 27.375 48-49 26.5625 23.5 23.9125 26.025 50-51 27.437499999999996 23.225 23.175 26.1625 52-53 25.7625 23.5375 22.912499999999998 27.787499999999998 54-55 26.8125 22.8625 23.724999999999998 26.6 56-57 26.2875 23.724999999999998 22.900000000000002 27.0875 58-59 27.1375 23.4625 23.3125 26.087500000000002 60-61 26.8 22.7375 23.275000000000002 27.187499999999996 62-63 27.175 23.425 22.725 26.674999999999997 64-65 26.900000000000002 24.125 22.25 26.724999999999998 66-67 26.687499999999996 23.1125 23.25 26.950000000000003 68-69 26.1 23.674999999999997 23.1875 27.037499999999998 70-71 27.1125 22.825 23.5 26.5625 72-73 27.575 24.05 22.85 25.525 74-75 26.924999999999997 23.674999999999997 22.35 27.05 76-77 27.762500000000003 22.8375 22.4625 26.937499999999996 78-79 27.1 21.6125 23.35 27.9375 80-81 26.325 22.925 23.7375 27.0125 82-83 27.5875 22.8875 22.900000000000002 26.625 84-85 26.5 22.5875 24.1875 26.724999999999998 86-87 26.387500000000003 23.3375 23.2625 27.0125 88-89 27.9375 22.5875 22.55 26.924999999999997 90-91 26.775 22.425 22.912499999999998 27.8875 92-93 26.6 23.125 23.7625 26.5125 94-95 27.224999999999998 23.1125 22.6125 27.05 96-97 26.6 23.3 22.75 27.35 98-99 26.275 23.9 22.9625 26.8625 100-101 26.825 23.5125 22.8 26.8625 102-103 26.724999999999998 23.45 22.8 27.025 104-105 27.3375 24.0 21.725 26.937499999999996 106-107 27.037499999999998 23.4125 23.1875 26.3625 108-109 27.800000000000004 22.2625 22.8875 27.05 110-111 27.1 22.6875 23.175 27.037499999999998 112-113 27.0875 22.7625 23.1125 27.037499999999998 114-115 27.0875 22.325 23.3375 27.250000000000004 116-117 25.9875 23.575 23.3875 27.05 118-119 26.724999999999998 22.7125 23.6625 26.900000000000002 120-121 26.825 23.225 23.1625 26.787499999999998 122-123 26.924999999999997 23.0625 23.6375 26.375 124-125 27.275 23.7 22.5125 26.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.0 24 0.5 25 0.5 26 1.0 27 2.5 28 2.0 29 2.5 30 6.0 31 8.0 32 8.5 33 10.5 34 20.5 35 23.5 36 26.5 37 46.5 38 57.5 39 75.0 40 100.5 41 113.5 42 120.0 43 136.0 44 142.5 45 156.0 46 164.5 47 150.5 48 146.5 49 138.0 50 128.0 51 122.0 52 119.0 53 114.5 54 107.0 55 94.0 56 88.0 57 90.5 58 89.5 59 83.5 60 79.5 61 89.5 62 88.5 63 80.5 64 75.0 65 79.0 66 88.5 67 79.0 68 81.0 69 83.5 70 69.5 71 64.0 72 64.0 73 57.5 74 45.5 75 41.5 76 39.0 77 29.0 78 20.5 79 14.0 80 10.0 81 9.0 82 6.0 83 2.0 84 2.5 85 1.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593454 spots for SRR13662597.sra Written 593454 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra Read 593439 spots for SRR13662597.sra Written 593439 spots for SRR13662597.sra SRR ids: ['SRR13662597.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eag96ukl SRR13662597.sra spots: 11868795 blocks: [[1, 593439], [593440, 1186878], [1186879, 1780317], [1780318, 2373756], [2373757, 2967195], [2967196, 3560634], [3560635, 4154073], [4154074, 4747512], [4747513, 5340951], [5340952, 5934390], [5934391, 6527829], [6527830, 7121268], [7121269, 7714707], [7714708, 8308146], [8308147, 8901585], [8901586, 9495024], [9495025, 10088463], [10088464, 10681902], [10681903, 11275341], [11275342, 11868795]] SRR13662597 file size 3409123 SRR13662597 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662597 SRR13662597_1.fastq SRR13662597_2.fastq Input file: SRR13662597_1.fastq Paired file: SRR13662597_2.fastq trimmed: SRR13662597-trimmed-pair1.fastq, SRR13662597-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 07:57:31 2024 >> started Tue Dec 10 07:57:45 2024 >> done (14.102s) 11868795 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 458 ( 0.00%) empty read pairs filtered out after trimming by size control 11868336 (100.00%) read pairs available; of these: 1578683 (13.30%) trimmed read pairs available after processing 10289653 (86.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 1 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 3 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 2 0.00% 43 1 0.00% 44 1 0.00% 45 1 0.00% 46 0 0.00% 47 2 0.00% 48 1 0.00% 49 0 0.00% 50 0 0.00% 51 1 0.00% 52 2 0.00% 53 2 0.00% 54 0 0.00% 55 2 0.00% 56 2 0.00% 57 5 0.00% 58 1 0.00% 59 7 0.00% 60 6 0.00% 61 11 0.00% 62 6 0.00% 63 17 0.00% 64 68 0.00% 65 57 0.00% 66 106 0.00% 67 91 0.00% 68 107 0.00% 69 152 0.00% 70 174 0.00% 71 193 0.00% 72 194 0.00% 73 236 0.00% 74 255 0.00% 75 258 0.00% 76 293 0.00% 77 344 0.00% 78 381 0.00% 79 393 0.00% 80 418 0.00% 81 483 0.00% 82 514 0.00% 83 525 0.00% 84 621 0.01% 85 692 0.01% 86 737 0.01% 87 826 0.01% 88 932 0.01% 89 943 0.01% 90 995 0.01% 91 1212 0.01% 92 1431 0.01% 93 1841 0.02% 94 5090 0.04% 95 5379 0.05% 96 5491 0.05% 97 5723 0.05% 98 5911 0.05% 99 6333 0.05% 100 6358 0.05% 101 6814 0.06% 102 7043 0.06% 103 7483 0.06% 104 7618 0.06% 105 7894 0.07% 106 8672 0.07% 107 9017 0.08% 108 9653 0.08% 109 10414 0.09% 110 11167 0.09% 111 12232 0.10% 112 13588 0.11% 113 15203 0.13% 114 16862 0.14% 115 19157 0.16% 116 45251 0.38% 117 50740 0.43% 118 58030 0.49% 119 68196 0.57% 120 82661 0.70% 121 106315 0.90% 122 147669 1.24% 123 239867 2.02% 124 561303 4.73% 125 10289653 86.70% 11868336 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.76 fanout-score-rank=26 prefix-density=0.19 prefix-fanout=4.5 sequence=TGCCGCACTTGCAGGTGGTGCAGTCGCAGCCGCCGCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=384.10 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=28.2 sequence=CGCCGCCGCCATCCCCTCCAAGTGCGGCGTCAGCATCCCTTACACCATCAGCCCCTCCGTCGACTGCTCCAGGGTCAACTAGAGAGATCGAGAGATCGGCCGTCTTCTCC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.83 fanout-score-rank=26 prefix-density=0.19 prefix-fanout=4.6 sequence=TGCCGCACTTGCAGGTGGTGCAGTCGCAGCCGCCGCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=387.72 fanout-score-rank=1 prefix-density=1.06 prefix-fanout=28.6 sequence=CGCCGCCGCCGA SRR13662597 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 07:58:47 Started mapping on | Dec 10 07:58:48 Finished on | Dec 10 07:59:34 Mapping speed, Million of reads per hour | 928.83 Number of input reads | 11868336 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 11288885 Uniquely mapped reads % | 95.12% Average mapped length | 246.55 Number of splices: Total | 8182032 Number of splices: Annotated (sjdb) | 7722964 Number of splices: GT/AG | 8067190 Number of splices: GC/AG | 92587 Number of splices: AT/AC | 4610 Number of splices: Non-canonical | 17645 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262354 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 13291 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 317151 317151 317151 N_multimapping 262354 262354 262354 N_noFeature 295488 5666984 5665621 N_ambiguous 293721 22523 22790 UnstrandedReadsAssigned:10699676 PositiveStrandReadsAssigned:5599378 NegativeStrandReadsAssigned:5600474 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662597 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662597-trimmed-pair1.fastq SRR13662597-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,868,336 reads, 11,172,162 reads pseudoaligned [quant] estimated average fragment length: 192.729 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52973 SRR13662597.ke.tsv 35125 SRR13662597.se.tsv 88098 total ==> SRR13662597.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.464 0 0 PNS24247 1044 852.271 14.9313 2.04534 PNS24249 1928 1736.27 137.643 9.25514 PNS24246 1044 852.271 14.9313 2.04534 PNS24248 1044 852.271 14.9313 2.04534 PNS24244 1471 1279.27 72.563 6.62214 PNS24243 293 107.32 5 5.43922 KQK14069 1603 1411.27 4694.19 388.325 KQK14071 474 283.972 495.808 203.837 ==> SRR13662597.se.tsv <== BRADI_1g14170v3 5370 BRADI_1g53295v3 57 BRADI_1g59795v3 203 BRADI_1g07683v3 0 BRADI_1g00485v3 10 BRADI_1g20270v3 581 BRADI_1g74790v3 110 BRADI_1g09890v3 14 BRADI_1g77505v3 226 BRADI_1g48960v3 0 SRR13662597 completed mapping pipeline successfully