Starting /dee2/code/volunteer_pipeline.sh SRR13662598 current disk space = 1526759591936 free memory = 1597900956 SRR13662598 SRAfilesize a4f001702cde03f80defa38104d2d01a SRR13662598.sra SRR13662598.sra file validated SRR13662598 is paired end SRR13662598 is conventional basespace SRR13662598 read1 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662598_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.523 33.0 33.0 34.0 31.0 34.0 2 32.55225 34.0 33.0 34.0 31.0 34.0 3 32.643 34.0 33.0 34.0 31.0 34.0 4 32.55175 34.0 33.0 34.0 31.0 34.0 5 32.49975 34.0 33.0 34.0 31.0 34.0 6 36.12575 38.0 36.0 38.0 33.0 38.0 7 36.6445 38.0 37.0 38.0 34.0 38.0 8 36.77 38.0 38.0 38.0 34.0 38.0 9 36.88925 38.0 38.0 38.0 35.0 38.0 10-11 36.952749999999995 38.0 38.0 38.0 35.5 38.0 12-13 36.92075 38.0 38.0 38.0 35.0 38.0 14-15 36.879625 38.0 38.0 38.0 35.0 38.0 16-17 36.95 38.0 38.0 38.0 35.0 38.0 18-19 36.94475 38.0 38.0 38.0 35.0 38.0 20-21 36.96875 38.0 38.0 38.0 35.0 38.0 22-23 36.913375 38.0 38.0 38.0 35.0 38.0 24-25 36.911125 38.0 38.0 38.0 35.0 38.0 26-27 36.834375 38.0 38.0 38.0 34.5 38.0 28-29 36.855875 38.0 38.0 38.0 35.0 38.0 30-31 36.886125 38.0 38.0 38.0 35.0 38.0 32-33 36.831875 38.0 38.0 38.0 35.0 38.0 34-35 36.773875000000004 38.0 38.0 38.0 34.5 38.0 36-37 36.872625 38.0 38.0 38.0 35.0 38.0 38-39 36.753625 38.0 38.0 38.0 35.0 38.0 40-41 36.793 38.0 38.0 38.0 35.0 38.0 42-43 36.737375 38.0 38.0 38.0 34.5 38.0 44-45 36.709125 38.0 38.0 38.0 34.0 38.0 46-47 36.698625 38.0 38.0 38.0 34.0 38.0 48-49 36.678375 38.0 38.0 38.0 34.0 38.0 50-51 36.695875 38.0 38.0 38.0 34.5 38.0 52-53 36.666375 38.0 38.0 38.0 34.0 38.0 54-55 36.640875 38.0 38.0 38.0 34.0 38.0 56-57 36.600624999999994 38.0 38.0 38.0 34.0 38.0 58-59 36.614875 38.0 38.0 38.0 34.0 38.0 60-61 36.634 38.0 38.0 38.0 34.0 38.0 62-63 36.592 38.0 38.0 38.0 34.0 38.0 64-65 36.623999999999995 38.0 38.0 38.0 34.0 38.0 66-67 36.582375 38.0 38.0 38.0 34.0 38.0 68-69 36.528375 38.0 38.0 38.0 34.0 38.0 70-71 36.415000000000006 38.0 38.0 38.0 34.0 38.0 72-73 36.459625 38.0 38.0 38.0 33.5 38.0 74-75 36.461 38.0 38.0 38.0 34.0 38.0 76-77 36.468500000000006 38.0 38.0 38.0 34.0 38.0 78-79 36.415875 38.0 38.0 38.0 34.0 38.0 80-81 36.306375 38.0 38.0 38.0 33.5 38.0 82-83 36.321 38.0 38.0 38.0 33.5 38.0 84-85 36.296375 38.0 38.0 38.0 34.0 38.0 86-87 36.285375 38.0 38.0 38.0 34.0 38.0 88-89 36.253375 38.0 38.0 38.0 33.0 38.0 90-91 36.301874999999995 38.0 38.0 38.0 34.0 38.0 92-93 36.258875 38.0 38.0 38.0 33.5 38.0 94-95 36.142375 38.0 37.5 38.0 33.0 38.0 96-97 36.042375 38.0 37.0 38.0 32.5 38.0 98-99 36.060625 38.0 37.0 38.0 33.0 38.0 100-101 36.067625 38.0 37.0 38.0 33.0 38.0 102-103 35.98525 38.0 37.0 38.0 33.0 38.0 104-105 35.95275 38.0 37.0 38.0 32.5 38.0 106-107 35.94775 38.0 37.0 38.0 32.5 38.0 108-109 35.83925 38.0 37.0 38.0 32.5 38.0 110-111 35.750625 38.0 37.0 38.0 31.0 38.0 112-113 35.794375 38.0 37.0 38.0 31.5 38.0 114-115 35.826125000000005 38.0 37.0 38.0 32.0 38.0 116-117 35.640375 38.0 36.0 38.0 31.0 38.0 118-119 35.474000000000004 38.0 36.0 38.0 31.0 38.0 120-121 35.431625 38.0 36.0 38.0 31.0 38.0 122-123 35.422250000000005 38.0 36.0 38.0 31.5 38.0 124-125 34.914125 38.0 36.0 38.0 31.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 1.0 18 2.0 19 1.0 20 2.0 21 3.0 22 6.0 23 8.0 24 14.0 25 11.0 26 25.0 27 22.0 28 37.0 29 47.0 30 59.0 31 70.0 32 112.0 33 119.0 34 178.0 35 258.0 36 492.0 37 2531.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.025 10.825 9.700000000000001 38.45 2 32.675 16.2 28.199999999999996 22.925 3 29.95 22.400000000000002 18.525 29.125 4 32.525 28.9 16.425 22.15 5 32.175 29.15 19.0 19.675 6 23.225 34.825 19.475 22.475 7 23.150000000000002 16.3 35.075 25.474999999999998 8 23.025000000000002 19.575 25.0 32.4 9 25.75 19.075 26.375 28.799999999999997 10-11 27.55 28.3875 19.0875 24.975 12-13 27.2625 21.1125 24.875 26.75 14-15 26.4625 21.987499999999997 24.4125 27.1375 16-17 28.8625 22.4625 22.225 26.450000000000003 18-19 27.5875 23.175 22.5875 26.650000000000002 20-21 27.05 23.1375 23.05 26.7625 22-23 27.500000000000004 22.9375 22.6 26.9625 24-25 26.85 24.0625 22.537499999999998 26.55 26-27 27.250000000000004 24.25 22.4375 26.0625 28-29 26.775 23.65 22.075 27.500000000000004 30-31 27.224999999999998 23.375 23.1125 26.2875 32-33 26.85 23.25 23.2625 26.637499999999996 34-35 26.9125 23.8375 22.8375 26.4125 36-37 27.6625 22.237499999999997 22.537499999999998 27.5625 38-39 27.487499999999997 24.0375 22.15 26.325 40-41 27.762500000000003 23.5375 22.05 26.650000000000002 42-43 26.6625 23.0625 22.6 27.675 44-45 26.55 24.425 22.8125 26.2125 46-47 26.9625 23.45 22.175 27.4125 48-49 27.150000000000002 22.7625 22.7 27.3875 50-51 26.924999999999997 23.375 23.525 26.174999999999997 52-53 27.400000000000002 23.5625 22.4375 26.6 54-55 28.012500000000003 23.45 21.65 26.887499999999996 56-57 26.25 23.3625 23.7625 26.625 58-59 26.937499999999996 23.35 22.4625 27.250000000000004 60-61 26.325 23.4625 23.05 27.1625 62-63 26.637499999999996 23.5875 23.0375 26.737499999999997 64-65 26.775 22.9625 23.35 26.9125 66-67 27.650000000000002 23.1125 22.4625 26.775 68-69 26.987499999999997 22.237499999999997 22.9375 27.8375 70-71 26.8375 22.900000000000002 22.675 27.5875 72-73 27.400000000000002 22.6125 23.125 26.8625 74-75 27.8125 22.4375 22.8375 26.9125 76-77 27.6625 22.675 23.2375 26.424999999999997 78-79 27.725 22.7625 22.45 27.0625 80-81 27.287499999999998 23.225 22.45 27.037499999999998 82-83 27.224999999999998 23.3625 22.7125 26.700000000000003 84-85 26.875 23.05 23.1375 26.937499999999996 86-87 26.5125 23.275000000000002 23.125 27.0875 88-89 26.775 23.5125 22.55 27.1625 90-91 27.5125 22.5 22.8625 27.125 92-93 25.575 23.5 23.0125 27.9125 94-95 27.125 22.5875 23.1625 27.125 96-97 26.325 23.425 22.925 27.325 98-99 27.487499999999997 23.0375 22.8875 26.5875 100-101 27.175 22.900000000000002 22.6 27.325 102-103 27.35 23.1 22.5625 26.987499999999997 104-105 27.3875 22.1375 22.9875 27.487499999999997 106-107 27.275 22.8125 22.9375 26.974999999999998 108-109 27.55 22.8875 22.3375 27.224999999999998 110-111 26.775 23.7 22.25 27.275 112-113 28.462500000000002 22.7375 22.85 25.95 114-115 26.687499999999996 22.25 23.275000000000002 27.787499999999998 116-117 27.5125 22.7 23.1125 26.674999999999997 118-119 26.85 22.7 23.25 27.200000000000003 120-121 27.224999999999998 23.05 23.5625 26.1625 122-123 27.800000000000004 22.6375 23.275000000000002 26.2875 124-125 27.750000000000004 21.775 22.662499999999998 27.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 1.5 26 1.5 27 1.5 28 4.0 29 3.0 30 4.0 31 8.5 32 6.0 33 6.0 34 16.0 35 20.0 36 29.0 37 45.0 38 54.5 39 59.0 40 80.0 41 112.5 42 129.0 43 132.0 44 138.5 45 143.0 46 154.0 47 149.0 48 131.5 49 139.5 50 140.0 51 125.5 52 111.0 53 113.5 54 114.5 55 97.0 56 95.0 57 96.0 58 80.0 59 84.0 60 85.5 61 87.5 62 94.0 63 84.0 64 70.5 65 66.5 66 79.5 67 89.0 68 85.5 69 73.5 70 87.0 71 86.5 72 62.5 73 59.0 74 56.5 75 47.0 76 41.5 77 33.5 78 27.5 79 20.0 80 8.0 81 7.5 82 7.5 83 4.5 84 1.5 85 0.5 86 1.0 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13662598 read2 length is 125 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13662598_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 125 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.21625 33.0 33.0 34.0 31.0 34.0 2 32.395 33.0 33.0 34.0 31.0 34.0 3 32.399 33.0 33.0 34.0 31.0 34.0 4 32.26925 33.0 33.0 34.0 31.0 34.0 5 32.26125 33.0 33.0 34.0 31.0 34.0 6 36.18325 38.0 38.0 38.0 33.0 38.0 7 36.317 38.0 38.0 38.0 33.0 38.0 8 36.3655 38.0 38.0 38.0 33.0 38.0 9 36.27425 38.0 38.0 38.0 33.0 38.0 10-11 36.235375000000005 38.0 38.0 38.0 33.0 38.0 12-13 36.282125 38.0 38.0 38.0 33.0 38.0 14-15 36.281875 38.0 38.0 38.0 33.0 38.0 16-17 36.295375 38.0 38.0 38.0 33.0 38.0 18-19 36.2225 38.0 38.0 38.0 33.0 38.0 20-21 36.28675 38.0 38.0 38.0 33.0 38.0 22-23 36.1945 38.0 38.0 38.0 33.0 38.0 24-25 36.295625 38.0 38.0 38.0 33.0 38.0 26-27 36.388625000000005 38.0 38.0 38.0 33.0 38.0 28-29 36.233875 38.0 38.0 38.0 33.0 38.0 30-31 36.265125 38.0 38.0 38.0 33.0 38.0 32-33 36.352875 38.0 38.0 38.0 33.0 38.0 34-35 36.258250000000004 38.0 38.0 38.0 33.0 38.0 36-37 36.16175 38.0 38.0 38.0 33.0 38.0 38-39 36.15 38.0 38.0 38.0 33.0 38.0 40-41 36.314750000000004 38.0 38.0 38.0 33.5 38.0 42-43 36.299375 38.0 38.0 38.0 33.0 38.0 44-45 36.260125 38.0 38.0 38.0 33.0 38.0 46-47 36.224500000000006 38.0 38.0 38.0 33.0 38.0 48-49 36.148624999999996 38.0 38.0 38.0 33.0 38.0 50-51 36.269000000000005 38.0 38.0 38.0 33.0 38.0 52-53 36.217 38.0 38.0 38.0 33.0 38.0 54-55 36.152875 38.0 38.0 38.0 33.0 38.0 56-57 36.194874999999996 38.0 37.5 38.0 33.0 38.0 58-59 36.183875 38.0 38.0 38.0 33.0 38.0 60-61 36.087125 38.0 38.0 38.0 32.5 38.0 62-63 36.06575 38.0 38.0 38.0 32.0 38.0 64-65 36.093999999999994 38.0 37.5 38.0 32.5 38.0 66-67 36.03925 38.0 37.0 38.0 32.0 38.0 68-69 36.0645 38.0 37.0 38.0 33.0 38.0 70-71 36.1385 38.0 38.0 38.0 33.0 38.0 72-73 36.02325 38.0 37.5 38.0 32.5 38.0 74-75 35.9815 38.0 37.0 38.0 31.5 38.0 76-77 35.854875 38.0 37.0 38.0 31.0 38.0 78-79 35.8285 38.0 37.0 38.0 31.0 38.0 80-81 35.703875 38.0 37.0 38.0 31.0 38.0 82-83 35.697375 38.0 37.0 38.0 30.5 38.0 84-85 35.692125000000004 38.0 37.0 38.0 31.0 38.0 86-87 35.514875 38.0 37.0 38.0 30.0 38.0 88-89 35.584125 38.0 37.0 38.0 30.0 38.0 90-91 35.47825 38.0 36.5 38.0 29.5 38.0 92-93 35.468 38.0 36.5 38.0 30.0 38.0 94-95 35.552 38.0 37.0 38.0 30.5 38.0 96-97 35.478625 38.0 37.0 38.0 29.0 38.0 98-99 35.527375000000006 38.0 37.0 38.0 31.0 38.0 100-101 35.39675 38.0 36.0 38.0 29.0 38.0 102-103 35.383624999999995 38.0 36.0 38.0 30.0 38.0 104-105 35.292375 38.0 36.0 38.0 29.0 38.0 106-107 35.226625 38.0 36.0 38.0 28.5 38.0 108-109 35.123999999999995 38.0 36.0 38.0 28.5 38.0 110-111 35.061625 38.0 36.0 38.0 28.5 38.0 112-113 34.7615 38.0 36.0 38.0 27.0 38.0 114-115 34.583625 38.0 35.5 38.0 25.0 38.0 116-117 34.583875 38.0 35.0 38.0 24.5 38.0 118-119 34.663 38.0 35.0 38.0 27.0 38.0 120-121 34.629375 38.0 36.0 38.0 26.5 38.0 122-123 34.372625 38.0 35.0 38.0 25.5 38.0 124-125 33.880875 38.0 35.0 38.0 24.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 5.0 15 2.0 16 3.0 17 5.0 18 6.0 19 6.0 20 10.0 21 11.0 22 12.0 23 23.0 24 26.0 25 37.0 26 30.0 27 45.0 28 48.0 29 73.0 30 72.0 31 95.0 32 106.0 33 143.0 34 191.0 35 266.0 36 439.0 37 2344.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.05 10.125 9.475 39.35 2 32.5 17.424999999999997 26.924999999999997 23.150000000000002 3 29.299999999999997 22.8 18.725 29.175 4 32.4 28.499999999999996 14.249999999999998 24.85 5 31.05 30.575000000000003 18.425 19.950000000000003 6 23.724999999999998 33.125 19.7 23.45 7 22.1 16.950000000000003 35.5 25.45 8 24.95 20.25 24.2 30.599999999999998 9 25.45 18.375 26.700000000000003 29.475 10-11 28.475 27.187499999999996 19.125 25.2125 12-13 25.337500000000002 21.7375 25.525 27.400000000000002 14-15 26.924999999999997 23.3 23.974999999999998 25.8 16-17 27.3375 23.4375 22.662499999999998 26.5625 18-19 26.687499999999996 22.9375 22.9375 27.437499999999996 20-21 26.6 22.925 23.575 26.900000000000002 22-23 27.200000000000003 23.5875 22.8 26.4125 24-25 26.8 23.150000000000002 23.025000000000002 27.025 26-27 27.125 24.3625 22.525000000000002 25.9875 28-29 27.6125 23.1125 22.537499999999998 26.737499999999997 30-31 27.250000000000004 23.8125 21.775 27.1625 32-33 27.125 23.8375 23.0625 25.974999999999998 34-35 26.950000000000003 23.0875 22.662499999999998 27.3 36-37 26.0375 23.799999999999997 22.55 27.6125 38-39 27.212500000000002 23.1125 22.9875 26.687499999999996 40-41 27.700000000000003 22.75 22.625 26.924999999999997 42-43 26.575 23.775 22.875 26.775 44-45 27.287499999999998 22.9875 23.799999999999997 25.924999999999997 46-47 27.6125 22.7 22.8875 26.8 48-49 26.75 23.474999999999998 23.25 26.525 50-51 27.750000000000004 22.5 22.900000000000002 26.85 52-53 27.3125 22.725 22.650000000000002 27.3125 54-55 26.650000000000002 22.825 23.0625 27.462500000000002 56-57 26.056514128532132 24.168542135533883 22.593148287071767 27.181795448862218 58-59 28.1125 23.125 22.400000000000002 26.3625 60-61 27.3125 22.787499999999998 22.662499999999998 27.237499999999997 62-63 26.825 22.5625 23.0875 27.525 64-65 27.710391396773794 22.733525071901965 22.24584219082156 27.31024134050269 66-67 26.937499999999996 22.6 22.475 27.987499999999997 68-69 26.575 23.9875 22.8375 26.6 70-71 27.200000000000003 22.5125 22.975 27.3125 72-73 27.3 23.1125 23.5875 26.0 74-75 27.437499999999996 23.724999999999998 22.5125 26.325 76-77 27.3875 22.325 22.7 27.5875 78-79 27.037499999999998 22.9875 22.875 27.1 80-81 27.537499999999998 22.9875 23.3125 26.1625 82-83 27.575 22.775000000000002 22.787499999999998 26.8625 84-85 26.650000000000002 23.075000000000003 22.3625 27.9125 86-87 26.087500000000002 23.4125 23.3375 27.1625 88-89 27.275 22.3875 22.85 27.487499999999997 90-91 26.900000000000002 22.8125 22.75 27.537499999999998 92-93 27.425 22.175 23.925 26.474999999999998 94-95 27.200000000000003 23.05 22.55 27.200000000000003 96-97 26.487500000000004 22.5625 23.25 27.700000000000003 98-99 27.737499999999997 22.9875 22.3375 26.937499999999996 100-101 27.6 23.0625 22.725 26.6125 102-103 26.5625 22.7625 22.0 28.675 104-105 26.85 23.025000000000002 22.675 27.450000000000003 106-107 27.3875 22.85 22.5625 27.200000000000003 108-109 27.240773286467483 22.031132312327394 23.035400451920662 27.692693949284457 110-111 26.93754702784048 23.426134938550288 22.786556308001003 26.84976172560823 112-113 26.692724750977177 22.88488210818308 23.300970873786408 27.121422267053337 114-115 26.202738349453586 22.71071473432986 23.04986810702173 28.036678809194825 116-117 26.5875 23.5 23.05 26.8625 118-119 27.051025512756375 24.12456228114057 22.07353676838419 26.750875437718857 120-121 26.581645411352838 23.093273318329583 23.53088272068017 26.79419854963741 122-123 26.9125 23.35 23.1375 26.6 124-125 27.678459807475935 22.677834729341168 22.452806600825102 27.19089886235779 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.5 28 4.5 29 5.0 30 8.5 31 8.0 32 6.0 33 6.5 34 11.0 35 25.5 36 33.0 37 36.0 38 55.0 39 74.0 40 83.5 41 99.5 42 109.0 43 124.0 44 146.0 45 160.5 46 158.5 47 151.0 48 143.5 49 136.0 50 139.0 51 130.0 52 120.5 53 111.0 54 97.0 55 94.0 56 91.5 57 82.0 58 84.5 59 81.0 60 80.0 61 77.5 62 68.5 63 89.0 64 101.5 65 89.5 66 78.5 67 83.5 68 86.0 69 77.5 70 79.0 71 74.0 72 61.0 73 63.0 74 63.0 75 57.0 76 42.5 77 27.0 78 23.5 79 15.5 80 12.5 81 12.0 82 6.5 83 4.5 84 4.5 85 2.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.025 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0375 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.42500000000000004 110-111 0.325 112-113 0.8625 114-115 0.4875 116-117 0.0 118-119 0.05 120-121 0.025 122-123 0.0 124-125 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 125 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720102 spots for SRR13662598.sra Written 720102 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra Read 720095 spots for SRR13662598.sra Written 720095 spots for SRR13662598.sra SRR ids: ['SRR13662598.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b9mbfwgj SRR13662598.sra spots: 14401907 blocks: [[1, 720095], [720096, 1440190], [1440191, 2160285], [2160286, 2880380], [2880381, 3600475], [3600476, 4320570], [4320571, 5040665], [5040666, 5760760], [5760761, 6480855], [6480856, 7200950], [7200951, 7921045], [7921046, 8641140], [8641141, 9361235], [9361236, 10081330], [10081331, 10801425], [10801426, 11521520], [11521521, 12241615], [12241616, 12961710], [12961711, 13681805], [13681806, 14401907]] SRR13662598 file size 4141350 SRR13662598 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13662598 SRR13662598_1.fastq SRR13662598_2.fastq Input file: SRR13662598_1.fastq Paired file: SRR13662598_2.fastq trimmed: SRR13662598-trimmed-pair1.fastq, SRR13662598-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 08:09:12 2024 >> started Tue Dec 10 08:09:26 2024 >> done (14.328s) 14401907 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 260 ( 0.00%) empty read pairs filtered out after trimming by size control 14401647 (100.00%) read pairs available; of these: 1953605 (13.57%) trimmed read pairs available after processing 12448042 (86.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 1 0.00% 38 1 0.00% 39 0 0.00% 40 1 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 1 0.00% 47 1 0.00% 48 1 0.00% 49 2 0.00% 50 0 0.00% 51 1 0.00% 52 0 0.00% 53 4 0.00% 54 5 0.00% 55 2 0.00% 56 4 0.00% 57 1 0.00% 58 2 0.00% 59 2 0.00% 60 8 0.00% 61 6 0.00% 62 9 0.00% 63 38 0.00% 64 73 0.00% 65 91 0.00% 66 125 0.00% 67 139 0.00% 68 174 0.00% 69 173 0.00% 70 216 0.00% 71 250 0.00% 72 286 0.00% 73 291 0.00% 74 342 0.00% 75 368 0.00% 76 436 0.00% 77 459 0.00% 78 472 0.00% 79 513 0.00% 80 589 0.00% 81 628 0.00% 82 699 0.00% 83 728 0.01% 84 824 0.01% 85 830 0.01% 86 979 0.01% 87 1080 0.01% 88 1186 0.01% 89 1310 0.01% 90 1496 0.01% 91 1662 0.01% 92 2011 0.01% 93 2483 0.02% 94 5857 0.04% 95 6060 0.04% 96 6507 0.05% 97 6795 0.05% 98 7089 0.05% 99 7278 0.05% 100 7731 0.05% 101 8077 0.06% 102 8339 0.06% 103 9029 0.06% 104 9278 0.06% 105 9847 0.07% 106 10187 0.07% 107 10737 0.07% 108 11763 0.08% 109 12589 0.09% 110 14025 0.10% 111 15539 0.11% 112 16868 0.12% 113 19040 0.13% 114 21280 0.15% 115 24963 0.17% 116 58009 0.40% 117 62694 0.44% 118 72579 0.50% 119 84899 0.59% 120 102738 0.71% 121 130583 0.91% 122 183273 1.27% 123 294375 2.04% 124 694568 4.82% 125 12448042 86.43% 14401647 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.93 fanout-score-rank=28 prefix-density=0.15 prefix-fanout=4.6 sequence=TGCCGCACTTGCAGGTGGTGCAGTCGCAGCCGCCGCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=412.43 fanout-score-rank=1 prefix-density=1.16 prefix-fanout=28.9 sequence=CGCCGCCGCCATCCCCTCCAAGTGCGGCGTCAGCATCCCTTACACCATCAGCCCCTCCGTCGACTGCTCCAGGGTCAACTAGAGAGATCGAGAGATCGGCCGTCTTCTCC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=5.05 fanout-score-rank=30 prefix-density=0.15 prefix-fanout=4.7 sequence=TGCCGCACTTGCAGGTGGTGCAGTCGCAGCCGCCGCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=21 fanout-score=413.87 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=28.6 sequence=CGCCGCCGCCATCCCCTCCAAGTGCGGCGTCAGCATCCCTTACACCATCAGCCCCTCCGTCGACTGCTCCAGGGTCAACTAGAGAGATCGAGAGATCGGCCGTCTTCTCC SRR13662598 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 08:10:07 Started mapping on | Dec 10 08:10:08 Finished on | Dec 10 08:10:57 Mapping speed, Million of reads per hour | 1058.08 Number of input reads | 14401647 Average input read length | 248 UNIQUE READS: Uniquely mapped reads number | 13713359 Uniquely mapped reads % | 95.22% Average mapped length | 246.41 Number of splices: Total | 10020201 Number of splices: Annotated (sjdb) | 9444552 Number of splices: GT/AG | 9878260 Number of splices: GC/AG | 114784 Number of splices: AT/AC | 5942 Number of splices: Non-canonical | 21215 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.21 Insertion rate per base | 0.01% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 320315 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 15290 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 368022 368022 368022 N_multimapping 320315 320315 320315 N_noFeature 364563 6891982 6902613 N_ambiguous 332724 26439 26735 UnstrandedReadsAssigned:13016072 PositiveStrandReadsAssigned:6794938 NegativeStrandReadsAssigned:6784011 Dataset is classified unstranded MeadianReadLen=125 20thPercentileLength=125 echo kmer=121 SRR13662598 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13662598-trimmed-pair1.fastq SRR13662598-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,401,647 reads, 13,550,370 reads pseudoaligned [quant] estimated average fragment length: 192.436 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 SRR13662598.ke.tsv 35125 SRR13662598.se.tsv 88098 total ==> SRR13662598.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.77 0 0 PNS24247 1044 852.564 20.668 2.39771 PNS24249 1928 1736.56 202.661 11.5426 PNS24246 1044 852.564 20.668 2.39771 PNS24248 1044 852.564 20.668 2.39771 PNS24244 1471 1279.56 50.3348 3.89072 PNS24243 293 107.932 6 5.49827 KQK14069 1603 1411.56 4446.49 311.559 KQK14071 474 284.508 480.107 166.904 ==> SRR13662598.se.tsv <== BRADI_1g14170v3 5098 BRADI_1g53295v3 58 BRADI_1g59795v3 205 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 626 BRADI_1g74790v3 132 BRADI_1g09890v3 19 BRADI_1g77505v3 245 BRADI_1g48960v3 0 SRR13662598 completed mapping pipeline successfully