Starting /dee2/code/volunteer_pipeline.sh SRR13844633 current disk space = 1551372558336 free memory = 1599050532 SRR13844633 SRAfilesize b4e458f6d60518ad1a74f02713eeb10e SRR13844633.sra SRR13844633.sra file validated SRR13844633 is paired end SRR13844633 is conventional basespace SRR13844633 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844633_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.871 34.0 31.0 34.0 31.0 34.0 2 32.72925 34.0 31.0 34.0 31.0 34.0 3 32.953 34.0 31.0 34.0 31.0 34.0 4 36.42475 37.0 37.0 37.0 35.0 37.0 5 36.31425 37.0 37.0 37.0 35.0 37.0 6 36.11025 37.0 36.0 37.0 35.0 37.0 7 36.26525 37.0 37.0 37.0 35.0 37.0 8 36.12225 37.0 36.0 37.0 35.0 37.0 9 37.92225 39.0 38.0 39.0 35.0 39.0 10-11 37.948 39.0 38.0 39.0 35.0 39.0 12-13 37.987624999999994 39.0 38.0 39.0 35.0 39.0 14-15 39.513999999999996 41.0 39.0 41.0 36.5 41.0 16-17 39.424375 41.0 39.0 41.0 36.0 41.0 18-19 39.293625 41.0 39.0 41.0 36.0 41.0 20-21 39.081625 41.0 39.0 41.0 35.5 41.0 22-23 38.987625 41.0 39.0 41.0 35.0 41.0 24-25 38.838625 41.0 39.0 41.0 35.0 41.0 26-27 38.579750000000004 41.0 39.0 41.0 35.0 41.0 28-29 38.34425 40.5 38.5 41.0 34.5 41.0 30-31 38.123 40.0 38.0 41.0 34.0 41.0 32-33 38.105875 40.0 38.0 41.0 34.0 41.0 34-35 37.72775 40.0 38.0 41.0 33.0 41.0 36-37 37.529375 40.0 38.0 41.0 32.5 41.0 38-39 37.647375 40.0 38.0 41.0 33.0 41.0 40-41 37.593875 40.0 38.0 41.0 33.0 41.0 42-43 37.34975 40.0 37.5 41.0 32.0 41.0 44-45 37.122749999999996 40.0 37.0 41.0 31.5 41.0 46-47 37.25475 40.0 37.0 41.0 32.5 41.0 48-49 37.10875 40.0 37.0 41.0 31.5 41.0 50-51 37.089625 40.0 37.0 41.0 31.5 41.0 52-53 36.952625 40.0 36.5 41.0 31.5 41.0 54-55 36.84175 40.0 36.5 41.0 31.0 41.0 56-57 36.5995 39.0 36.0 41.0 31.0 41.0 58-59 36.341499999999996 39.0 35.5 41.0 30.0 41.0 60-61 35.89525 38.5 35.0 41.0 28.5 41.0 62-63 35.957125 39.0 35.0 41.0 29.5 41.0 64-65 36.217375000000004 39.0 35.0 41.0 31.5 41.0 66-67 35.885 38.0 35.0 40.0 31.0 41.0 68-69 35.22825 37.0 34.5 39.5 29.5 41.0 70-71 34.75087499999999 36.5 34.5 39.0 29.0 41.0 72-73 34.33525 36.0 34.0 39.0 28.5 41.0 74-75 34.00675 35.5 34.0 38.0 28.0 40.0 76-77 32.895375 35.0 32.5 37.0 26.5 39.0 78-79 33.6375 35.0 34.0 37.0 29.0 39.0 80-81 33.384375 35.0 34.0 36.0 29.0 39.0 82-83 33.200125 35.0 34.0 36.0 29.0 37.0 84-85 33.180875 35.0 34.0 36.0 30.0 37.0 86-87 32.968375 35.0 34.0 35.0 29.5 36.5 88-89 32.556375 35.0 34.0 35.0 29.0 36.0 90-91 32.528625000000005 35.0 34.0 35.0 29.0 36.0 92-93 32.335125000000005 35.0 34.0 35.0 29.0 36.0 94-95 32.135 35.0 33.5 35.0 27.5 36.0 96-97 31.963375 35.0 33.0 35.0 26.5 35.0 98-99 31.81225 35.0 33.5 35.0 26.5 35.0 100-101 30.349 34.5 31.0 35.0 21.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 6.0 8 9.0 9 26.0 10 34.0 11 12.0 12 18.0 13 5.0 14 4.0 15 5.0 16 6.0 17 1.0 18 5.0 19 6.0 20 5.0 21 4.0 22 5.0 23 7.0 24 14.0 25 19.0 26 24.0 27 15.0 28 26.0 29 48.0 30 53.0 31 76.0 32 91.0 33 121.0 34 169.0 35 229.0 36 447.0 37 888.0 38 1292.0 39 330.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.406101525381345 16.67916979244811 8.377094273568392 50.53763440860215 2 14.95 21.3 49.2 14.549999999999999 3 22.375 24.625 28.449999999999996 24.55 4 24.8 30.25 24.775 20.175 5 24.325 32.625 28.499999999999996 14.549999999999999 6 21.8 34.175 29.575000000000003 14.45 7 17.150000000000002 19.125 47.325 16.400000000000002 8 16.925 21.4 39.175 22.5 9 19.475 20.075000000000003 41.699999999999996 18.75 10-11 21.925 31.275 28.462500000000002 18.337500000000002 12-13 20.5 25.362499999999997 33.15 20.9875 14-15 20.8875 27.075 31.974999999999998 20.0625 16-17 20.575 28.037499999999998 31.05 20.3375 18-19 21.55 27.224999999999998 30.837500000000002 20.3875 20-21 22.0 28.199999999999996 29.75 20.05 22-23 21.837500000000002 27.875 29.5 20.7875 24-25 21.375 28.4375 29.312500000000004 20.875 26-27 21.8 28.999999999999996 28.712500000000002 20.4875 28-29 22.3125 29.2375 27.237499999999997 21.212500000000002 30-31 22.825 28.275 27.525 21.375 32-33 21.7 29.5375 28.599999999999998 20.1625 34-35 21.5 29.012500000000003 28.037499999999998 21.45 36-37 21.762500000000003 29.175 28.050000000000004 21.0125 38-39 21.475 28.849999999999998 27.787499999999998 21.8875 40-41 21.5 29.2375 28.1625 21.099999999999998 42-43 22.2625 29.375 27.150000000000002 21.212500000000002 44-45 21.8875 27.3375 29.262500000000003 21.512500000000003 46-47 22.175 28.762500000000003 28.425 20.6375 48-49 22.45 28.1375 27.700000000000003 21.712500000000002 50-51 21.837500000000002 29.125 27.400000000000002 21.637500000000003 52-53 22.8375 28.075 27.287499999999998 21.8 54-55 21.475 29.1875 27.6625 21.675 56-57 22.112499999999997 28.6375 27.6875 21.5625 58-59 22.0625 28.65 27.775 21.512500000000003 60-61 21.25 28.7 27.8875 22.162499999999998 62-63 21.15 29.2875 27.6375 21.925 64-65 22.2125 29.1375 27.437499999999996 21.212500000000002 66-67 22.475 28.9125 27.1125 21.5 68-69 22.5125 28.499999999999996 27.787499999999998 21.2 70-71 21.725 28.787499999999998 27.212500000000002 22.275 72-73 21.3625 29.2 28.1125 21.325 74-75 21.0375 29.3875 28.037499999999998 21.5375 76-77 21.8625 29.65 27.725 20.7625 78-79 21.087500000000002 29.562500000000004 27.875 21.475 80-81 21.5 28.0875 28.025 22.3875 82-83 22.5625 28.599999999999998 27.625 21.212500000000002 84-85 21.325 29.312500000000004 27.750000000000004 21.6125 86-87 21.575 29.099999999999998 28.175 21.15 88-89 22.2 29.5 27.3625 20.9375 90-91 22.3625 29.2375 27.187499999999996 21.212500000000002 92-93 21.5625 29.0875 27.500000000000004 21.85 94-95 21.4375 28.962500000000002 28.15 21.45 96-97 21.375 29.8875 27.4125 21.325 98-99 22.6875 29.725 27.1 20.4875 100-101 21.2875 29.5 27.675 21.5375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.5 11 0.5 12 3.0 13 3.0 14 1.0 15 4.5 16 6.5 17 5.5 18 5.0 19 4.0 20 3.0 21 4.5 22 6.0 23 6.5 24 5.0 25 5.0 26 7.0 27 11.5 28 17.5 29 22.0 30 31.5 31 39.5 32 48.5 33 62.0 34 91.5 35 121.0 36 131.5 37 166.5 38 206.0 39 219.0 40 234.5 41 226.5 42 224.5 43 237.0 44 210.5 45 203.5 46 192.0 47 159.0 48 154.0 49 143.5 50 115.0 51 97.0 52 85.5 53 74.5 54 66.5 55 53.0 56 44.0 57 34.5 58 24.5 59 20.5 60 24.0 61 24.0 62 18.0 63 18.0 64 13.0 65 8.5 66 7.0 67 3.5 68 4.0 69 4.0 70 5.5 71 6.5 72 6.0 73 4.5 74 2.5 75 3.5 76 2.0 77 0.5 78 1.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.05 #Duplication Level Percentage of deduplicated Percentage of total 1 97.88768675940237 95.0 2 1.6486347243688821 3.2 3 0.1545595054095827 0.44999999999999996 4 0.18031942297784648 0.7000000000000001 5 0.10303967027305513 0.5 6 0.025759917568263783 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTCTTGATTCTGCAGCAAGTCATGCCAGTCTTATCTGTAGTGTTCCC 6 0.15 No Hit CTTAGAACAGGAAACCATTCATACTGCCAGGATCCATCCACATGGGTTCA 5 0.125 No Hit CCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAG 5 0.125 No Hit CCCGTCTTGATTCTGCAGCAAGTCATGCCAGTATTATCCGTAGTGTTCCC 5 0.125 No Hit CTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844633 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844633_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.23325 34.0 31.0 34.0 30.0 34.0 2 32.162 34.0 31.0 34.0 29.0 34.0 3 32.001 34.0 31.0 34.0 27.0 34.0 4 35.59725 37.0 35.0 37.0 32.0 37.0 5 35.5815 37.0 35.0 37.0 32.0 37.0 6 35.39225 37.0 35.0 37.0 32.0 37.0 7 35.52075 37.0 35.0 37.0 32.0 37.0 8 35.45375 37.0 35.0 37.0 32.0 37.0 9 37.385 39.0 38.0 39.0 33.0 39.0 10-11 36.815875 39.0 37.5 39.0 33.0 39.0 12-13 36.407875 39.0 37.5 39.0 32.0 39.0 14-15 37.725875 41.0 38.5 41.0 32.5 41.0 16-17 37.411125 40.5 38.0 41.0 32.0 41.0 18-19 37.244875 40.5 38.0 41.0 31.0 41.0 20-21 37.017125 41.0 38.0 41.0 32.0 41.0 22-23 36.772125 40.5 38.0 41.0 30.5 41.0 24-25 36.627750000000006 40.0 38.0 41.0 29.5 41.0 26-27 36.355625 40.0 38.0 41.0 29.0 41.0 28-29 36.187875000000005 40.0 38.0 41.0 28.0 41.0 30-31 36.10875 40.0 37.5 41.0 28.0 41.0 32-33 35.90275 40.0 37.0 41.0 26.5 41.0 34-35 35.90875 40.0 37.5 41.0 27.5 41.0 36-37 35.67525 40.0 38.0 41.0 24.0 41.0 38-39 35.4295 40.0 37.0 41.0 20.5 41.0 40-41 35.3105 40.0 37.0 41.0 19.5 41.0 42-43 34.893874999999994 40.0 36.5 41.0 5.5 41.0 44-45 34.414625 40.0 35.5 41.0 2.0 41.0 46-47 34.037499999999994 40.0 35.0 41.0 2.0 41.0 48-49 34.064750000000004 40.0 35.0 41.0 2.0 41.0 50-51 33.180125000000004 39.0 34.0 40.0 2.0 40.5 52-53 33.577125 39.0 34.0 40.0 7.5 41.0 54-55 34.141999999999996 39.0 35.0 41.0 8.0 41.0 56-57 34.29125 39.0 35.0 41.0 7.5 41.0 58-59 34.55075 39.0 35.0 41.0 10.5 41.0 60-61 34.50175 39.0 35.0 41.0 8.5 41.0 62-63 34.205625 39.0 35.0 41.0 3.5 41.0 64-65 33.862875 38.5 34.5 41.0 2.0 41.0 66-67 33.419875000000005 37.0 34.0 40.0 2.0 41.0 68-69 32.951625 37.0 34.0 40.0 2.0 41.0 70-71 32.469750000000005 36.5 34.0 39.0 2.0 41.0 72-73 31.8645 36.0 33.5 39.0 2.0 41.0 74-75 31.2975 35.0 33.0 38.5 2.0 40.0 76-77 30.7835 35.0 33.0 37.0 2.0 39.0 78-79 30.284125 35.0 32.5 37.0 2.0 39.0 80-81 29.969250000000002 35.0 32.0 36.0 2.0 38.0 82-83 29.245375 35.0 31.0 35.5 2.0 37.0 84-85 24.556625 33.0 2.0 35.0 2.0 36.0 86-87 24.71425 33.0 2.0 35.0 2.0 36.0 88-89 24.906875 33.0 9.0 35.0 2.0 36.0 90-91 25.3385 33.0 14.5 35.0 2.0 35.0 92-93 25.436625 33.0 18.5 35.0 2.0 35.0 94-95 25.4415 33.5 17.0 35.0 2.0 35.0 96-97 25.106625 33.0 6.0 35.0 2.0 35.0 98-99 24.68275 33.0 2.0 35.0 2.0 35.0 100-101 22.865375 31.0 2.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 10.0 4 80.0 5 9.0 6 35.0 7 52.0 8 44.0 9 36.0 10 33.0 11 25.0 12 18.0 13 12.0 14 10.0 15 12.0 16 8.0 17 7.0 18 12.0 19 13.0 20 17.0 21 17.0 22 30.0 23 31.0 24 27.0 25 28.0 26 44.0 27 46.0 28 49.0 29 57.0 30 83.0 31 118.0 32 143.0 33 145.0 34 163.0 35 261.0 36 413.0 37 729.0 38 991.0 39 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.3 14.95 8.325000000000001 52.425 2 17.075613420130196 18.803204807210815 50.375563345017525 13.745618427641462 3 22.225 23.525 28.9 25.35 4 25.75 28.525 26.5 19.225 5 25.85 29.225 30.95 13.975000000000001 6 19.125 33.324999999999996 32.9 14.649999999999999 7 16.625 17.2 50.05 16.125 8 17.349999999999998 21.8 40.0 20.849999999999998 9 18.45 18.15 42.8 20.599999999999998 10-11 20.96342551293488 31.298585446667516 29.935007009048043 17.80298203134956 12-13 20.493922937677787 24.87716576157228 35.13059219032842 19.498319110421516 14-15 20.329100803316923 26.703809277014773 33.946618294895046 19.020471624773258 16-17 21.45906092355452 27.40913206570948 31.263743370844647 19.868063639891346 18-19 21.058732612055643 26.403915507470376 31.530139103554866 21.00721277691911 20-21 21.185012316867628 27.93984182548943 31.46635550369506 19.40879035394788 22-23 21.643906209739757 28.0468951301211 29.670188095851586 20.639010564287556 24-25 21.637426900584796 28.540554284261376 28.960081362827356 20.86193745232647 26-27 20.986252995333583 29.688485307100514 29.083112624542817 20.24214907302308 28-29 21.71780684104628 28.86066398390342 28.169014084507044 21.25251509054326 30-31 22.00950950950951 29.266766766766768 28.02802802802803 20.695695695695697 32-33 21.704745166959576 28.182274667336177 29.512929952297263 20.600050213406977 34-35 21.46735698951888 29.195605505745675 28.09698194216442 21.24005556257103 36-37 21.82402055234425 29.184328837508026 27.642903018625564 21.34874759152216 38-39 22.39482200647249 29.074433656957925 28.03883495145631 20.491909385113267 40-41 22.109770338653174 28.72713117944726 29.440768132866225 19.722330349033346 42-43 22.334030318870884 28.959749085206482 28.46314688970204 20.243073706220596 44-45 22.312853571898433 27.693724509932906 28.298908038416 21.694513879752662 46-47 21.59494670351362 29.319647322016056 27.674694038689303 21.410711935781023 48-49 21.487057580559956 28.34125726360275 28.34125726360275 21.83042789223455 50-51 22.303595206391478 29.920106524633823 26.657789613848205 21.118508655126497 52-53 21.168545148335276 28.682471822774968 28.29382044306257 21.855162585827177 54-55 21.749774513593607 29.158613580724136 28.076278830047674 21.015333075634583 56-57 21.877384889341133 29.152887306029 27.461205800050877 21.508522004578985 58-59 20.920502092050206 28.80689742614429 28.553315582604284 21.719284899201217 60-61 21.93261284170375 28.709472345835984 27.056579783852513 22.301335028607756 62-63 22.082494969818914 30.520623742454728 26.848591549295776 20.548289738430583 64-65 21.37887413029728 28.855154965211895 28.32384566729918 21.44212523719165 66-67 22.465437788018434 29.237071172555044 27.444956477214543 20.852534562211982 68-69 20.950772827639952 29.822054812313286 28.3023769320691 20.92479542797766 70-71 21.650294695481335 29.037328094302556 27.164374590700717 22.14800261951539 72-73 21.92435301924353 29.396151293961516 27.52488387524884 21.15461181154612 74-75 22.40735803785657 29.485470541189017 26.792855238603043 21.314316182351373 76-77 22.3203532717784 28.542753914090728 27.472233373477856 21.66465944065302 78-79 22.00772200772201 29.157236053787777 27.080282252696048 21.754759685794166 80-81 22.238391321603387 28.13864267760286 27.437491731710544 22.185474269083212 82-83 21.681129387385052 28.49371843025515 27.846133920476625 21.979018261883176 84-85 21.607963246554366 28.958652373660033 27.810107197549772 21.623277182235835 86-87 22.47478548848412 28.405840734607857 27.863916905012797 21.255456871895227 88-89 21.78088171104321 28.109995635093842 29.02662592754256 21.082496726320386 90-91 21.76362868009579 29.17312297506691 28.11663614593605 20.946612198901253 92-93 21.84166198764739 29.660303200449185 27.723189219539584 20.774845592363842 94-95 22.162771050408338 29.850746268656714 26.795268938327233 21.19121374260772 96-97 22.45068074465129 29.03584328980272 26.36843567657683 22.14504028896916 98-99 21.74152659134748 29.14025902452466 27.00468448608432 22.113529898043538 100-101 22.487644151565075 29.763866007688083 27.045579352004395 20.70291048874245 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.0 3 2.0 4 4.5 5 7.5 6 8.5 7 8.5 8 12.0 9 12.0 10 9.5 11 6.5 12 9.5 13 14.0 14 15.0 15 12.5 16 10.0 17 12.5 18 14.5 19 15.5 20 14.0 21 15.5 22 19.5 23 20.0 24 17.5 25 21.5 26 24.5 27 22.0 28 28.0 29 35.0 30 39.0 31 48.0 32 55.5 33 67.5 34 92.5 35 124.0 36 153.5 37 170.5 38 193.5 39 199.0 40 205.0 41 223.5 42 231.0 43 218.5 44 180.5 45 152.5 46 148.5 47 150.5 48 127.5 49 108.5 50 100.0 51 97.0 52 88.5 53 67.5 54 58.5 55 47.5 56 39.5 57 34.0 58 25.5 59 25.5 60 21.5 61 15.0 62 14.0 63 11.5 64 13.5 65 12.0 66 7.5 67 7.0 68 4.5 69 3.0 70 2.0 71 2.5 72 3.5 73 3.5 74 2.5 75 2.0 76 1.5 77 0.5 78 0.5 79 1.5 80 1.0 81 0.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 1.9124999999999999 12-13 3.325 14-15 3.5249999999999995 16-17 3.3625000000000003 18-19 2.9499999999999997 20-21 3.5875 22-23 2.9749999999999996 24-25 1.675 26-27 0.8875 28-29 0.6 30-31 0.1 32-33 0.42500000000000004 34-35 1.0125 36-37 2.6875 38-39 3.4375000000000004 40-41 3.6624999999999996 42-43 4.35 44-45 4.987500000000001 46-47 5.0125 48-49 5.35 50-51 6.125 52-53 3.5125 54-55 2.9875 56-57 1.725 58-59 1.4125 60-61 1.6875 62-63 0.6 64-65 1.1875 66-67 2.35 68-69 3.7624999999999997 70-71 4.5625 72-73 5.8125 74-75 6.225 76-77 6.5875 78-79 6.1125 80-81 5.5125 82-83 3.4875000000000003 84-85 18.375 86-87 16.9625 88-89 14.0875 90-91 11.262500000000001 92-93 10.95 94-95 11.225 96-97 10.025 98-99 9.275 100-101 8.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.15289892252437 95.65 2 1.4109799897383273 2.75 3 0.3078501795792714 0.8999999999999999 4 0.0513083632632119 0.2 5 0.0513083632632119 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02565418163160595 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCC 10 0.25 No Hit CCCGTCTTGATTCTGCAGCAAGTCATGCCAGTATTATCCGTAGTGTTCCC 5 0.125 No Hit CTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.0875 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.1375 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 35 3.3300667E-4 51.07857 1 >>END_MODULE Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211486 spots for SRR13844633.sra Written 1211486 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra Read 1211467 spots for SRR13844633.sra Written 1211467 spots for SRR13844633.sra SRR ids: ['SRR13844633.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6t701g3a SRR13844633.sra spots: 24229359 blocks: [[1, 1211467], [1211468, 2422934], [2422935, 3634401], [3634402, 4845868], [4845869, 6057335], [6057336, 7268802], [7268803, 8480269], [8480270, 9691736], [9691737, 10903203], [10903204, 12114670], [12114671, 13326137], [13326138, 14537604], [14537605, 15749071], [15749072, 16960538], [16960539, 18172005], [18172006, 19383472], [19383473, 20594939], [20594940, 21806406], [21806407, 23017873], [23017874, 24229359]] SRR13844633 file size 5846347 SRR13844633 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844633 SRR13844633_1.fastq SRR13844633_2.fastq Input file: SRR13844633_1.fastq Paired file: SRR13844633_2.fastq trimmed: SRR13844633-trimmed-pair1.fastq, SRR13844633-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:39:23 2024 >> started Fri Dec 6 12:39:48 2024 >> done (25.125s) 24229359 read pairs processed; of these: 361214 ( 1.49%) short read pairs filtered out after trimming by size control 250891 ( 1.04%) empty read pairs filtered out after trimming by size control 23617254 (97.47%) read pairs available; of these: 6314184 (26.74%) trimmed read pairs available after processing 17303070 (73.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 30 0.00% 19 98 0.00% 20 234 0.00% 21 373 0.00% 22 448 0.00% 23 557 0.00% 24 624 0.00% 25 732 0.00% 26 831 0.00% 27 929 0.00% 28 1086 0.00% 29 1303 0.01% 30 1409 0.01% 31 1652 0.01% 32 1814 0.01% 33 1957 0.01% 34 2170 0.01% 35 2358 0.01% 36 2516 0.01% 37 2800 0.01% 38 3061 0.01% 39 3176 0.01% 40 3494 0.01% 41 3822 0.02% 42 4150 0.02% 43 4563 0.02% 44 4875 0.02% 45 5284 0.02% 46 5857 0.02% 47 6348 0.03% 48 6765 0.03% 49 7420 0.03% 50 8214 0.03% 51 9567 0.04% 52 10983 0.05% 53 12368 0.05% 54 13514 0.06% 55 15118 0.06% 56 17316 0.07% 57 19569 0.08% 58 23805 0.10% 59 188217 0.80% 60 245704 1.04% 61 258573 1.09% 62 289540 1.23% 63 253632 1.07% 64 174741 0.74% 65 118963 0.50% 66 85581 0.36% 67 68840 0.29% 68 59400 0.25% 69 55503 0.24% 70 53846 0.23% 71 48751 0.21% 72 47116 0.20% 73 45950 0.19% 74 45495 0.19% 75 48020 0.20% 76 46119 0.20% 77 47946 0.20% 78 47414 0.20% 79 47984 0.20% 80 48641 0.21% 81 48947 0.21% 82 52187 0.22% 83 55875 0.24% 84 60769 0.26% 85 64106 0.27% 86 67128 0.28% 87 71045 0.30% 88 77128 0.33% 89 85187 0.36% 90 100468 0.43% 91 134282 0.57% 92 208434 0.88% 93 127309 0.54% 94 129706 0.55% 95 147860 0.63% 96 178700 0.76% 97 233347 0.99% 98 323230 1.37% 99 476262 2.02% 100 1133048 4.80% 101 17303070 73.26% 23617254 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=25 prefix-density=0.91 prefix-fanout=2.0 sequence=TGCTCGTAGGAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=101.34 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.7 sequence=GCGGCGGCGGGTGCTTCTCCTGCGGCGAGTCTGGCCACTTCTCCCGCGAGTGCCCCAACAAGAAGTACTAGGCGCTGATACCACTGTATGAAGATCTCAGATCTGACTGCTGTGCTTCTTCCCGCTCCGTTTCCTGCATCTTGACTATGCTGCAGCAAGT criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=27 prefix-density=0.75 prefix-fanout=2.2 sequence=GTAGTGTTCCCCGTCCTGCTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=86.80 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.1 sequence=GCGGCGGCGGGTGCTTCTCCTGCGGCGAGTCTGGCCACTTCTCCCGCGAGTGCCCCAACAAGAAGTACTAGGCGCTGATACCACTGTATGAAGATCTCAGATCTGACTGCTGTGCTTCTTCCCGCTCCGTTTCCTGCATCTTGACTATGCTGCAGCAAGT SRR13844633 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:40:23 Started mapping on | Dec 06 12:40:24 Finished on | Dec 06 12:42:10 Mapping speed, Million of reads per hour | 802.10 Number of input reads | 23617254 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 22173763 Uniquely mapped reads % | 93.89% Average mapped length | 190.37 Number of splices: Total | 4160320 Number of splices: Annotated (sjdb) | 3774366 Number of splices: GT/AG | 4002299 Number of splices: GC/AG | 53977 Number of splices: AT/AC | 1605 Number of splices: Non-canonical | 102439 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.46% Deletion average length | 1.03 Insertion rate per base | 0.03% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 365479 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 4104 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.44% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2436389 2436389 2436389 N_multimapping 365479 365479 365479 N_noFeature 870539 11414675 11165605 N_ambiguous 527251 32592 32575 UnstrandedReadsAssigned:20775973 PositiveStrandReadsAssigned:10726496 NegativeStrandReadsAssigned:10975583 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844633 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844633-trimmed-pair1.fastq SRR13844633-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,617,254 reads, 21,784,272 reads pseudoaligned [quant] estimated average fragment length: 165.174 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR13844633.ke.tsv 35125 SRR13844633.se.tsv 88098 total ==> SRR13844633.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 771.89 0 0 PNS24247 1044 879.826 0 0 PNS24249 1928 1763.83 0 0 PNS24246 1044 879.826 0 0 PNS24248 1044 879.826 0 0 PNS24244 1471 1306.83 2884 132.889 PNS24243 293 132.399 1 0.454805 KQK14069 1603 1438.83 13.6707 0.572127 KQK14071 474 310.401 0 0 ==> SRR13844633.se.tsv <== BRADI_1g14170v3 28 BRADI_1g53295v3 56 BRADI_1g59795v3 192 BRADI_1g07683v3 1 BRADI_1g00485v3 54 BRADI_1g20270v3 821 BRADI_1g74790v3 21 BRADI_1g09890v3 0 BRADI_1g77505v3 625 BRADI_1g48960v3 3 SRR13844633 completed mapping pipeline successfully