Starting /dee2/code/volunteer_pipeline.sh SRR13844634 current disk space = 1551377154048 free memory = 1337652808 SRR13844634 SRAfilesize 84dabc93dfef9a4ceaee7529635a825b SRR13844634.sra SRR13844634.sra file validated SRR13844634 is paired end SRR13844634 is conventional basespace SRR13844634 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844634_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86625 34.0 31.0 34.0 31.0 34.0 2 32.76275 34.0 31.0 34.0 31.0 34.0 3 32.92 34.0 31.0 34.0 31.0 34.0 4 36.33975 37.0 37.0 37.0 35.0 37.0 5 36.27975 37.0 37.0 37.0 35.0 37.0 6 36.12175 37.0 37.0 37.0 35.0 37.0 7 36.25 37.0 36.0 37.0 35.0 37.0 8 36.1425 37.0 36.0 37.0 35.0 37.0 9 37.89425 39.0 38.0 39.0 35.0 39.0 10-11 37.951499999999996 39.0 38.0 39.0 35.0 39.0 12-13 37.936625 39.0 38.0 39.0 35.0 39.0 14-15 39.518 41.0 39.0 41.0 36.5 41.0 16-17 39.4345 41.0 39.0 41.0 36.5 41.0 18-19 39.23125 41.0 38.5 41.0 36.0 41.0 20-21 39.071125 40.5 39.0 41.0 35.0 41.0 22-23 38.838875 41.0 39.0 41.0 35.0 41.0 24-25 38.63425 41.0 38.5 41.0 34.5 41.0 26-27 38.39725 40.5 38.5 41.0 34.5 41.0 28-29 38.079625 40.0 38.5 41.0 34.0 41.0 30-31 37.7715 40.0 38.0 41.0 33.5 41.0 32-33 37.733875 40.0 38.0 41.0 33.5 41.0 34-35 37.41575 40.0 38.0 41.0 32.5 41.0 36-37 37.261250000000004 40.0 38.0 41.0 32.0 41.0 38-39 37.417375 40.0 38.0 41.0 33.0 41.0 40-41 37.28675 40.0 38.0 41.0 32.5 41.0 42-43 36.998 40.0 37.5 41.0 31.5 41.0 44-45 36.79025 40.0 37.0 41.0 30.5 41.0 46-47 36.953625 40.0 37.0 41.0 31.5 41.0 48-49 36.932625 40.0 37.0 41.0 31.0 41.0 50-51 36.874375 40.0 37.0 41.0 31.0 41.0 52-53 36.652249999999995 40.0 37.0 41.0 30.5 41.0 54-55 36.639624999999995 40.0 36.0 41.0 31.0 41.0 56-57 36.357 39.0 36.0 41.0 31.0 41.0 58-59 36.102875 39.0 35.5 41.0 30.0 41.0 60-61 35.738625 39.0 35.0 40.5 28.5 41.0 62-63 35.75075 39.0 35.0 41.0 29.5 41.0 64-65 36.025999999999996 39.0 35.0 41.0 31.0 41.0 66-67 35.615875 37.5 35.0 40.0 30.5 41.0 68-69 35.1095 37.0 35.0 39.5 29.5 41.0 70-71 34.665125 36.5 34.5 39.0 29.0 41.0 72-73 34.146249999999995 36.0 34.0 39.0 28.5 40.5 74-75 33.8215 35.0 34.0 38.0 27.5 40.0 76-77 32.74325 35.0 32.5 37.0 26.0 39.0 78-79 33.436499999999995 35.0 34.0 37.0 29.0 39.0 80-81 33.06 35.0 34.0 36.0 28.0 38.0 82-83 32.974374999999995 35.0 34.0 36.0 29.0 37.0 84-85 32.929500000000004 35.0 34.0 36.0 29.0 37.0 86-87 32.713499999999996 35.0 34.0 35.0 29.0 36.5 88-89 32.376374999999996 35.0 34.0 35.0 28.5 36.0 90-91 32.236875 35.0 33.5 35.0 27.5 36.0 92-93 32.18475 35.0 34.0 35.0 28.0 36.0 94-95 31.962875 35.0 33.5 35.0 27.0 35.5 96-97 31.813875 35.0 33.0 35.0 26.0 35.0 98-99 31.709 35.0 33.0 35.0 27.0 35.0 100-101 30.279249999999998 34.5 31.0 35.0 21.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 4.0 8 23.0 9 29.0 10 45.0 11 32.0 12 5.0 13 8.0 14 3.0 15 4.0 16 2.0 17 3.0 18 4.0 19 7.0 20 3.0 21 6.0 22 3.0 23 5.0 24 12.0 25 14.0 26 17.0 27 21.0 28 28.0 29 46.0 30 64.0 31 63.0 32 92.0 33 109.0 34 154.0 35 245.0 36 431.0 37 904.0 38 1337.0 39 277.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.127659574468083 15.39424280350438 6.958698372966207 55.51939924906133 2 14.799999999999999 19.825 51.575 13.8 3 21.125 24.025 28.475 26.375 4 23.724999999999998 29.65 25.3 21.325 5 24.2 31.7 28.199999999999996 15.9 6 19.6 35.099999999999994 30.075000000000003 15.225 7 16.175 18.05 48.85 16.925 8 17.549999999999997 22.425 39.074999999999996 20.95 9 17.675 20.175 41.349999999999994 20.8 10-11 21.3 30.837500000000002 29.212500000000002 18.65 12-13 19.8625 25.7 33.862500000000004 20.575 14-15 20.575 26.7625 33.137499999999996 19.525000000000002 16-17 21.15 26.650000000000002 30.55 21.65 18-19 21.7375 26.825 30.2875 21.15 20-21 21.587500000000002 28.3875 29.75 20.275000000000002 22-23 21.375 27.750000000000004 29.95 20.925 24-25 21.9 28.6875 28.95 20.4625 26-27 22.112499999999997 29.362500000000004 27.925 20.599999999999998 28-29 22.05 28.787499999999998 28.3875 20.775 30-31 22.475 28.050000000000004 28.037499999999998 21.4375 32-33 21.637500000000003 28.525 28.487499999999997 21.349999999999998 34-35 22.8125 28.3875 27.800000000000004 21.0 36-37 22.1375 29.025000000000002 27.9375 20.9 38-39 22.15 27.85 28.012500000000003 21.987499999999997 40-41 21.4875 28.812500000000004 27.925 21.775 42-43 21.575 28.6875 28.0875 21.65 44-45 22.0125 28.275 28.050000000000004 21.6625 46-47 21.6625 28.475 28.599999999999998 21.2625 48-49 21.825 28.5625 28.287499999999998 21.325 50-51 21.725 29.3375 27.075 21.8625 52-53 22.3 27.85 28.5625 21.2875 54-55 22.375 27.237499999999997 28.787499999999998 21.6 56-57 22.787499999999998 27.3125 27.900000000000002 22.0 58-59 22.0875 27.975 27.787499999999998 22.15 60-61 22.0625 27.525 27.9125 22.5 62-63 21.5625 28.549999999999997 28.175 21.712500000000002 64-65 22.287499999999998 27.962500000000002 27.9125 21.837500000000002 66-67 21.625 28.0625 28.075 22.237499999999997 68-69 22.325 28.3125 27.487499999999997 21.875 70-71 22.1375 28.212500000000002 28.075 21.575 72-73 21.575 29.1125 27.437499999999996 21.875 74-75 22.287499999999998 28.812500000000004 27.474999999999998 21.425 76-77 21.75 29.1375 26.787499999999998 22.325 78-79 22.537499999999998 28.037499999999998 27.3625 22.0625 80-81 21.3875 29.562500000000004 27.675 21.375 82-83 22.4625 29.425 26.637499999999996 21.475 84-85 21.9375 29.049999999999997 27.900000000000002 21.1125 86-87 21.337500000000002 29.5 27.3125 21.85 88-89 21.325 28.6875 28.1375 21.85 90-91 21.3 28.249999999999996 28.012500000000003 22.4375 92-93 21.987499999999997 28.812500000000004 27.487499999999997 21.712500000000002 94-95 21.5375 29.099999999999998 27.775 21.587500000000002 96-97 21.587500000000002 28.9 27.900000000000002 21.6125 98-99 22.2 28.875 27.6625 21.2625 100-101 22.412499999999998 28.4375 28.3125 20.837500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 1.0 10 1.5 11 0.5 12 2.0 13 3.0 14 3.0 15 4.0 16 5.5 17 6.0 18 5.5 19 6.5 20 7.5 21 6.0 22 5.5 23 7.5 24 7.5 25 9.5 26 11.0 27 12.0 28 13.0 29 17.0 30 21.5 31 27.5 32 39.0 33 51.5 34 73.5 35 102.0 36 131.0 37 156.5 38 203.5 39 222.0 40 221.5 41 240.5 42 237.5 43 237.5 44 238.0 45 222.5 46 188.0 47 154.5 48 155.5 49 144.5 50 115.0 51 92.0 52 76.0 53 80.5 54 70.0 55 55.5 56 53.0 57 40.0 58 25.5 59 21.0 60 22.5 61 19.5 62 14.0 63 14.0 64 13.0 65 12.5 66 12.0 67 12.5 68 10.0 69 6.0 70 8.0 71 7.5 72 4.5 73 3.5 74 3.0 75 1.5 76 1.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.11079908092928 96.075 2 1.6594332397242788 3.25 3 0.2297676793464386 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844634 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844634_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.24825 34.0 31.0 34.0 29.0 34.0 2 32.20775 34.0 31.0 34.0 28.0 34.0 3 32.05825 34.0 31.0 34.0 27.0 34.0 4 35.653 37.0 35.0 37.0 32.0 37.0 5 35.66425 37.0 35.0 37.0 32.0 37.0 6 35.459 37.0 35.0 37.0 32.0 37.0 7 35.5705 37.0 35.0 37.0 32.0 37.0 8 35.52325 37.0 35.0 37.0 32.0 37.0 9 37.3465 39.0 37.0 39.0 32.0 39.0 10-11 36.724875 39.0 37.5 39.0 32.0 39.0 12-13 36.343125 39.0 38.0 39.0 32.0 39.0 14-15 37.576499999999996 41.0 38.5 41.0 32.0 41.0 16-17 37.277375 40.5 38.0 41.0 31.5 41.0 18-19 37.176625 40.5 38.0 41.0 31.0 41.0 20-21 36.715125 41.0 38.0 41.0 30.5 41.0 22-23 36.537125 40.5 38.0 41.0 29.0 41.0 24-25 36.47025 40.0 38.0 41.0 29.5 41.0 26-27 36.09725 40.0 38.0 41.0 27.5 41.0 28-29 35.891 40.0 38.0 41.0 26.0 41.0 30-31 35.852875 40.0 38.0 41.0 26.5 41.0 32-33 35.672625 40.0 37.0 41.0 25.0 41.0 34-35 35.688125 40.0 37.5 41.0 25.0 41.0 36-37 35.361875 40.0 37.0 41.0 19.5 41.0 38-39 35.10575 40.0 37.0 41.0 5.5 41.0 40-41 34.877250000000004 40.0 37.0 41.0 4.5 41.0 42-43 34.645875000000004 40.0 36.5 41.0 2.0 41.0 44-45 34.202375 40.0 35.5 41.0 2.0 41.0 46-47 33.8405 40.0 35.0 41.0 2.0 41.0 48-49 33.840625 40.0 35.0 41.0 2.0 41.0 50-51 32.963625 39.0 34.0 40.0 2.0 40.5 52-53 33.27875 39.0 34.0 40.0 2.0 41.0 54-55 33.875625 39.0 34.0 41.0 2.0 41.0 56-57 33.957 39.0 34.5 41.0 2.0 41.0 58-59 34.21325 39.0 35.0 41.0 2.0 41.0 60-61 34.122875 39.0 35.0 41.0 2.0 41.0 62-63 33.827375 39.0 35.0 41.0 2.0 41.0 64-65 33.54475 38.0 34.5 41.0 2.0 41.0 66-67 33.169875 37.0 34.0 40.0 2.0 41.0 68-69 32.70775 37.0 34.0 39.5 2.0 41.0 70-71 32.198375 36.0 34.0 39.0 2.0 41.0 72-73 31.61125 36.0 33.5 39.0 2.0 41.0 74-75 30.98625 35.0 33.0 37.5 2.0 40.0 76-77 30.44475 35.0 32.5 37.0 2.0 39.0 78-79 29.87375 35.0 31.5 36.5 2.0 39.0 80-81 29.609875000000002 35.0 31.0 36.0 2.0 37.0 82-83 28.915999999999997 35.0 30.0 35.5 2.0 37.0 84-85 24.640625 33.0 2.0 35.0 2.0 36.0 86-87 24.753875 33.0 2.0 35.0 2.0 36.0 88-89 24.892375 33.0 6.5 35.0 2.0 35.5 90-91 25.261875 33.0 14.5 35.0 2.0 35.0 92-93 25.403125 33.0 18.5 35.0 2.0 35.0 94-95 25.356625 33.5 15.0 35.0 2.0 35.0 96-97 24.984125 33.0 4.5 35.0 2.0 35.0 98-99 24.5925 33.0 2.0 35.0 2.0 35.0 100-101 22.62825 31.0 2.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 9.0 4 92.0 5 5.0 6 47.0 7 54.0 8 51.0 9 43.0 10 36.0 11 29.0 12 15.0 13 18.0 14 9.0 15 9.0 16 2.0 17 9.0 18 13.0 19 9.0 20 13.0 21 24.0 22 26.0 23 15.0 24 30.0 25 31.0 26 50.0 27 43.0 28 56.0 29 64.0 30 82.0 31 100.0 32 153.0 33 124.0 34 165.0 35 257.0 36 422.0 37 753.0 38 954.0 39 175.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.65 14.95 6.775 54.625 2 15.430861723446892 17.81062124248497 51.67835671342685 15.080160320641284 3 21.05 21.9 29.075 27.975 4 23.775 28.799999999999997 25.95 21.475 5 24.725 29.049999999999997 29.5 16.725 6 18.725 33.800000000000004 31.924999999999997 15.55 7 14.899999999999999 18.475 49.575 17.05 8 16.400000000000002 20.474999999999998 40.25 22.875 9 16.75 20.05 42.4 20.8 10-11 20.904676718630206 29.874776386404296 30.66700741119346 18.55353948377204 12-13 19.356512714063314 24.72755578619616 35.664244940321744 20.251686559418786 14-15 20.744403956272777 26.847995835502342 33.36803748047892 19.039562727745967 16-17 19.85208252238225 27.40365901128844 32.308291163876994 20.435967302452315 18-19 21.00232498062516 27.034358047016276 31.219323172306897 20.743993800051665 20-21 21.951219512195124 27.703143341593844 29.437850528237902 20.90778661797313 22-23 21.869351923573458 27.562612961528533 29.53782597469662 21.030209140201393 24-25 22.328365813272192 28.454973888676598 27.792637880524772 21.42402241752643 26-27 21.813353566009106 28.81891755184623 28.098128477491148 21.269600404653517 28-29 22.570493454179257 28.52467270896274 27.630916414904334 21.273917421953676 30-31 21.957936905358036 29.06860290435653 26.89033550325488 22.083124687030544 32-33 21.87460736273401 29.16195501947481 27.377811282824478 21.585626334966705 34-35 21.848526994563155 28.5497534454419 28.006069035276266 21.595650524718675 36-37 22.76475135274414 28.51069312032981 26.78433393455295 21.9402215923731 38-39 21.658866354654187 28.211128445137806 28.172126885075404 21.957878315132607 40-41 21.196290975577902 30.024813895781637 26.642288102389973 22.13660702625049 42-43 21.791672139760934 27.689478523578092 27.952187048469725 22.566662288191253 44-45 21.66050686378036 28.946673706441395 27.983104540654697 21.40971488912355 46-47 21.183306920232436 29.27892234548336 27.746962493396726 21.79080824088748 48-49 21.73336867214418 27.802809435462493 28.200371057513912 22.263450834879407 50-51 21.645079449859793 28.8155962077714 27.346775270396584 22.192549071972227 52-53 21.82457053617907 29.22956793336804 27.394586153045292 21.5512753774076 54-55 22.345647119607335 29.475587703435806 26.595195040041332 21.583570136915526 56-57 21.85945670195128 28.325468690218088 28.108659609743654 21.706414998086977 58-59 22.01625190452006 28.94870492635856 26.295073641442357 22.739969527679023 60-61 21.99847055824624 28.804486362477693 27.313280652561815 21.88376242671425 62-63 21.9662638469285 29.45619335347432 26.636455186304133 21.94108761329305 64-65 22.18559837728195 29.069472616632858 26.711460446247465 22.03346855983773 66-67 21.182961252245317 28.752886836027713 27.675134719014626 22.389017192712345 68-69 21.195156880614505 28.993620622314804 27.691706809009244 22.11951568806145 70-71 21.515151515151516 28.642951251646902 28.102766798418973 21.73913043478261 72-73 22.220744680851066 28.843085106382976 27.127659574468083 21.808510638297875 74-75 21.75368139223561 28.63453815261044 27.10843373493976 22.50334672021419 76-77 21.377736001074258 28.642406338122733 27.366724855646567 22.61313280515644 78-79 22.317252438861416 28.678337565147665 28.06361085126286 20.94079914472805 80-81 21.411514990713716 27.56699389758557 27.925179092597507 23.09631201910321 82-83 21.09090909090909 28.2987012987013 27.727272727272727 22.883116883116884 84-85 20.678018100935727 30.342077005675716 26.998005829114895 21.981899064273662 86-87 21.58349764902169 28.879114212043078 26.694979523737295 22.842408615197936 88-89 21.03256086828982 28.982106189498385 26.884716925784684 23.100616016427107 90-91 21.35039090262971 28.926794598436388 27.363184079601986 22.35963041933191 92-93 21.69664353491007 29.429259311712226 27.120804418637583 21.75329273474012 94-95 22.285308729595457 28.445706174591912 27.224982256919798 22.044002838892833 96-97 21.922216004476777 28.931169557918302 27.462227196418574 21.684387241186347 98-99 22.360764754779716 29.23247436963148 26.863397062898308 21.543363812690497 100-101 22.093344380005522 29.107981220657276 27.03673018503176 21.76194421430544 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 3.0 4 5.0 5 7.5 6 10.5 7 10.0 8 6.5 9 7.5 10 9.5 11 8.5 12 9.0 13 13.5 14 18.5 15 17.0 16 12.5 17 14.0 18 12.0 19 10.0 20 13.5 21 14.5 22 16.5 23 18.0 24 15.0 25 17.5 26 26.5 27 25.0 28 28.0 29 33.0 30 35.5 31 46.0 32 65.0 33 72.5 34 84.0 35 108.5 36 125.0 37 153.0 38 179.5 39 189.5 40 209.5 41 230.5 42 216.5 43 197.5 44 186.0 45 182.0 46 181.0 47 144.0 48 125.5 49 129.5 50 107.5 51 88.5 52 86.0 53 76.0 54 61.5 55 56.0 56 38.0 57 28.0 58 29.0 59 24.5 60 22.5 61 19.0 62 16.5 63 14.0 64 13.0 65 13.0 66 11.0 67 7.5 68 6.0 69 7.0 70 7.0 71 7.5 72 5.0 73 3.5 74 4.0 75 2.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 2.175 12-13 3.65 14-15 3.95 16-17 3.6624999999999996 18-19 3.225 20-21 4.1625000000000005 22-23 3.175 24-25 1.8624999999999998 26-27 1.15 28-29 0.7000000000000001 30-31 0.15 32-33 0.5125000000000001 34-35 1.1375 36-37 2.9749999999999996 38-39 3.85 40-41 4.2875000000000005 42-43 4.8375 44-45 5.3 46-47 5.35 48-49 5.675 50-51 6.3875 52-53 3.95 54-55 3.225 56-57 1.9875 58-59 1.55 60-61 1.925 62-63 0.7000000000000001 64-65 1.4000000000000001 66-67 2.5749999999999997 68-69 3.9875000000000003 70-71 5.125 72-73 6.0 74-75 6.625 76-77 6.9125000000000005 78-79 6.4625 80-81 5.775 82-83 3.75 84-85 18.512500000000003 86-87 17.5875 88-89 14.774999999999999 90-91 12.0625 92-93 11.737499999999999 94-95 11.9375 96-97 10.65 98-99 9.775 100-101 9.475 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.175 #Duplication Level Percentage of deduplicated Percentage of total 1 98.52304558186911 96.72500000000001 2 1.145912910618793 2.25 3 0.30557677616501144 0.8999999999999999 4 0.0 0.0 5 0.025464731347084286 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTGTGTGTTAGTCAGGCTGCTCTCATCAGTTAATTCCGGCCGTGCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 45 2.2499626E-7 60.15833 1 TTTTTTT 525 0.0014314629 6.170086 8 >>END_MODULE Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308091 spots for SRR13844634.sra Written 1308091 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra Read 1308084 spots for SRR13844634.sra Written 1308084 spots for SRR13844634.sra SRR ids: ['SRR13844634.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9in4a0ht SRR13844634.sra spots: 26161687 blocks: [[1, 1308084], [1308085, 2616168], [2616169, 3924252], [3924253, 5232336], [5232337, 6540420], [6540421, 7848504], [7848505, 9156588], [9156589, 10464672], [10464673, 11772756], [11772757, 13080840], [13080841, 14388924], [14388925, 15697008], [15697009, 17005092], [17005093, 18313176], [18313177, 19621260], [19621261, 20929344], [20929345, 22237428], [22237429, 23545512], [23545513, 24853596], [24853597, 26161687]] SRR13844634 file size 6314333 SRR13844634 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844634 SRR13844634_1.fastq SRR13844634_2.fastq Input file: SRR13844634_1.fastq Paired file: SRR13844634_2.fastq trimmed: SRR13844634-trimmed-pair1.fastq, SRR13844634-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:39:51 2024 >> started Fri Dec 6 12:40:17 2024 >> done (26.229s) 26161687 read pairs processed; of these: 316191 ( 1.21%) short read pairs filtered out after trimming by size control 239404 ( 0.92%) empty read pairs filtered out after trimming by size control 25606092 (97.88%) read pairs available; of these: 6792727 (26.53%) trimmed read pairs available after processing 18813365 (73.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 30 0.00% 19 99 0.00% 20 244 0.00% 21 371 0.00% 22 451 0.00% 23 604 0.00% 24 664 0.00% 25 766 0.00% 26 807 0.00% 27 953 0.00% 28 1110 0.00% 29 1219 0.00% 30 1453 0.01% 31 1609 0.01% 32 1812 0.01% 33 1897 0.01% 34 2212 0.01% 35 2215 0.01% 36 2447 0.01% 37 2610 0.01% 38 2834 0.01% 39 2957 0.01% 40 3226 0.01% 41 3422 0.01% 42 3790 0.01% 43 4153 0.02% 44 4489 0.02% 45 4809 0.02% 46 5320 0.02% 47 5467 0.02% 48 5988 0.02% 49 6526 0.03% 50 7322 0.03% 51 8418 0.03% 52 9895 0.04% 53 11212 0.04% 54 12354 0.05% 55 13599 0.05% 56 15301 0.06% 57 18044 0.07% 58 21977 0.09% 59 189518 0.74% 60 266533 1.04% 61 300494 1.17% 62 354973 1.39% 63 312183 1.22% 64 213565 0.83% 65 142864 0.56% 66 99026 0.39% 67 76643 0.30% 68 64674 0.25% 69 57712 0.23% 70 53843 0.21% 71 48745 0.19% 72 46809 0.18% 73 45475 0.18% 74 44769 0.17% 75 45292 0.18% 76 39712 0.16% 77 41832 0.16% 78 43370 0.17% 79 44752 0.17% 80 47303 0.18% 81 49436 0.19% 82 53602 0.21% 83 57493 0.22% 84 63351 0.25% 85 67570 0.26% 86 71143 0.28% 87 75476 0.29% 88 82971 0.32% 89 91461 0.36% 90 107482 0.42% 91 140882 0.55% 92 219741 0.86% 93 132153 0.52% 94 137219 0.54% 95 156606 0.61% 96 188884 0.74% 97 246695 0.96% 98 343225 1.34% 99 505992 1.98% 100 1226582 4.79% 101 18813365 73.47% 25606092 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=34 prefix-density=0.47 prefix-fanout=2.1 sequence=TGCTCGTAGGAAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=43.92 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.9 sequence=GAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGTTATTTTTTAGTATGCTGAAACTGCATCAGTAATACCATATGTGATATTCGTACCCTGTTATTCTCAGTTCCAAATACTTTAAGCACCTAATTCT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=38 prefix-density=0.29 prefix-fanout=2.1 sequence=TTCTTCCTACGAGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=37.01 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.5 sequence=TAACAGTACTCCATTAAATTGATACTCATTCCCACAGCACAAGAGCCACTTACACCTAGCATTATTCATGCCTCAAGAACAGCACTACCACTACATAACCAATAAGAACTCAACACGTAGTACGACCGAAGATAGACCAACCTAATTGGAAAACAACAAATTAAACGTCCACACAAGAGTGCAAGCTGCTAAACTGCACAAATAAAAACGTACGCGCGGCGTATAGCGCCCAGGGAACCATCATGCATG SRR13844634 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:41:07 Started mapping on | Dec 06 12:41:07 Finished on | Dec 06 12:42:20 Mapping speed, Million of reads per hour | 1262.77 Number of input reads | 25606092 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 24569892 Uniquely mapped reads % | 95.95% Average mapped length | 190.03 Number of splices: Total | 5586322 Number of splices: Annotated (sjdb) | 5206671 Number of splices: GT/AG | 5436507 Number of splices: GC/AG | 68071 Number of splices: AT/AC | 2913 Number of splices: Non-canonical | 78831 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.46% Deletion average length | 1.02 Insertion rate per base | 0.02% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373941 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 4098 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2319801 2319801 2319801 N_multimapping 373941 373941 373941 N_noFeature 1031539 12564461 12506138 N_ambiguous 581178 26418 25824 UnstrandedReadsAssigned:22957175 PositiveStrandReadsAssigned:11979013 NegativeStrandReadsAssigned:12037930 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844634 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844634-trimmed-pair1.fastq SRR13844634-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,606,092 reads, 23,929,747 reads pseudoaligned [quant] estimated average fragment length: 164.57 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR13844634.ke.tsv 35125 SRR13844634.se.tsv 88098 total ==> SRR13844634.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 772.494 0 0 PNS24247 1044 880.43 0 0 PNS24249 1928 1764.43 46.3308 1.34017 PNS24246 1044 880.43 0 0 PNS24248 1044 880.43 0 0 PNS24244 1471 1307.43 2350.67 91.7632 PNS24243 293 133.262 0 0 KQK14069 1603 1439.43 183.975 6.52324 KQK14071 474 311.124 1.02513 0.168167 ==> SRR13844634.se.tsv <== BRADI_1g14170v3 180 BRADI_1g53295v3 30 BRADI_1g59795v3 188 BRADI_1g07683v3 2 BRADI_1g00485v3 18 BRADI_1g20270v3 2094 BRADI_1g74790v3 2 BRADI_1g09890v3 0 BRADI_1g77505v3 1023 BRADI_1g48960v3 5 SRR13844634 completed mapping pipeline successfully