Starting /dee2/code/volunteer_pipeline.sh SRR13844635 current disk space = 1551402516480 free memory = 1311015500 SRR13844635 SRAfilesize a76ecf4648248e55340484f91a65e3b9 SRR13844635.sra SRR13844635.sra file validated SRR13844635 is paired end SRR13844635 is conventional basespace SRR13844635 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844635_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93525 34.0 31.0 34.0 31.0 34.0 2 33.03925 34.0 33.0 34.0 31.0 34.0 3 33.0875 34.0 33.0 34.0 31.0 34.0 4 36.358 37.0 37.0 37.0 35.0 37.0 5 36.319 37.0 37.0 37.0 35.0 37.0 6 36.369 37.0 37.0 37.0 35.0 37.0 7 36.37375 37.0 37.0 37.0 35.0 37.0 8 36.41875 37.0 37.0 37.0 35.0 37.0 9 38.08825 39.0 39.0 39.0 35.0 39.0 10-11 38.285 39.0 39.0 39.0 37.0 39.0 12-13 38.248000000000005 39.0 39.0 39.0 37.0 39.0 14-15 39.702749999999995 41.0 40.0 41.0 37.0 41.0 16-17 39.64325 41.0 40.0 41.0 37.0 41.0 18-19 39.673375 41.0 40.0 41.0 36.5 41.0 20-21 39.645875000000004 41.0 40.0 41.0 37.0 41.0 22-23 39.395250000000004 41.0 39.5 41.0 36.5 41.0 24-25 39.08025 41.0 40.0 41.0 36.0 41.0 26-27 38.701499999999996 41.0 39.0 41.0 36.0 41.0 28-29 38.466750000000005 41.0 39.0 41.0 35.0 41.0 30-31 38.345 41.0 39.0 41.0 35.0 41.0 32-33 38.311 41.0 39.0 41.0 35.0 41.0 34-35 37.981624999999994 40.5 38.5 41.0 34.0 41.0 36-37 37.905125 40.0 38.5 41.0 34.0 41.0 38-39 37.897499999999994 40.0 38.0 41.0 34.0 41.0 40-41 37.919 40.0 38.0 41.0 34.0 41.0 42-43 37.77125 40.0 38.0 41.0 33.5 41.0 44-45 37.554375 40.0 38.0 41.0 33.5 41.0 46-47 37.695499999999996 40.0 38.0 41.0 33.5 41.0 48-49 37.553 40.0 38.0 41.0 33.0 41.0 50-51 37.555 40.0 38.0 41.0 33.5 41.0 52-53 37.463125 40.0 38.0 41.0 33.5 41.0 54-55 37.169875 40.0 37.0 41.0 32.5 41.0 56-57 37.099875 40.0 37.0 41.0 32.5 41.0 58-59 36.815 40.0 36.5 41.0 31.5 41.0 60-61 36.6945 39.0 36.0 41.0 31.5 41.0 62-63 36.765125 39.0 36.0 41.0 33.5 41.0 64-65 36.66475 39.0 36.0 41.0 33.0 41.0 66-67 36.305625000000006 39.0 35.0 41.0 32.5 41.0 68-69 35.935500000000005 37.5 35.0 40.5 32.0 41.0 70-71 35.542125 37.0 35.0 39.5 32.0 41.0 72-73 34.831375 36.5 35.0 39.0 31.0 41.0 74-75 34.6525 36.0 35.0 39.0 31.0 40.5 76-77 33.728125 35.0 34.0 37.0 29.5 39.0 78-79 33.86275 35.0 34.5 37.0 30.5 39.0 80-81 33.686875 35.0 35.0 36.5 30.5 39.0 82-83 33.46275 35.0 35.0 36.0 30.5 37.0 84-85 33.293875 35.0 35.0 36.0 31.0 37.0 86-87 32.939875 35.0 34.5 35.5 30.0 36.5 88-89 32.789500000000004 35.0 34.0 35.0 29.5 36.0 90-91 32.756375 35.0 34.0 35.0 30.0 36.0 92-93 32.698375 35.0 34.0 35.0 31.0 36.0 94-95 32.58225 35.0 34.0 35.0 31.0 36.0 96-97 32.45575 35.0 34.0 35.0 30.5 35.5 98-99 32.261624999999995 35.0 34.0 35.0 29.5 35.0 100-101 31.063250000000004 34.5 32.0 35.0 24.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 13.0 9 39.0 10 44.0 11 22.0 12 8.0 13 7.0 14 7.0 15 3.0 16 4.0 17 3.0 18 4.0 19 3.0 20 2.0 21 5.0 22 7.0 23 4.0 24 7.0 25 10.0 26 7.0 27 18.0 28 24.0 29 33.0 30 24.0 31 38.0 32 66.0 33 79.0 34 94.0 35 181.0 36 349.0 37 911.0 38 1557.0 39 425.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.28664332166083 13.856928464232116 7.178589294647324 55.67783891945973 2 14.649999999999999 19.05 50.55 15.75 3 21.05 23.325000000000003 27.400000000000002 28.225 4 24.525 30.65 23.474999999999998 21.349999999999998 5 24.825 30.725 29.25 15.2 6 19.325 35.9 29.475 15.299999999999999 7 17.4 18.55 46.949999999999996 17.1 8 17.05 20.95 38.675 23.325000000000003 9 17.7 20.525 41.699999999999996 20.075000000000003 10-11 21.85 30.85 28.787499999999998 18.512500000000003 12-13 20.4875 25.900000000000002 32.9875 20.625 14-15 21.55 26.25 32.85 19.35 16-17 21.275 26.7625 31.4 20.5625 18-19 20.674999999999997 27.5875 30.862499999999997 20.875 20-21 21.762500000000003 27.675 30.049999999999997 20.5125 22-23 21.825 27.5125 29.9625 20.7 24-25 21.3 28.262500000000003 29.15 21.2875 26-27 21.8875 28.525 28.787499999999998 20.8 28-29 22.412499999999998 28.349999999999998 27.500000000000004 21.7375 30-31 21.349999999999998 29.099999999999998 27.8625 21.6875 32-33 21.725 29.6375 27.85 20.7875 34-35 22.4875 29.262500000000003 26.7125 21.5375 36-37 21.85 28.475 28.275 21.4 38-39 21.8625 28.475 28.325 21.337500000000002 40-41 22.237499999999997 28.8875 27.650000000000002 21.224999999999998 42-43 22.2625 29.025000000000002 27.825 20.8875 44-45 22.8 27.825 28.349999999999998 21.025 46-47 22.225 28.499999999999996 27.9375 21.337500000000002 48-49 22.55 28.7 26.9125 21.837500000000002 50-51 21.625 29.0875 27.487499999999997 21.8 52-53 21.675 28.3125 27.800000000000004 22.2125 54-55 22.4625 27.9125 27.5875 22.037499999999998 56-57 21.987499999999997 28.825 27.437499999999996 21.75 58-59 21.637500000000003 28.962500000000002 27.5875 21.8125 60-61 23.2125 29.012500000000003 26.900000000000002 20.875 62-63 22.15 28.825 27.725 21.3 64-65 21.575 29.212500000000002 27.400000000000002 21.8125 66-67 21.6625 27.3375 28.487499999999997 22.5125 68-69 21.337500000000002 29.599999999999998 27.8125 21.25 70-71 21.8125 28.812500000000004 26.8375 22.537499999999998 72-73 23.2375 28.749999999999996 28.0625 19.950000000000003 74-75 21.725 29.262500000000003 27.487499999999997 21.525 76-77 21.4375 29.45 27.325 21.7875 78-79 21.762500000000003 28.95 26.9625 22.325 80-81 21.75 29.325000000000003 26.9125 22.0125 82-83 21.712500000000002 28.749999999999996 27.8625 21.675 84-85 21.4375 28.999999999999996 26.875 22.6875 86-87 21.0375 29.012500000000003 27.8375 22.112499999999997 88-89 21.9625 28.95 27.450000000000003 21.637500000000003 90-91 22.8625 28.749999999999996 27.200000000000003 21.1875 92-93 21.825 29.25 26.937499999999996 21.987499999999997 94-95 21.5 29.575000000000003 27.525 21.4 96-97 21.375 29.725 26.775 22.125 98-99 21.85 28.5875 27.3125 22.25 100-101 22.400000000000002 28.849999999999998 26.900000000000002 21.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.5 8 1.0 9 0.0 10 1.0 11 1.5 12 1.0 13 1.5 14 1.5 15 3.0 16 5.5 17 4.5 18 5.0 19 4.5 20 6.0 21 8.0 22 5.5 23 4.0 24 4.5 25 12.5 26 15.5 27 12.0 28 15.5 29 20.5 30 18.0 31 32.0 32 55.0 33 62.0 34 77.5 35 97.0 36 128.5 37 159.0 38 176.5 39 199.5 40 232.0 41 239.0 42 222.5 43 215.0 44 204.0 45 194.0 46 191.0 47 179.0 48 173.5 49 164.5 50 130.5 51 109.5 52 88.0 53 80.5 54 84.5 55 63.5 56 39.0 57 33.0 58 35.0 59 29.0 60 21.5 61 24.5 62 20.5 63 12.5 64 13.0 65 13.5 66 11.0 67 5.0 68 3.5 69 4.5 70 5.0 71 4.5 72 4.0 73 2.5 74 1.0 75 1.5 76 2.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.13012295081968 95.775 2 1.4600409836065575 2.85 3 0.2817622950819672 0.8250000000000001 4 0.10245901639344263 0.4 5 0.0 0.0 6 0.025614754098360656 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTCTTGATTCTGCAGCAAGTCATGCCAGTATTATCCGTAGTGTTCCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844635 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844635_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.11675 34.0 31.0 34.0 28.0 34.0 2 32.4475 34.0 31.0 34.0 30.0 34.0 3 32.637 34.0 31.0 34.0 30.0 34.0 4 36.017 37.0 37.0 37.0 35.0 37.0 5 35.86175 37.0 37.0 37.0 33.0 37.0 6 35.8755 37.0 37.0 37.0 33.0 37.0 7 35.91225 37.0 37.0 37.0 33.0 37.0 8 35.6355 37.0 37.0 37.0 33.0 37.0 9 37.457 39.0 39.0 39.0 35.0 39.0 10-11 37.170375 39.0 39.0 39.0 35.0 39.0 12-13 36.891125 39.0 39.0 39.0 35.0 39.0 14-15 38.401624999999996 41.0 40.0 41.0 36.0 41.0 16-17 38.1635 41.0 39.5 41.0 33.5 41.0 18-19 37.944874999999996 41.0 39.0 41.0 34.0 41.0 20-21 37.464125 41.0 39.0 41.0 33.0 41.0 22-23 37.063500000000005 41.0 39.0 41.0 32.5 41.0 24-25 36.429874999999996 41.0 38.0 41.0 28.0 41.0 26-27 36.527625 41.0 38.5 41.0 28.5 41.0 28-29 36.457 41.0 39.0 41.0 28.5 41.0 30-31 36.286500000000004 41.0 38.0 41.0 27.5 41.0 32-33 36.1095 41.0 38.0 41.0 25.5 41.0 34-35 36.019875 41.0 38.0 41.0 24.5 41.0 36-37 35.82425 40.0 38.0 41.0 23.5 41.0 38-39 35.632000000000005 40.0 38.0 41.0 19.5 41.0 40-41 35.265125 40.0 38.0 41.0 4.5 41.0 42-43 35.112875 40.0 37.0 41.0 2.0 41.0 44-45 34.771875 40.0 36.0 41.0 5.5 41.0 46-47 34.725875 40.0 36.5 41.0 2.0 41.0 48-49 34.8895 40.0 37.0 41.0 2.0 41.0 50-51 34.449125 39.5 36.0 40.5 5.5 41.0 52-53 34.43575 39.5 36.0 40.5 2.0 41.0 54-55 34.9435 40.0 36.0 41.0 2.0 41.0 56-57 34.762 40.0 36.0 41.0 2.0 41.0 58-59 34.800250000000005 40.0 36.0 41.0 2.0 41.0 60-61 34.646875 39.5 35.0 41.0 2.0 41.0 62-63 34.48325 39.0 35.0 41.0 2.0 41.0 64-65 34.298125 39.0 35.0 41.0 2.0 41.0 66-67 33.7345 37.5 35.0 41.0 2.0 41.0 68-69 33.401125 37.0 35.0 40.0 2.0 41.0 70-71 32.691500000000005 36.5 35.0 39.0 2.0 41.0 72-73 32.217875 36.0 34.0 39.0 2.0 41.0 74-75 31.861125 35.5 34.0 38.5 2.0 40.5 76-77 31.37425 35.0 34.0 37.0 2.0 39.0 78-79 31.133875000000003 35.0 34.0 37.0 2.0 39.0 80-81 30.694125 35.0 33.5 36.0 2.0 38.0 82-83 30.212 35.0 32.5 35.5 2.0 37.0 84-85 26.7115 34.0 25.0 35.0 2.0 36.0 86-87 26.667125 34.0 23.5 35.0 2.0 36.0 88-89 26.779 34.0 24.0 35.0 2.0 36.0 90-91 27.107 34.0 26.0 35.0 2.0 35.5 92-93 27.3545 34.0 27.5 35.0 2.0 35.0 94-95 27.314125 34.0 28.0 35.0 2.0 35.0 96-97 27.082250000000002 34.0 27.0 35.0 2.0 35.0 98-99 26.986375 34.0 27.0 35.0 2.0 35.0 100-101 25.320500000000003 32.5 22.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 48.0 4 52.0 5 4.0 6 47.0 7 50.0 8 32.0 9 37.0 10 50.0 11 25.0 12 17.0 13 10.0 14 6.0 15 9.0 16 8.0 17 4.0 18 7.0 19 9.0 20 10.0 21 13.0 22 10.0 23 10.0 24 18.0 25 16.0 26 37.0 27 30.0 28 40.0 29 46.0 30 47.0 31 71.0 32 122.0 33 99.0 34 132.0 35 219.0 36 348.0 37 813.0 38 1197.0 39 292.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.599198396793586 14.303607214428856 6.212424849699398 54.88476953907816 2 14.63963963963964 18.56856856856857 51.57657657657657 15.215215215215217 3 20.690517888416313 22.992244183137352 30.122591943957964 26.194645984488368 4 23.39254440830623 28.921691268451337 27.24543407555667 20.440330247685765 5 24.617698671346204 30.634244171471547 30.107796440210578 14.640260716971673 6 19.725 33.35 31.474999999999998 15.45 7 16.14114114114114 18.543543543543546 48.47347347347347 16.84184184184184 8 16.45153125790939 21.9944317894204 40.673247279169836 20.88078967350038 9 17.7407126611069 19.3580995703816 43.71998989133182 19.18119787717968 10-11 21.601227778488298 30.208466555825552 30.144519759560044 18.045785906126103 12-13 20.03345342254246 25.090066906845088 35.10036026762738 19.776119402985074 14-15 20.459532722344136 26.100425971343743 34.310055505356914 19.12998580095521 16-17 21.436848203939746 25.40234324707094 33.320458349427064 19.840350199562252 18-19 21.92678227360308 27.090558766859345 31.136801541425818 19.845857418111752 20-21 20.974794238683128 27.944958847736622 30.555555555555557 20.52469135802469 22-23 21.48930687967019 28.085544962638497 29.708837928368975 20.71631022932234 24-25 21.020092735703248 28.32302936630603 28.670788253477593 21.986089644513136 26-27 21.976759034606054 29.217213638104965 28.31056059251692 20.495466734772062 28-29 21.761262407737338 29.85492491728175 27.33519979638585 21.048612878595062 30-31 21.672376601954067 29.869305925643953 26.988960791777693 21.469356680624287 32-33 21.362189688096752 28.83513685550605 27.307447485677912 22.495225970719286 34-35 21.629498226051698 29.76431829700963 26.723264064875824 21.882919412062847 36-37 21.0619918699187 29.6875 26.969004065040654 22.28150406504065 38-39 21.83804627249357 29.035989717223647 27.519280205655527 21.60668380462725 40-41 21.74928627043862 29.133143005450297 27.92629120166104 21.19127952245004 42-43 22.39678005712802 28.693845754349518 27.460399896130877 21.448974292391586 44-45 21.831530139103556 28.32302936630603 28.567748583204533 21.277691911385883 46-47 22.200596859997404 28.389775528740106 27.50746074996756 21.902166861294926 48-49 21.729490022172946 28.890048258771355 27.79444371983827 21.586017999217425 50-51 22.270686337395766 28.64656831302117 27.209749839640796 21.87299550994227 52-53 21.736334405144696 29.363344051446944 27.84565916398714 21.05466237942122 54-55 22.043495045682665 29.211169733625013 27.11362758975679 21.63170763093553 56-57 21.358723623262996 28.21667524446732 28.28100874935667 22.14359238291302 58-59 22.167868177136974 28.41143151390319 27.2399588053553 22.18074150360453 60-61 21.788349020605445 29.369117272958533 26.316458916306285 22.526074790129737 62-63 22.136521403779405 29.348245275742386 26.481552898830184 22.03368042164803 64-65 22.021660649819495 28.893759669932955 27.282104177411036 21.80247550283651 66-67 21.897715472481828 30.334890965732086 25.726895119418487 22.0404984423676 68-69 21.675703588949137 29.65401497547121 27.446423960753936 21.223857474825717 70-71 21.785154208050184 29.312598013591217 26.907997909043385 21.99424986931521 72-73 20.506428758855943 30.608764103909735 27.11886643925479 21.765940697979534 74-75 22.479599894709136 29.178731245064494 26.375361937351933 21.96630692287444 76-77 21.707060063224446 29.596944151738676 27.884615384615387 20.8113804004215 78-79 21.925555701696698 28.857030119689597 27.410232802840984 21.80718137577272 80-81 21.75379426644182 27.47438059411078 27.70787391360747 23.063951225839926 82-83 22.50894225855902 28.947368421052634 27.06949412365866 21.47419519672969 84-85 21.30333138515488 29.544126241963763 27.016364699006427 22.136177673874926 86-87 22.31167337550316 29.082806210465783 26.150086256469233 22.455434157561818 88-89 21.701168849457822 28.89733840304182 27.46092099704267 21.940571750457682 90-91 22.55513940907199 29.40768483839645 26.841448189762794 21.195727562768763 92-93 22.501028383381325 29.233511586452764 27.149321266968325 21.116138763197586 94-95 22.069059642418452 29.43906100723352 26.94144943360175 21.550429916746282 96-97 22.365765038352848 28.784820347194184 26.99502085856547 21.8543937558875 98-99 22.455856584445343 29.033562474727052 27.321741474592265 21.188839466235343 100-101 23.476389075743306 28.736714650881208 26.382348984259384 21.404547289116106 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 4.0 2 9.5 3 11.0 4 11.5 5 13.5 6 10.5 7 8.5 8 8.0 9 6.0 10 8.5 11 10.5 12 8.5 13 9.5 14 7.0 15 6.0 16 6.5 17 5.0 18 7.5 19 9.0 20 8.0 21 10.5 22 14.0 23 15.0 24 19.0 25 20.0 26 24.0 27 26.0 28 23.0 29 26.5 30 34.5 31 41.5 32 54.5 33 68.5 34 89.5 35 117.0 36 121.0 37 137.5 38 167.5 39 180.5 40 203.0 41 225.5 42 214.5 43 199.5 44 189.5 45 182.5 46 177.5 47 168.0 48 153.5 49 136.5 50 123.0 51 107.5 52 90.0 53 76.0 54 72.5 55 58.0 56 39.5 57 34.0 58 32.5 59 29.5 60 23.0 61 17.5 62 16.0 63 13.0 64 11.5 65 10.0 66 7.5 67 6.5 68 4.5 69 2.5 70 3.5 71 5.0 72 3.0 73 1.5 74 1.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.2 2 0.1 3 0.075 4 0.075 5 0.27499999999999997 6 0.0 7 0.1 8 1.225 9 1.075 10-11 2.2624999999999997 12-13 2.85 14-15 3.1625 16-17 2.9125 18-19 2.6875 20-21 2.8000000000000003 22-23 2.9749999999999996 24-25 2.9499999999999997 26-27 2.1125000000000003 28-29 1.775 30-31 1.4874999999999998 32-33 1.8124999999999998 34-35 1.35 36-37 1.6 38-39 2.75 40-41 3.675 42-43 3.7249999999999996 44-45 2.9499999999999997 46-47 3.6624999999999996 48-49 4.1625000000000005 50-51 2.5625 52-53 2.8125 54-55 2.8625000000000003 56-57 2.85 58-59 2.9000000000000004 60-61 1.725 62-63 2.7625 64-65 3.05 66-67 3.6999999999999997 68-69 3.175 70-71 4.35 72-73 4.725 74-75 5.025 76-77 5.1 78-79 4.9625 80-81 3.6374999999999997 82-83 2.15 84-85 14.45 86-87 13.05 88-89 11.2375 90-91 9.887500000000001 92-93 8.8375 94-95 8.412500000000001 96-97 7.112499999999999 98-99 7.262499999999999 100-101 7.0874999999999995 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36984207845136 96.55 2 1.4263881813550687 2.8000000000000003 3 0.1782985226693836 0.525 4 0.0 0.0 5 0.025471217524197655 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTCTTGATTCTGCAGCAAGTCATGCCAGTCTTATCTGTAGTGTTCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0125 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 55 1.2601959E-8 57.376133 1 TTTTTTT 565 0.0029730739 6.631881 5 >>END_MODULE Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985572 spots for SRR13844635.sra Written 985572 spots for SRR13844635.sra Read 985579 spots for SRR13844635.sra Written 985579 spots for SRR13844635.sra SRR ids: ['SRR13844635.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rcge9ziu SRR13844635.sra spots: 19711447 blocks: [[1, 985572], [985573, 1971144], [1971145, 2956716], [2956717, 3942288], [3942289, 4927860], [4927861, 5913432], [5913433, 6899004], [6899005, 7884576], [7884577, 8870148], [8870149, 9855720], [9855721, 10841292], [10841293, 11826864], [11826865, 12812436], [12812437, 13798008], [13798009, 14783580], [14783581, 15769152], [15769153, 16754724], [16754725, 17740296], [17740297, 18725868], [18725869, 19711447]] SRR13844635 file size 4752165 SRR13844635 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844635 SRR13844635_1.fastq SRR13844635_2.fastq Input file: SRR13844635_1.fastq Paired file: SRR13844635_2.fastq trimmed: SRR13844635-trimmed-pair1.fastq, SRR13844635-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:40:53 2024 >> started Fri Dec 6 12:41:11 2024 >> done (18.288s) 19711447 read pairs processed; of these: 241257 ( 1.22%) short read pairs filtered out after trimming by size control 115148 ( 0.58%) empty read pairs filtered out after trimming by size control 19355042 (98.19%) read pairs available; of these: 4337930 (22.41%) trimmed read pairs available after processing 15017112 (77.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 57 0.00% 20 122 0.00% 21 146 0.00% 22 216 0.00% 23 283 0.00% 24 305 0.00% 25 338 0.00% 26 394 0.00% 27 478 0.00% 28 542 0.00% 29 652 0.00% 30 796 0.00% 31 888 0.00% 32 1057 0.01% 33 1329 0.01% 34 1470 0.01% 35 1701 0.01% 36 2066 0.01% 37 2296 0.01% 38 2695 0.01% 39 3043 0.02% 40 3505 0.02% 41 4014 0.02% 42 4417 0.02% 43 4960 0.03% 44 5512 0.03% 45 6031 0.03% 46 6742 0.03% 47 7209 0.04% 48 8034 0.04% 49 8662 0.04% 50 9577 0.05% 51 10952 0.06% 52 12339 0.06% 53 13708 0.07% 54 14713 0.08% 55 16274 0.08% 56 18076 0.09% 57 19795 0.10% 58 22702 0.12% 59 179953 0.93% 60 227378 1.17% 61 226675 1.17% 62 242739 1.25% 63 198875 1.03% 64 135488 0.70% 65 91770 0.47% 66 64958 0.34% 67 49121 0.25% 68 40377 0.21% 69 36802 0.19% 70 32977 0.17% 71 29735 0.15% 72 28309 0.15% 73 27724 0.14% 74 26877 0.14% 75 27917 0.14% 76 26476 0.14% 77 27361 0.14% 78 27269 0.14% 79 27272 0.14% 80 28355 0.15% 81 29534 0.15% 82 32061 0.17% 83 35149 0.18% 84 37627 0.19% 85 39172 0.20% 86 40270 0.21% 87 41952 0.22% 88 46216 0.24% 89 50283 0.26% 90 57768 0.30% 91 72741 0.38% 92 108764 0.56% 93 73031 0.38% 94 75229 0.39% 95 85781 0.44% 96 104259 0.54% 97 136508 0.71% 98 187888 0.97% 99 285765 1.48% 100 775406 4.01% 101 15017112 77.59% 19355042 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=23 prefix-density=0.41 prefix-fanout=2.2 sequence=TGCTCGTAGGAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=36.99 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.4 sequence=CGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACCTGTCGTGTGTTCCTGTTCTGT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=25 prefix-density=0.43 prefix-fanout=2.4 sequence=GTAGTGTTCCCCGTCCTGCTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=29.36 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.6 sequence=CGGCGGCGGCAACTGGAGGGAGTGAATGGTGGGGCCCCTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAGGGTTACCATTAGGTGTTTGTCCGTGATGCTACC SRR13844635 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:41:52 Started mapping on | Dec 06 12:41:52 Finished on | Dec 06 12:42:45 Mapping speed, Million of reads per hour | 1314.68 Number of input reads | 19355042 Average input read length | 192 UNIQUE READS: Uniquely mapped reads number | 18453235 Uniquely mapped reads % | 95.34% Average mapped length | 191.39 Number of splices: Total | 5083303 Number of splices: Annotated (sjdb) | 4730714 Number of splices: GT/AG | 4915499 Number of splices: GC/AG | 64744 Number of splices: AT/AC | 2443 Number of splices: Non-canonical | 100617 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.47% Deletion average length | 1.02 Insertion rate per base | 0.02% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356201 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 4489 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.69% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1694538 1694538 1694538 N_multimapping 356201 356201 356201 N_noFeature 697186 9396963 9369387 N_ambiguous 436008 27157 26148 UnstrandedReadsAssigned:17320041 PositiveStrandReadsAssigned:9029115 NegativeStrandReadsAssigned:9057700 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844635 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844635-trimmed-pair1.fastq SRR13844635-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,355,042 reads, 18,261,103 reads pseudoaligned [quant] estimated average fragment length: 167.62 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,146 rounds 52973 SRR13844635.ke.tsv 35125 SRR13844635.se.tsv 88098 total ==> SRR13844635.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.38 0 0 PNS24247 1044 877.38 0.846845 0.0670292 PNS24249 1928 1761.38 15.3299 0.604411 PNS24246 1044 877.38 0.846845 0.0670292 PNS24248 1044 877.38 0.846845 0.0670292 PNS24244 1471 1304.38 1508.13 80.2938 PNS24243 293 130.486 2 1.06442 KQK14069 1603 1436.38 126.355 6.10903 KQK14071 474 307.969 0 0 ==> SRR13844635.se.tsv <== BRADI_1g14170v3 123 BRADI_1g53295v3 11 BRADI_1g59795v3 159 BRADI_1g07683v3 1 BRADI_1g00485v3 9 BRADI_1g20270v3 1552 BRADI_1g74790v3 1 BRADI_1g09890v3 0 BRADI_1g77505v3 603 BRADI_1g48960v3 0 SRR13844635 completed mapping pipeline successfully