Starting /dee2/code/volunteer_pipeline.sh SRR13844636 current disk space = 1551376842752 free memory = 1604064256 SRR13844636 SRAfilesize 0c04822950283ab59d3e61d8fc00ded7 SRR13844636.sra SRR13844636.sra file validated SRR13844636 is paired end SRR13844636 is conventional basespace SRR13844636 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844636_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98625 34.0 33.0 34.0 31.0 34.0 2 33.1375 34.0 33.0 34.0 31.0 34.0 3 33.11075 34.0 33.0 34.0 31.0 34.0 4 36.38875 37.0 37.0 37.0 35.0 37.0 5 36.364 37.0 37.0 37.0 35.0 37.0 6 36.369 37.0 37.0 37.0 35.0 37.0 7 36.379 37.0 37.0 37.0 35.0 37.0 8 36.408 37.0 37.0 37.0 35.0 37.0 9 38.06525 39.0 38.0 39.0 35.0 39.0 10-11 38.286875 39.0 39.0 39.0 37.0 39.0 12-13 38.306 39.0 39.0 39.0 37.0 39.0 14-15 39.675749999999994 41.0 40.0 41.0 37.0 41.0 16-17 39.676 41.0 40.0 41.0 37.0 41.0 18-19 39.758624999999995 41.0 40.0 41.0 37.5 41.0 20-21 39.719375 41.0 40.0 41.0 37.5 41.0 22-23 39.548874999999995 41.0 40.0 41.0 37.0 41.0 24-25 39.455 41.0 40.0 41.0 37.0 41.0 26-27 39.230125 41.0 40.0 41.0 37.0 41.0 28-29 39.097375 41.0 40.0 41.0 36.5 41.0 30-31 38.899375000000006 41.0 39.5 41.0 36.0 41.0 32-33 38.858625 41.0 39.0 41.0 36.0 41.0 34-35 38.542125 40.5 39.0 41.0 35.5 41.0 36-37 38.497125 40.0 38.5 41.0 35.0 41.0 38-39 38.475875 40.0 38.5 41.0 35.0 41.0 40-41 38.50175 40.0 39.0 41.0 35.0 41.0 42-43 38.32725 40.0 38.5 41.0 34.5 41.0 44-45 38.136625 40.0 38.0 41.0 34.5 41.0 46-47 38.2965 40.0 38.0 41.0 35.0 41.0 48-49 38.18175 40.0 38.0 41.0 34.5 41.0 50-51 38.09 40.0 38.0 41.0 34.5 41.0 52-53 38.116125 40.0 38.0 41.0 34.0 41.0 54-55 37.887125 40.0 38.0 41.0 34.0 41.0 56-57 37.773250000000004 40.0 37.0 41.0 34.0 41.0 58-59 37.424875 40.0 37.0 41.0 33.0 41.0 60-61 37.363875 40.0 37.0 41.0 33.0 41.0 62-63 37.318375 39.0 36.0 41.0 33.5 41.0 64-65 37.157 39.0 36.0 41.0 33.5 41.0 66-67 36.869125 39.0 35.5 41.0 34.0 41.0 68-69 36.524 38.0 35.0 40.5 33.0 41.0 70-71 36.109750000000005 37.0 35.0 39.5 33.0 41.0 72-73 35.522999999999996 36.5 35.0 39.0 32.0 41.0 74-75 35.332 36.0 35.0 39.0 32.0 40.5 76-77 34.373000000000005 35.0 34.0 37.0 30.5 39.0 78-79 34.49325 35.0 35.0 37.0 31.5 39.0 80-81 34.257125 35.0 35.0 37.0 32.0 39.0 82-83 34.088375 35.0 35.0 36.0 32.0 37.0 84-85 33.857124999999996 35.0 35.0 36.0 32.0 37.0 86-87 33.532 35.0 35.0 35.5 31.5 36.5 88-89 33.391999999999996 35.0 34.5 35.0 31.0 36.0 90-91 33.310874999999996 35.0 35.0 35.0 31.0 36.0 92-93 33.228875 35.0 34.5 35.0 31.0 36.0 94-95 33.153125 35.0 34.5 35.0 31.0 36.0 96-97 33.011125 35.0 34.0 35.0 31.0 35.0 98-99 32.875875 35.0 34.0 35.0 31.0 35.0 100-101 31.800375 34.5 32.5 35.0 27.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 11.0 9 21.0 10 18.0 11 13.0 12 12.0 13 3.0 14 1.0 15 2.0 16 2.0 17 6.0 18 0.0 19 1.0 20 2.0 21 3.0 22 5.0 23 6.0 24 5.0 25 8.0 26 10.0 27 14.0 28 23.0 29 25.0 30 34.0 31 47.0 32 57.0 33 74.0 34 102.0 35 196.0 36 348.0 37 903.0 38 1628.0 39 418.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.585792896448226 14.382191095547775 6.55327663831916 57.47873936968484 2 15.2 19.85 49.225 15.725 3 21.0 23.849999999999998 26.450000000000003 28.7 4 25.275 29.15 23.849999999999998 21.725 5 26.375 31.075000000000003 27.3 15.25 6 20.575 35.449999999999996 28.125 15.85 7 17.299999999999997 19.55 45.775 17.375 8 17.1 22.925 37.75 22.225 9 19.525000000000002 20.150000000000002 40.525 19.8 10-11 22.400000000000002 30.012499999999996 27.825 19.7625 12-13 20.2875 26.087500000000002 32.8625 20.7625 14-15 21.912499999999998 26.924999999999997 31.087500000000002 20.075000000000003 16-17 22.8625 27.212500000000002 28.775000000000002 21.15 18-19 21.6 28.849999999999998 29.25 20.3 20-21 22.2 27.700000000000003 29.4 20.7 22-23 21.6875 28.799999999999997 28.175 21.337500000000002 24-25 22.2625 27.8625 28.225 21.65 26-27 21.6875 28.199999999999996 29.2875 20.825 28-29 22.5875 28.875 26.325 22.2125 30-31 22.675 29.125 26.75 21.45 32-33 21.975 28.0875 27.9375 22.0 34-35 22.537499999999998 28.8375 27.187499999999996 21.4375 36-37 22.162499999999998 28.675 27.0625 22.1 38-39 22.412499999999998 28.0875 27.975 21.525 40-41 22.225 28.299999999999997 27.6875 21.7875 42-43 22.1875 28.975 26.775 22.0625 44-45 22.162499999999998 27.525 27.650000000000002 22.662499999999998 46-47 21.975 28.449999999999996 27.474999999999998 22.1 48-49 21.7875 28.4375 27.6875 22.0875 50-51 21.925 28.299999999999997 27.750000000000004 22.025 52-53 21.85 28.975 26.900000000000002 22.275 54-55 21.925 29.4375 26.575 22.0625 56-57 22.5 27.6 28.000000000000004 21.9 58-59 21.95 28.287499999999998 26.987499999999997 22.775000000000002 60-61 22.8 28.475 26.687499999999996 22.037499999999998 62-63 21.912499999999998 28.925 27.3375 21.825 64-65 22.4875 28.475 27.037499999999998 22.0 66-67 22.2125 28.499999999999996 27.187499999999996 22.1 68-69 22.5 28.65 27.6 21.25 70-71 22.0125 28.6875 26.737499999999997 22.5625 72-73 21.4125 28.075 27.8375 22.675 74-75 22.375 29.1625 27.0 21.462500000000002 76-77 21.512500000000003 29.599999999999998 27.1375 21.75 78-79 21.5625 28.8375 26.950000000000003 22.650000000000002 80-81 22.7125 28.462500000000002 26.775 22.05 82-83 22.6 28.199999999999996 27.0625 22.1375 84-85 21.875 27.6125 27.8875 22.625 86-87 21.9625 28.749999999999996 27.6625 21.625 88-89 22.412499999999998 28.65 26.2875 22.650000000000002 90-91 22.912499999999998 28.875 25.837500000000002 22.375 92-93 22.8875 28.037499999999998 27.85 21.224999999999998 94-95 21.15 29.612500000000004 27.525 21.712500000000002 96-97 22.237499999999997 28.4 26.625 22.7375 98-99 21.95 28.175 27.0875 22.787499999999998 100-101 21.627703462932867 29.65370671333917 27.603450431303912 21.115139392424055 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 1.0 16 2.5 17 4.5 18 5.5 19 4.0 20 2.0 21 3.5 22 5.0 23 4.0 24 5.5 25 6.0 26 5.0 27 6.0 28 11.0 29 12.5 30 16.0 31 31.0 32 42.5 33 52.5 34 63.5 35 85.0 36 119.5 37 150.5 38 178.5 39 180.0 40 199.5 41 216.0 42 230.0 43 257.5 44 248.0 45 232.5 46 207.5 47 190.5 48 175.5 49 149.5 50 134.5 51 117.0 52 100.0 53 89.5 54 81.5 55 70.5 56 49.5 57 39.5 58 37.5 59 28.0 60 18.0 61 19.5 62 15.0 63 11.0 64 14.0 65 10.5 66 10.5 67 10.0 68 6.0 69 4.0 70 5.0 71 4.0 72 3.0 73 4.5 74 4.0 75 1.5 76 1.5 77 1.5 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.36609650242532 96.325 2 1.3020168496298188 2.55 3 0.2297676793464386 0.675 4 0.051059484299208584 0.2 5 0.051059484299208584 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCC 5 0.125 No Hit CTTTTTTCATTCATTCATAGGGATAGCGAACGGAACAGAACAGGAACACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.6625000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844636 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844636_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.12125 34.0 31.0 34.0 28.0 34.0 2 32.38675 34.0 31.0 34.0 29.0 34.0 3 32.557 34.0 31.0 34.0 30.0 34.0 4 35.932 37.0 37.0 37.0 33.0 37.0 5 35.725 37.0 37.0 37.0 32.0 37.0 6 35.76325 37.0 37.0 37.0 32.0 37.0 7 35.8175 37.0 36.0 37.0 32.0 37.0 8 35.38 37.0 36.0 37.0 32.0 37.0 9 37.2515 39.0 39.0 39.0 34.0 39.0 10-11 36.722 39.0 39.0 39.0 33.5 39.0 12-13 36.3005 39.0 39.0 39.0 33.0 39.0 14-15 37.74575 41.0 40.0 41.0 34.0 41.0 16-17 37.578375 41.0 39.0 41.0 33.0 41.0 18-19 37.50825 41.0 39.0 41.0 32.0 41.0 20-21 37.213375 41.0 39.0 41.0 32.0 41.0 22-23 36.777625 41.0 39.0 41.0 30.5 41.0 24-25 36.20425 41.0 38.0 41.0 25.5 41.0 26-27 36.575 41.0 38.5 41.0 28.5 41.0 28-29 36.640375 41.0 39.0 41.0 30.0 41.0 30-31 36.4825 41.0 38.5 41.0 30.0 41.0 32-33 36.30675 41.0 38.0 41.0 28.5 41.0 34-35 36.238875 40.0 38.0 41.0 28.5 41.0 36-37 36.01875 40.0 38.0 41.0 26.5 41.0 38-39 35.755125 40.0 38.0 41.0 23.5 41.0 40-41 35.2505 40.0 38.0 41.0 2.0 41.0 42-43 35.157375 40.0 37.5 41.0 2.0 41.0 44-45 34.682249999999996 40.0 36.5 41.0 5.5 41.0 46-47 34.699124999999995 40.0 36.5 41.0 2.0 41.0 48-49 34.939375 40.0 37.0 41.0 2.0 41.0 50-51 34.598625 39.5 36.0 40.5 12.0 41.0 52-53 34.601 39.5 36.0 40.5 8.5 41.0 54-55 35.098124999999996 40.0 36.0 41.0 11.0 41.0 56-57 34.924875 40.0 36.0 41.0 7.5 41.0 58-59 34.944374999999994 40.0 36.0 41.0 8.0 41.0 60-61 34.76475 39.5 35.5 41.0 5.0 41.0 62-63 34.57025 39.0 35.0 41.0 2.0 41.0 64-65 34.375375000000005 39.0 35.0 41.0 2.0 41.0 66-67 33.9015 38.0 35.0 41.0 2.0 41.0 68-69 33.549875 37.0 35.0 40.5 2.0 41.0 70-71 32.916 37.0 35.0 39.0 2.0 41.0 72-73 32.432375 36.0 34.0 39.0 2.0 41.0 74-75 32.017125 35.5 34.0 38.5 2.0 40.5 76-77 31.45275 35.0 34.0 37.0 2.0 39.0 78-79 31.25975 35.0 34.0 37.0 2.0 39.0 80-81 30.773 35.0 33.5 36.0 2.0 38.0 82-83 30.345750000000002 35.0 33.0 36.0 2.0 37.0 84-85 25.65925 34.0 2.0 35.0 2.0 36.0 86-87 25.768124999999998 34.0 10.5 35.0 2.0 36.0 88-89 25.996625 34.0 15.0 35.0 2.0 36.0 90-91 26.36225 34.0 22.5 35.0 2.0 35.5 92-93 26.84075 34.0 25.0 35.0 2.0 35.0 94-95 27.019 34.0 27.0 35.0 2.0 35.0 96-97 26.877875000000003 34.0 27.0 35.0 2.0 35.0 98-99 26.871375 34.0 27.0 35.0 2.0 35.0 100-101 25.40175 32.5 21.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 58.0 4 88.0 5 4.0 6 30.0 7 53.0 8 38.0 9 30.0 10 22.0 11 23.0 12 11.0 13 5.0 14 9.0 15 6.0 16 4.0 17 8.0 18 9.0 19 4.0 20 7.0 21 14.0 22 17.0 23 13.0 24 19.0 25 17.0 26 26.0 27 31.0 28 28.0 29 53.0 30 47.0 31 97.0 32 121.0 33 114.0 34 148.0 35 262.0 36 389.0 37 760.0 38 1127.0 39 291.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.45614035087719 13.909774436090224 7.042606516290727 56.59147869674186 2 15.294117647058824 19.173967459324157 49.5369211514393 15.994993742177721 3 21.846846846846844 23.773773773773772 26.401401401401404 27.97797797797798 4 24.843632724543408 29.321991493620214 23.767825869402053 22.066549912434326 5 24.805423047953802 31.05699221692192 28.596535274918406 15.541049460205874 6 21.15 33.324999999999996 29.475 16.05 7 17.792792792792792 18.743743743743742 46.5965965965966 16.866866866866868 8 17.352642276422763 22.789634146341463 38.56707317073171 21.290650406504067 9 18.124207858048162 20.20278833967047 40.557667934093786 21.11533586818758 10-11 21.69127169127169 30.536130536130536 29.64257964257964 18.13001813001813 12-13 20.666142145292422 25.596643063204827 33.32022029897718 20.41699449252557 14-15 20.63638764193293 26.20808027462371 33.08687615526802 20.068655928175335 16-17 22.04724409448819 27.060367454068242 30.22309711286089 20.669291338582678 18-19 21.311047270827892 27.37007051449465 29.877252546356754 21.44162966832071 20-21 21.704411572195315 27.804686477287603 29.637387092551382 20.853514857965703 22-23 22.52169339994741 28.51696029450434 27.83328950828293 21.128056797265316 24-25 21.791672139760934 27.899645343491397 27.20346775252857 23.1052147642191 26-27 22.76485788113695 28.42377260981912 27.44186046511628 21.36950904392765 28-29 21.64736164736165 28.62290862290862 27.54182754182754 22.18790218790219 30-31 22.162645218945485 28.456530065109153 27.53734201455381 21.843482701391547 32-33 21.673101673101673 28.545688545688545 27.47747747747748 22.303732303732303 34-35 21.765756570553712 28.719060984945138 27.404950242408777 22.11023220209237 36-37 21.771406629975683 28.79815691795725 27.531038013567134 21.899398438499937 38-39 22.531711782398325 28.612527788675298 27.46174970576697 21.39401072315941 40-41 22.409670563230605 28.520191285866098 27.510626992561104 21.55951115834219 42-43 22.129186602870814 28.38915470494418 26.780967570441256 22.700691121743755 44-45 22.35772357723577 28.15368476265408 27.865198006818776 21.623393653291373 46-47 22.270916334661354 28.49933598937583 27.715803452855248 21.51394422310757 48-49 22.472659375833555 27.527340624166445 27.927447319285143 22.072552680714857 50-51 20.754716981132077 28.536109303838646 28.05465191932336 22.65452179570592 52-53 21.37894874819767 28.627605190719624 27.95910342115612 22.034342639926596 54-55 21.700956624295635 28.423535578561133 27.04756912593369 22.82793867120954 56-57 22.076731700929685 28.335733926934658 27.235825585963074 22.35170878617258 58-59 21.5897166841553 28.436516264428125 28.043022035676813 21.93074501573977 60-61 22.80656747049769 28.360697793740382 26.52642380708055 22.306310928681373 62-63 22.074015953968875 29.004838498757685 26.951745782659863 21.969399764613573 64-65 22.23246018165065 28.20850335658813 26.931683559299724 22.6273529024615 66-67 22.203029497741163 28.85995216582514 26.694127026308795 22.2428913101249 68-69 22.27212681638045 28.07133421400264 27.767503302509905 21.889035667107002 70-71 22.486313259447186 28.74883161970891 26.932834824409134 21.83202029643477 72-73 22.187960852661213 28.904678911382227 27.041158332216114 21.86620190374045 74-75 22.078447230084915 27.753066451004177 27.59131958484971 22.577166734061194 76-77 22.265625 28.47521551724138 26.65678879310345 22.60237068965517 78-79 22.45529111200753 28.385101519429877 27.20182869436601 21.957778674196586 80-81 21.91435768261965 28.914225109372925 26.48813469441867 22.683282513588757 82-83 22.022268254790266 29.117037804246504 27.446918694976695 21.413775245986535 84-85 22.590738423028785 28.26971214017522 27.190237797246557 21.94931163954944 86-87 22.848392036753445 28.453292496171517 26.998468606431853 21.699846860643184 88-89 22.417125018581835 28.51196670135276 26.861899806748923 22.209008473316487 90-91 22.590975254730715 28.7627365356623 27.292576419213976 21.353711790393014 92-93 23.2900185634728 28.059403112951593 27.074111095244895 21.576467228330714 94-95 22.531214528944382 29.3416572077185 27.07150964812713 21.05561861520999 96-97 22.3070516379789 29.23375902276513 26.374236535258188 22.08495280399778 98-99 22.061281337047355 29.693593314763234 27.57660167130919 20.668523676880223 100-101 23.020283412058905 28.99416504584607 27.174215059738817 20.81133648235621 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 5.0 2 9.0 3 15.5 4 20.5 5 20.5 6 15.5 7 10.5 8 10.5 9 11.5 10 11.5 11 13.0 12 11.5 13 9.5 14 11.0 15 11.0 16 9.0 17 8.0 18 8.5 19 8.0 20 7.0 21 9.0 22 12.0 23 11.5 24 11.0 25 14.5 26 15.0 27 21.5 28 27.0 29 23.5 30 27.0 31 41.5 32 44.0 33 53.0 34 82.5 35 109.0 36 131.0 37 135.0 38 151.0 39 186.0 40 206.0 41 220.0 42 216.5 43 208.5 44 198.5 45 179.0 46 169.0 47 159.0 48 144.5 49 134.5 50 128.5 51 119.5 52 106.0 53 85.5 54 67.5 55 56.0 56 46.5 57 36.0 58 28.5 59 25.5 60 20.5 61 14.5 62 13.0 63 11.5 64 10.0 65 9.0 66 10.0 67 9.5 68 4.5 69 4.5 70 6.0 71 5.0 72 5.0 73 3.0 74 0.0 75 0.5 76 1.5 77 1.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.25 2 0.125 3 0.1 4 0.075 5 0.42500000000000004 6 0.0 7 0.1 8 1.6 9 1.375 10-11 3.4750000000000005 12-13 4.675 14-15 5.325 16-17 4.75 18-19 4.275 20-21 4.5125 22-23 4.925 24-25 4.8375 26-27 3.25 28-29 2.875 30-31 2.0875 32-33 2.875 34-35 2.025 36-37 2.3375 38-39 4.4125 40-41 5.8999999999999995 42-43 5.949999999999999 44-45 4.675 46-47 5.875 48-49 6.275 50-51 3.9375 52-53 4.6375 54-55 4.6125 56-57 4.5375 58-59 4.7 60-61 2.55 62-63 4.4125 64-65 5.0375000000000005 66-67 5.925 68-69 5.375 70-71 6.3875 72-73 6.7625 74-75 7.262499999999999 76-77 7.199999999999999 78-79 7.0375 80-81 5.7125 82-83 3.45 84-85 20.1 86-87 18.375 88-89 15.9125 90-91 14.124999999999998 92-93 12.4625 94-95 11.899999999999999 96-97 9.950000000000001 98-99 10.25 100-101 10.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.67852604828462 97.075 2 1.1435832274459974 2.25 3 0.07623888182973317 0.22499999999999998 4 0.05082592121982211 0.2 5 0.05082592121982211 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCC 5 0.125 No Hit CTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 35 3.5351102E-4 50.464287 1 >>END_MODULE Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458262 spots for SRR13844636.sra Written 1458262 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra Read 1458254 spots for SRR13844636.sra Written 1458254 spots for SRR13844636.sra SRR ids: ['SRR13844636.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bgisd6en SRR13844636.sra spots: 29165088 blocks: [[1, 1458254], [1458255, 2916508], [2916509, 4374762], [4374763, 5833016], [5833017, 7291270], [7291271, 8749524], [8749525, 10207778], [10207779, 11666032], [11666033, 13124286], [13124287, 14582540], [14582541, 16040794], [16040795, 17499048], [17499049, 18957302], [18957303, 20415556], [20415557, 21873810], [21873811, 23332064], [23332065, 24790318], [24790319, 26248572], [26248573, 27706826], [27706827, 29165088]] SRR13844636 file size 7041719 SRR13844636 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844636 SRR13844636_1.fastq SRR13844636_2.fastq Input file: SRR13844636_1.fastq Paired file: SRR13844636_2.fastq trimmed: SRR13844636-trimmed-pair1.fastq, SRR13844636-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:44:02 2024 >> started Fri Dec 6 12:44:29 2024 >> done (27.488s) 29165088 read pairs processed; of these: 335982 ( 1.15%) short read pairs filtered out after trimming by size control 171885 ( 0.59%) empty read pairs filtered out after trimming by size control 28657221 (98.26%) read pairs available; of these: 5952000 (20.77%) trimmed read pairs available after processing 22705221 (79.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 50 0.00% 20 133 0.00% 21 213 0.00% 22 257 0.00% 23 325 0.00% 24 355 0.00% 25 409 0.00% 26 482 0.00% 27 571 0.00% 28 693 0.00% 29 778 0.00% 30 961 0.00% 31 1164 0.00% 32 1396 0.00% 33 1700 0.01% 34 2067 0.01% 35 2400 0.01% 36 2944 0.01% 37 3768 0.01% 38 4475 0.02% 39 5232 0.02% 40 6230 0.02% 41 7120 0.02% 42 8179 0.03% 43 9180 0.03% 44 10404 0.04% 45 11291 0.04% 46 12458 0.04% 47 13709 0.05% 48 14907 0.05% 49 16315 0.06% 50 17636 0.06% 51 18955 0.07% 52 21205 0.07% 53 22214 0.08% 54 23789 0.08% 55 25447 0.09% 56 27963 0.10% 57 29053 0.10% 58 32790 0.11% 59 198942 0.69% 60 237042 0.83% 61 216532 0.76% 62 214804 0.75% 63 184231 0.64% 64 135029 0.47% 65 100859 0.35% 66 77318 0.27% 67 62052 0.22% 68 53049 0.19% 69 51416 0.18% 70 47135 0.16% 71 43257 0.15% 72 42545 0.15% 73 42460 0.15% 74 42216 0.15% 75 44155 0.15% 76 42298 0.15% 77 45043 0.16% 78 44203 0.15% 79 44766 0.16% 80 46531 0.16% 81 47936 0.17% 82 51963 0.18% 83 56961 0.20% 84 61802 0.22% 85 63533 0.22% 86 65895 0.23% 87 68535 0.24% 88 74474 0.26% 89 81324 0.28% 90 91095 0.32% 91 114819 0.40% 92 167776 0.59% 93 113512 0.40% 94 116256 0.41% 95 131548 0.46% 96 158896 0.55% 97 207316 0.72% 98 286635 1.00% 99 434678 1.52% 100 1181932 4.12% 101 22705221 79.23% 28657221 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=23 prefix-density=0.36 prefix-fanout=2.1 sequence=TGCTCGTAGGAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=62.30 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.4 sequence=AACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGAACGGAACAGAACAGGAACACACGACAGGTAGCATCACGGACAAACACCTAATGGTAACCCTTAAACATCTCAAACCCTACGCGATGGAGCGAGATCTAGGATACTCGGGAGCGATAACATCACAGATAAAAGGTAACAAGGATAACTGGCCACGAGGGGCCCCACCATTCACTCCCTCCAGTTGCCGCCGCCGGAGCCTCCACGGC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=21 prefix-density=0.39 prefix-fanout=2.3 sequence=GTAGTGTTCCCCGTCCTGCTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=74.36 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.6 sequence=AACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGAACGGAACAGAACAGGAACACACGACAGGTAGCATCACGGACAAACACCTAATGGTAACCCTTAAACATCTCAAACCCTACGCGATGGAGCGAGATCTAGGATACTCGGGAGCGATAACATCAC SRR13844636 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:45:59 Started mapping on | Dec 06 12:45:59 Finished on | Dec 06 12:47:30 Mapping speed, Million of reads per hour | 1133.69 Number of input reads | 28657221 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 27250509 Uniquely mapped reads % | 95.09% Average mapped length | 193.43 Number of splices: Total | 9524732 Number of splices: Annotated (sjdb) | 8943134 Number of splices: GT/AG | 9249646 Number of splices: GC/AG | 122361 Number of splices: AT/AC | 4993 Number of splices: Non-canonical | 147732 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.47% Deletion average length | 1.02 Insertion rate per base | 0.02% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 556309 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 7296 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1948973 1948973 1948973 N_multimapping 556309 556309 556309 N_noFeature 1074228 13936874 13813184 N_ambiguous 653135 41521 39356 UnstrandedReadsAssigned:25523146 PositiveStrandReadsAssigned:13272114 NegativeStrandReadsAssigned:13397969 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844636 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844636-trimmed-pair1.fastq SRR13844636-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,657,221 reads, 26,957,725 reads pseudoaligned [quant] estimated average fragment length: 167.136 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR13844636.ke.tsv 35125 SRR13844636.se.tsv 88098 total ==> SRR13844636.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.904 0 0 PNS24247 1044 877.864 0 0 PNS24249 1928 1761.86 7.669 0.211808 PNS24246 1044 877.864 0 0 PNS24248 1044 877.864 0 0 PNS24244 1471 1304.86 2107.33 78.5858 PNS24243 293 132.046 1 0.368511 KQK14069 1603 1436.86 131.343 4.44803 KQK14071 474 308.543 0 0 ==> SRR13844636.se.tsv <== BRADI_1g14170v3 131 BRADI_1g53295v3 42 BRADI_1g59795v3 417 BRADI_1g07683v3 1 BRADI_1g00485v3 16 BRADI_1g20270v3 2774 BRADI_1g74790v3 8 BRADI_1g09890v3 0 BRADI_1g77505v3 1122 BRADI_1g48960v3 1 SRR13844636 completed mapping pipeline successfully