Starting /dee2/code/volunteer_pipeline.sh SRR13844637 current disk space = 1551318941696 free memory = 1607236728 SRR13844637 SRAfilesize 76a7c16d11f35f9e23d5bb9f37a099c1 SRR13844637.sra SRR13844637.sra file validated SRR13844637 is paired end SRR13844637 is conventional basespace SRR13844637 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844637_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99925 34.0 33.0 34.0 31.0 34.0 2 33.14525 34.0 33.0 34.0 31.0 34.0 3 33.13225 34.0 33.0 34.0 31.0 34.0 4 36.40825 37.0 37.0 37.0 35.0 37.0 5 36.3725 37.0 37.0 37.0 35.0 37.0 6 36.43825 37.0 37.0 37.0 35.0 37.0 7 36.44175 37.0 37.0 37.0 35.0 37.0 8 36.45425 37.0 37.0 37.0 35.0 37.0 9 38.0425 39.0 39.0 39.0 37.0 39.0 10-11 38.310874999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.291 39.0 39.0 39.0 37.0 39.0 14-15 39.680625 41.0 40.0 41.0 37.5 41.0 16-17 39.661125 41.0 40.0 41.0 37.0 41.0 18-19 39.715625 41.0 40.0 41.0 37.5 41.0 20-21 39.686 41.0 40.0 41.0 37.0 41.0 22-23 39.53425 41.0 40.0 41.0 37.0 41.0 24-25 39.370875 41.0 40.0 41.0 36.5 41.0 26-27 39.114875 41.0 40.0 41.0 36.0 41.0 28-29 38.93275 41.0 39.0 41.0 36.0 41.0 30-31 38.8275 41.0 39.5 41.0 36.0 41.0 32-33 38.801375 41.0 39.0 41.0 36.0 41.0 34-35 38.385625000000005 40.5 38.5 41.0 34.5 41.0 36-37 38.408 40.0 38.5 41.0 35.0 41.0 38-39 38.35 40.0 38.0 41.0 35.0 41.0 40-41 38.353624999999994 40.0 38.5 41.0 35.0 41.0 42-43 38.2295 40.0 38.0 41.0 34.5 41.0 44-45 38.0205 40.0 38.0 41.0 33.5 41.0 46-47 38.116625 40.0 38.0 41.0 34.0 41.0 48-49 37.923 40.0 38.0 41.0 33.5 41.0 50-51 37.917125 40.0 38.0 41.0 33.5 41.0 52-53 37.85025 40.0 38.0 41.0 34.0 41.0 54-55 37.616749999999996 40.0 37.0 41.0 33.0 41.0 56-57 37.46375 40.0 37.0 41.0 33.0 41.0 58-59 37.117875 39.5 36.0 41.0 32.5 41.0 60-61 37.03325 39.0 36.0 41.0 33.0 41.0 62-63 37.093125 39.0 36.0 41.0 33.5 41.0 64-65 36.945875 39.0 35.0 41.0 33.5 41.0 66-67 36.633624999999995 38.5 35.0 41.0 33.0 41.0 68-69 36.174875 37.0 35.0 40.0 32.5 41.0 70-71 35.844625 37.0 35.0 39.5 33.0 41.0 72-73 35.305375 36.0 35.0 39.0 31.5 41.0 74-75 35.11425 36.0 35.0 38.5 32.0 40.5 76-77 34.1605 35.0 34.0 37.0 30.5 39.0 78-79 34.313 35.0 35.0 37.0 31.0 39.0 80-81 34.142875000000004 35.0 35.0 36.5 31.0 38.0 82-83 33.931875 35.0 35.0 36.0 32.0 37.0 84-85 33.79025 35.0 35.0 36.0 32.0 37.0 86-87 33.542125 35.0 35.0 35.0 31.5 36.5 88-89 33.397375 35.0 34.5 35.0 31.5 36.0 90-91 33.33325 35.0 35.0 35.0 31.5 36.0 92-93 33.231375 35.0 34.5 35.0 31.5 36.0 94-95 33.179 35.0 34.0 35.0 32.0 36.0 96-97 33.039500000000004 35.0 34.0 35.0 31.0 35.5 98-99 32.889375 35.0 34.0 35.0 31.0 35.0 100-101 31.697375 34.5 32.5 35.0 27.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 5.0 8 9.0 9 22.0 10 25.0 11 8.0 12 10.0 13 5.0 14 4.0 15 4.0 16 2.0 17 2.0 18 3.0 19 2.0 20 2.0 21 5.0 22 3.0 23 9.0 24 8.0 25 9.0 26 19.0 27 13.0 28 13.0 29 27.0 30 33.0 31 27.0 32 55.0 33 79.0 34 117.0 35 179.0 36 411.0 37 920.0 38 1592.0 39 377.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.311155577788895 13.856928464232116 9.054527263631815 54.777388694347174 2 18.925 20.175 45.5 15.4 3 22.525000000000002 22.775000000000002 27.625 27.075 4 24.175 28.749999999999996 23.425 23.65 5 25.35 30.625000000000004 27.075 16.950000000000003 6 19.125 32.175 31.15 17.549999999999997 7 17.675 17.675 45.275 19.375 8 17.599999999999998 21.575 36.15 24.675 9 19.75 20.349999999999998 37.85 22.05 10-11 23.5625 29.5875 26.637499999999996 20.2125 12-13 21.175 24.8625 32.824999999999996 21.1375 14-15 21.925 26.650000000000002 30.362499999999997 21.0625 16-17 22.7 26.85 29.862499999999997 20.5875 18-19 22.5 27.9125 28.199999999999996 21.3875 20-21 22.162499999999998 27.975 27.875 21.987499999999997 22-23 22.0125 27.05 28.725 22.2125 24-25 21.8 27.575 27.650000000000002 22.975 26-27 22.3875 27.875 27.487499999999997 22.25 28-29 23.0875 27.075 27.537499999999998 22.3 30-31 22.775000000000002 27.8625 27.037499999999998 22.325 32-33 22.662499999999998 27.750000000000004 27.3625 22.225 34-35 23.3625 27.3625 26.4625 22.8125 36-37 22.6375 27.6875 26.3 23.375 38-39 22.4875 29.325000000000003 26.987499999999997 21.2 40-41 23.3375 27.1375 27.3625 22.162499999999998 42-43 22.675 26.75 28.212500000000002 22.3625 44-45 23.075000000000003 27.1375 27.925 21.8625 46-47 22.900000000000002 27.900000000000002 26.775 22.425 48-49 23.2875 26.900000000000002 26.7125 23.1 50-51 22.9875 27.85 27.4125 21.75 52-53 23.4625 27.0625 27.224999999999998 22.25 54-55 22.1875 27.6125 27.075 23.125 56-57 22.875 27.250000000000004 27.3 22.575 58-59 22.400000000000002 27.3 27.6 22.7 60-61 23.4625 27.175 26.5125 22.85 62-63 22.412499999999998 27.462500000000002 27.437499999999996 22.6875 64-65 22.55 27.875 26.9125 22.662499999999998 66-67 23.1875 26.400000000000002 27.2625 23.150000000000002 68-69 22.575 27.525 27.3125 22.5875 70-71 21.925 27.287499999999998 27.675 23.1125 72-73 23.799999999999997 26.974999999999998 26.400000000000002 22.825 74-75 22.175 27.5875 27.500000000000004 22.7375 76-77 22.4625 27.6125 27.2625 22.662499999999998 78-79 23.1125 27.1625 26.387500000000003 23.3375 80-81 22.8625 27.712500000000002 26.575 22.85 82-83 22.475 27.6 26.9125 23.0125 84-85 22.4875 27.150000000000002 27.8375 22.525000000000002 86-87 22.425 27.487499999999997 27.6 22.4875 88-89 23.2375 27.925 27.1375 21.7 90-91 22.475 27.762500000000003 26.887499999999996 22.875 92-93 22.725 27.250000000000004 27.35 22.675 94-95 22.1375 27.400000000000002 27.224999999999998 23.2375 96-97 22.662499999999998 27.9125 26.700000000000003 22.725 98-99 22.3875 28.512500000000003 27.150000000000002 21.95 100-101 22.525000000000002 27.3125 27.187499999999996 22.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.5 12 1.0 13 0.5 14 0.5 15 1.0 16 2.5 17 4.0 18 4.0 19 4.0 20 3.5 21 4.0 22 4.5 23 3.0 24 4.0 25 4.5 26 6.5 27 7.5 28 7.0 29 12.5 30 20.0 31 22.5 32 27.5 33 36.0 34 49.5 35 84.5 36 104.0 37 119.5 38 147.5 39 171.5 40 193.5 41 200.0 42 205.5 43 218.5 44 237.0 45 228.5 46 193.5 47 185.5 48 191.0 49 178.0 50 160.5 51 144.5 52 128.0 53 113.0 54 86.5 55 60.5 56 57.5 57 54.5 58 42.5 59 31.0 60 26.0 61 28.0 62 25.5 63 16.5 64 11.5 65 13.5 66 15.0 67 14.0 68 11.0 69 10.0 70 11.0 71 13.0 72 11.0 73 7.5 74 4.5 75 2.0 76 3.0 77 3.5 78 2.5 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65277071682766 97.02499999999999 2 1.0930350788002035 2.15 3 0.20335536349771224 0.6 4 0.02541942043721403 0.1 5 0.02541942043721403 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTTATTCCACATCATAAACACCATACATCATCCAACTCGCAGACTCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0125 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0125 0.0 0.0 0.0 0.025 60-61 0.025 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.037500000000000006 0.0 0.0 0.0 0.025 70-71 0.0625 0.0 0.0 0.0 0.025 72-73 0.075 0.0 0.0 0.0 0.025 74-75 0.075 0.0 0.0 0.0 0.025 76-77 0.125 0.0 0.0 0.0 0.025 78-79 0.16249999999999998 0.0 0.0 0.0 0.025 80-81 0.1875 0.0 0.0 0.0 0.025 82-83 0.23750000000000002 0.0 0.0 0.0 0.025 84-85 0.35 0.0 0.0 0.0 0.025 86-87 0.42500000000000004 0.0 0.0 0.0 0.025 88-89 0.5 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844637 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844637_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.15025 34.0 31.0 34.0 30.0 34.0 2 32.431 34.0 31.0 34.0 30.0 34.0 3 32.59375 34.0 31.0 34.0 30.0 34.0 4 35.93925 37.0 37.0 37.0 35.0 37.0 5 35.84175 37.0 37.0 37.0 33.0 37.0 6 35.912 37.0 37.0 37.0 35.0 37.0 7 35.85625 37.0 37.0 37.0 35.0 37.0 8 35.53275 37.0 37.0 37.0 33.0 37.0 9 37.41525 39.0 39.0 39.0 35.0 39.0 10-11 37.0345 39.0 39.0 39.0 35.0 39.0 12-13 36.68425 39.0 39.0 39.0 35.0 39.0 14-15 38.15125 41.0 40.0 41.0 35.5 41.0 16-17 37.94325 41.0 39.5 41.0 34.0 41.0 18-19 37.863375000000005 41.0 39.5 41.0 34.0 41.0 20-21 37.633624999999995 41.0 39.5 41.0 33.5 41.0 22-23 37.3475 41.0 39.0 41.0 33.0 41.0 24-25 36.802125000000004 41.0 38.0 41.0 30.0 41.0 26-27 37.013000000000005 41.0 39.0 41.0 31.0 41.0 28-29 37.022875 41.0 39.0 41.0 30.5 41.0 30-31 36.902874999999995 41.0 38.5 41.0 30.0 41.0 32-33 36.720749999999995 41.0 38.0 41.0 30.0 41.0 34-35 36.643625 40.5 38.0 41.0 30.0 41.0 36-37 36.34825 40.0 38.0 41.0 29.5 41.0 38-39 36.131125 40.0 38.0 41.0 27.5 41.0 40-41 35.7305 40.0 38.0 41.0 23.5 41.0 42-43 35.682500000000005 40.0 37.5 41.0 24.0 41.0 44-45 35.2555 40.0 36.5 41.0 21.5 41.0 46-47 35.202 40.0 36.5 41.0 20.5 41.0 48-49 35.444874999999996 40.0 37.0 41.0 21.5 41.0 50-51 34.970875 39.5 36.0 40.5 21.0 40.5 52-53 34.895375 39.5 36.0 40.5 22.5 41.0 54-55 35.43175 40.0 36.0 41.0 25.0 41.0 56-57 35.234125000000006 40.0 35.5 41.0 23.5 41.0 58-59 35.24725 40.0 35.5 41.0 23.5 41.0 60-61 35.106875 39.0 35.0 41.0 25.0 41.0 62-63 34.929874999999996 39.0 35.0 41.0 24.0 41.0 64-65 34.747875 39.0 35.0 41.0 26.0 41.0 66-67 34.28175 37.5 35.0 41.0 23.5 41.0 68-69 34.008375 37.0 35.0 40.0 23.0 41.0 70-71 33.396875 36.5 35.0 39.0 13.0 41.0 72-73 32.933499999999995 36.0 35.0 39.0 5.0 41.0 74-75 32.614000000000004 35.5 35.0 37.5 2.0 40.0 76-77 32.144375 35.0 34.0 37.0 2.0 39.0 78-79 31.843125 35.0 34.0 37.0 2.0 39.0 80-81 31.381500000000003 35.0 34.0 36.0 2.0 37.5 82-83 30.951999999999998 35.0 33.5 35.5 2.0 37.0 84-85 27.590875 34.0 28.5 35.0 2.0 36.0 86-87 27.6045 34.0 28.0 35.0 2.0 36.0 88-89 27.673125 34.0 28.0 35.0 2.0 36.0 90-91 27.99175 34.0 29.5 35.0 2.0 35.0 92-93 28.200499999999998 34.0 30.0 35.0 2.0 35.0 94-95 28.04975 34.0 29.5 35.0 2.0 35.0 96-97 27.761875 34.0 29.0 35.0 2.0 35.0 98-99 27.861125 34.0 30.0 35.0 2.0 35.0 100-101 26.198125 32.5 24.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 47.0 4 65.0 5 5.0 6 26.0 7 46.0 8 24.0 9 18.0 10 37.0 11 17.0 12 14.0 13 7.0 14 8.0 15 2.0 16 5.0 17 7.0 18 3.0 19 9.0 20 6.0 21 19.0 22 20.0 23 13.0 24 8.0 25 6.0 26 28.0 27 23.0 28 36.0 29 27.0 30 53.0 31 86.0 32 115.0 33 94.0 34 150.0 35 237.0 36 419.0 37 836.0 38 1211.0 39 252.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.078848560700877 13.4918648310388 9.486858573216521 53.94242803504381 2 19.048811013767207 20.175219023779725 45.63204005006258 15.143929912390488 3 22.202753441802255 22.57822277847309 26.708385481852314 28.510638297872344 4 25.056320400500624 27.95994993742178 24.130162703379224 22.853566958698373 5 24.473947895791586 32.139278557114224 27.304609218436877 16.082164328657313 6 20.775 32.5 30.2 16.525000000000002 7 17.571964956195245 17.69712140175219 45.25657071339174 19.474342928660825 8 17.319848293299618 21.31479140328698 36.257901390644754 25.10745891276865 9 19.248234106962663 20.53481331987891 38.69828456104945 21.51866801210898 10-11 23.476587556125722 30.006414368184736 27.7613855035279 18.755612572161642 12-13 21.10103626943005 24.417098445595855 33.05699481865285 21.424870466321245 14-15 22.509752925877763 25.916775032509754 31.248374512353706 20.32509752925878 16-17 22.384964355152302 26.49384316267012 29.604666234607908 21.51652624756967 18-19 21.466374080289143 26.46185620240093 29.41783916354718 22.65393055376275 20-21 21.486748545572077 28.01551389786684 28.674854557207496 21.822882999353588 22-23 22.294232015554115 27.116007777057682 28.39922229423202 22.190537913156188 24-25 22.37490277417682 27.962146746175787 27.573243453461238 22.089707026186154 26-27 21.30245649948823 28.275332650972363 27.699590583418626 22.722620266120778 28-29 22.627551020408163 27.56377551020408 26.505102040816325 23.30357142857143 30-31 23.24283176858665 28.102004567368688 27.21390510022837 21.44125856381629 32-33 23.564684868588927 28.4256187803011 26.537381985200305 21.47231436590967 34-35 23.15202231520223 28.10954735640928 26.04285533155826 22.695574996830224 36-37 23.045633659590695 27.83780348290327 26.833608745392144 22.28295411211389 38-39 22.46479782973776 27.399560780260952 27.28329673168841 22.85234465831288 40-41 22.10320052253429 27.707380796864793 27.36773350751143 22.821685173089485 42-43 22.297738857665664 28.989674552346102 26.41484773232257 22.297738857665664 44-45 22.363142228549243 27.5397955221949 27.358612656917302 22.738449592338554 46-47 22.315129344133787 27.057747582963152 27.384374183433497 23.24274888946956 48-49 22.814834228803566 27.283449089241252 27.191717992399422 22.70999868955576 50-51 22.359608449252963 27.266872746007216 27.421432251416793 22.952086553323028 52-53 22.751391225572668 28.782192312669856 25.922091367930634 22.544325093826842 54-55 22.01371813122816 27.850394719813643 26.530348129933994 23.605539019024203 56-57 22.7972570837107 27.364471471082936 26.963384655194723 22.874886790011644 58-59 22.83382981479083 28.260588006734878 26.201269265639166 22.704312912835125 60-61 22.65953381734811 28.060119729970705 26.136797860145204 23.143548592535982 62-63 22.944674250258533 27.546535677352637 25.99534643226474 23.513443640124095 64-65 23.11088029083355 27.862892755128538 26.64243053752272 22.383796416515192 66-67 22.16272691654695 28.07888206869531 26.99490662139219 22.763484393365548 68-69 22.180304410042933 27.61805645895668 27.61805645895668 22.583582672043708 70-71 22.515079989509573 27.760293731969576 26.514555468135327 23.21007081038552 72-73 22.824086247699185 26.97870102550618 27.46515908493295 22.73205364186169 74-75 23.005003950487225 28.166973926784305 26.613115617592836 22.214906505135634 76-77 22.343647136273866 28.466096115865703 26.872942725477287 22.317314022383147 78-79 21.947368421052634 28.342105263157897 26.763157894736842 22.94736842105263 80-81 22.371510566136184 27.928515523088965 27.10670493086355 22.593268979911297 82-83 22.95565239682133 27.98000512689054 26.441937964624458 22.622404511663678 84-85 22.618360277136258 26.93418013856813 26.558891454965355 23.888568129330253 86-87 22.440832620473337 27.644710578842314 26.96036498431708 22.954091816367264 88-89 23.361344537815125 27.535014005602243 27.00280112044818 22.100840336134453 90-91 23.138555049039923 27.932034811438044 26.301975410968364 22.627434728553666 92-93 23.08743169398907 27.89617486338798 26.284153005464482 22.73224043715847 94-95 23.83025027203482 26.659412404787812 27.35310119695321 22.157236126224156 96-97 23.568753344034242 26.819154628143394 26.73889780631354 22.87319422150883 98-99 23.05112035421978 27.371528243660272 27.076345095934524 22.501006306185428 100-101 23.44504021447721 28.150134048257375 26.045576407506704 22.35924932975871 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 4.5 2 6.0 3 9.5 4 16.0 5 16.5 6 13.0 7 7.5 8 8.5 9 11.5 10 12.5 11 11.5 12 7.0 13 5.5 14 6.0 15 8.0 16 8.0 17 6.5 18 6.0 19 6.5 20 6.5 21 6.0 22 6.5 23 5.5 24 6.0 25 11.5 26 11.5 27 11.5 28 21.0 29 22.0 30 18.5 31 27.5 32 34.5 33 51.0 34 66.5 35 72.0 36 87.5 37 121.5 38 146.5 39 168.5 40 190.5 41 198.0 42 205.0 43 208.5 44 211.0 45 214.0 46 197.5 47 172.5 48 160.5 49 153.5 50 142.5 51 110.0 52 102.5 53 106.5 54 82.0 55 64.0 56 57.5 57 49.5 58 41.0 59 36.5 60 30.0 61 24.0 62 21.5 63 16.0 64 12.5 65 12.0 66 11.5 67 10.0 68 12.5 69 12.5 70 8.5 71 8.0 72 9.5 73 8.0 74 5.0 75 5.0 76 5.0 77 3.5 78 1.5 79 1.5 80 2.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 0.125 3 0.125 4 0.125 5 0.2 6 0.0 7 0.125 8 1.125 9 0.8999999999999999 10-11 2.5625 12-13 3.5000000000000004 14-15 3.875 16-17 3.5624999999999996 18-19 3.1625 20-21 3.3125 22-23 3.5624999999999996 24-25 3.5749999999999997 26-27 2.3 28-29 2.0 30-31 1.4749999999999999 32-33 2.025 34-35 1.4125 36-37 1.6625 38-39 3.2375000000000003 40-41 4.3125 42-43 4.3625 44-45 3.4125 46-47 4.324999999999999 48-49 4.6125 50-51 2.9499999999999997 52-53 3.4125 54-55 3.4125 56-57 3.3875 58-59 3.4875000000000003 60-61 1.8624999999999998 62-63 3.3000000000000003 64-65 3.7249999999999996 66-67 4.2875000000000005 68-69 3.9125 70-71 4.675 72-73 4.925 74-75 5.075 76-77 5.0625 78-79 5.0 80-81 4.175 82-83 2.475 84-85 13.4 86-87 12.325 88-89 10.75 90-91 9.5125 92-93 8.5 94-95 8.1 96-97 6.550000000000001 98-99 6.8375 100-101 6.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62839725679451 97.075 2 1.143002286004572 2.25 3 0.2286004572009144 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra Read 1030436 spots for SRR13844637.sra Written 1030436 spots for SRR13844637.sra Read 1030424 spots for SRR13844637.sra Written 1030424 spots for SRR13844637.sra SRR ids: ['SRR13844637.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ge08vn2 SRR13844637.sra spots: 20608492 blocks: [[1, 1030424], [1030425, 2060848], [2060849, 3091272], [3091273, 4121696], [4121697, 5152120], [5152121, 6182544], [6182545, 7212968], [7212969, 8243392], [8243393, 9273816], [9273817, 10304240], [10304241, 11334664], [11334665, 12365088], [12365089, 13395512], [13395513, 14425936], [14425937, 15456360], [15456361, 16486784], [16486785, 17517208], [17517209, 18547632], [18547633, 19578056], [19578057, 20608492]] SRR13844637 file size 4969418 SRR13844637 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844637 SRR13844637_1.fastq SRR13844637_2.fastq Input file: SRR13844637_1.fastq Paired file: SRR13844637_2.fastq trimmed: SRR13844637-trimmed-pair1.fastq, SRR13844637-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:46:50 2024 >> started Fri Dec 6 12:47:20 2024 >> done (30.039s) 20608492 read pairs processed; of these: 224909 ( 1.09%) short read pairs filtered out after trimming by size control 146496 ( 0.71%) empty read pairs filtered out after trimming by size control 20237087 (98.20%) read pairs available; of these: 4267065 (21.09%) trimmed read pairs available after processing 15970022 (78.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 45 0.00% 20 90 0.00% 21 178 0.00% 22 236 0.00% 23 272 0.00% 24 289 0.00% 25 378 0.00% 26 396 0.00% 27 486 0.00% 28 532 0.00% 29 643 0.00% 30 790 0.00% 31 807 0.00% 32 967 0.00% 33 1124 0.01% 34 1119 0.01% 35 1184 0.01% 36 1372 0.01% 37 1446 0.01% 38 1600 0.01% 39 1708 0.01% 40 1829 0.01% 41 2059 0.01% 42 2172 0.01% 43 2418 0.01% 44 2650 0.01% 45 2786 0.01% 46 3073 0.02% 47 3351 0.02% 48 3502 0.02% 49 3860 0.02% 50 4193 0.02% 51 4809 0.02% 52 5629 0.03% 53 6188 0.03% 54 6775 0.03% 55 7687 0.04% 56 8833 0.04% 57 10258 0.05% 58 12203 0.06% 59 120200 0.59% 60 153365 0.76% 61 156498 0.77% 62 176618 0.87% 63 149444 0.74% 64 103243 0.51% 65 70449 0.35% 66 51485 0.25% 67 41884 0.21% 68 37585 0.19% 69 36831 0.18% 70 34241 0.17% 71 32101 0.16% 72 31602 0.16% 73 33396 0.17% 74 31423 0.16% 75 33160 0.16% 76 30535 0.15% 77 31856 0.16% 78 31706 0.16% 79 31843 0.16% 80 33559 0.17% 81 35362 0.17% 82 38788 0.19% 83 42859 0.21% 84 45225 0.22% 85 48008 0.24% 86 49703 0.25% 87 51994 0.26% 88 57539 0.28% 89 63138 0.31% 90 69862 0.35% 91 90060 0.45% 92 129106 0.64% 93 86786 0.43% 94 90376 0.45% 95 101374 0.50% 96 121665 0.60% 97 156097 0.77% 98 217790 1.08% 99 325388 1.61% 100 882969 4.36% 101 15970022 78.91% 20237087 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.38 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=44.34 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.3 sequence=ACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGAACGGAACAGAACAGGAACACACGACAGGTAGCATCACGGACAAACACCTAATGGTAACCCTTAAACATCTCAAACCCTACGCGATGGAGCGAGATCTAGGATACTCGGGAGCGATAACATCACAGATAAAAGGTAACAAGGATAACTGGCCACGAGGGGCCCCACCATTCACTCCCTCCAGTTGCCGCCGCCGG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=27.54 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.7 sequence=ACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGAACGGAACAGAACAGGAACACACGACAGGTAGCATCACGGACAAACACCTAATGGTAACCCTTAAACATCTCAAACCCTACGCGATGGAGCGAGATCTAGGATACTCGGGAGCGATAACATCACAGATAAAAGGTAACAAGGATAACTGGCCACGAGGGGCCCCACCATTCACTCCCTCCAGTTGCCGCCGCCGGAGCC SRR13844637 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:48:03 Started mapping on | Dec 06 12:48:04 Finished on | Dec 06 12:49:03 Mapping speed, Million of reads per hour | 1234.81 Number of input reads | 20237087 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 19435610 Uniquely mapped reads % | 96.04% Average mapped length | 193.09 Number of splices: Total | 7853828 Number of splices: Annotated (sjdb) | 7430618 Number of splices: GT/AG | 7662890 Number of splices: GC/AG | 95595 Number of splices: AT/AC | 3441 Number of splices: Non-canonical | 91902 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.46% Deletion average length | 1.02 Insertion rate per base | 0.02% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394878 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 3663 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.91% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1241805 1241805 1241805 N_multimapping 394878 394878 394878 N_noFeature 743434 9918667 9877755 N_ambiguous 440701 30174 29794 UnstrandedReadsAssigned:18251475 PositiveStrandReadsAssigned:9486769 NegativeStrandReadsAssigned:9528061 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844637 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844637-trimmed-pair1.fastq SRR13844637-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,237,087 reads, 19,096,425 reads pseudoaligned [quant] estimated average fragment length: 166.96 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR13844637.ke.tsv 35125 SRR13844637.se.tsv 88098 total ==> SRR13844637.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.05 0 0 PNS24247 1044 878.04 0.489169 0.0418505 PNS24249 1928 1762.04 7.67241 0.327093 PNS24246 1044 878.04 0.489169 0.0418505 PNS24248 1044 878.04 0.489169 0.0418505 PNS24244 1471 1305.04 1125.86 64.8062 PNS24243 293 132.723 0 0 KQK14069 1603 1437.04 4.34236 0.226993 KQK14071 474 308.889 0 0 ==> SRR13844637.se.tsv <== BRADI_1g14170v3 11 BRADI_1g53295v3 206 BRADI_1g59795v3 472 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 2271 BRADI_1g74790v3 12 BRADI_1g09890v3 0 BRADI_1g77505v3 815 BRADI_1g48960v3 0 SRR13844637 completed mapping pipeline successfully