Starting /dee2/code/volunteer_pipeline.sh SRR13844638 current disk space = 1551316733952 free memory = 1607202456 SRR13844638 SRAfilesize ecb3a508199e25385fb5a4e4df093c75 SRR13844638.sra SRR13844638.sra file validated SRR13844638 is paired end SRR13844638 is conventional basespace SRR13844638 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844638_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9715 34.0 33.0 34.0 31.0 34.0 2 33.1 34.0 33.0 34.0 31.0 34.0 3 33.07875 34.0 33.0 34.0 31.0 34.0 4 36.385 37.0 37.0 37.0 35.0 37.0 5 36.361 37.0 37.0 37.0 35.0 37.0 6 36.38025 37.0 37.0 37.0 35.0 37.0 7 36.36975 37.0 37.0 37.0 35.0 37.0 8 36.384 37.0 37.0 37.0 35.0 37.0 9 37.96525 39.0 38.0 39.0 35.0 39.0 10-11 38.2645 39.0 39.0 39.0 37.0 39.0 12-13 38.268 39.0 39.0 39.0 37.0 39.0 14-15 39.653375 41.0 40.0 41.0 37.0 41.0 16-17 39.636625 41.0 40.0 41.0 37.0 41.0 18-19 39.68825 41.0 40.0 41.0 37.0 41.0 20-21 39.617125 41.0 40.0 41.0 37.0 41.0 22-23 39.410875000000004 41.0 39.5 41.0 36.5 41.0 24-25 39.2565 41.0 40.0 41.0 36.5 41.0 26-27 38.984625 41.0 39.0 41.0 36.0 41.0 28-29 38.753125 41.0 39.0 41.0 36.0 41.0 30-31 38.69775 41.0 39.0 41.0 36.0 41.0 32-33 38.664500000000004 41.0 39.0 41.0 35.0 41.0 34-35 38.275625000000005 40.0 38.5 41.0 34.5 41.0 36-37 38.208625 40.0 38.0 41.0 34.5 41.0 38-39 38.178625 40.0 38.0 41.0 34.0 41.0 40-41 38.212999999999994 40.0 38.0 41.0 34.5 41.0 42-43 38.005875 40.0 38.0 41.0 34.0 41.0 44-45 37.752375 40.0 38.0 41.0 33.0 41.0 46-47 37.863625 40.0 38.0 41.0 33.0 41.0 48-49 37.649125 40.0 38.0 41.0 33.0 41.0 50-51 37.68237499999999 40.0 37.5 41.0 33.0 41.0 52-53 37.594625 40.0 37.0 41.0 33.0 41.0 54-55 37.228625 40.0 36.0 41.0 33.0 41.0 56-57 37.1725 40.0 36.0 41.0 32.5 41.0 58-59 36.7735 39.0 35.5 41.0 31.5 41.0 60-61 36.689375 39.0 35.0 41.0 32.0 41.0 62-63 36.751374999999996 39.0 35.0 41.0 33.0 41.0 64-65 36.597375 39.0 35.0 41.0 33.0 41.0 66-67 36.299 37.5 35.0 40.5 33.0 41.0 68-69 35.873000000000005 37.0 35.0 39.5 32.0 41.0 70-71 35.573625 36.5 35.0 39.0 32.5 41.0 72-73 34.94775 36.0 35.0 39.0 31.0 40.5 74-75 34.82025 35.5 35.0 37.5 31.0 39.5 76-77 33.87875 35.0 33.5 37.0 30.5 39.0 78-79 34.06225 35.0 34.5 37.0 30.5 39.0 80-81 33.909875 35.0 35.0 36.0 31.0 37.5 82-83 33.761375 35.0 34.5 36.0 31.0 37.0 84-85 33.61475 35.0 35.0 35.5 31.0 37.0 86-87 33.364625000000004 35.0 34.0 35.0 31.0 36.0 88-89 33.250625 35.0 34.0 35.0 31.0 36.0 90-91 33.220625 35.0 34.0 35.0 31.0 36.0 92-93 33.099125 35.0 34.0 35.0 31.0 36.0 94-95 33.014875 35.0 34.0 35.0 31.0 36.0 96-97 32.948 35.0 34.0 35.0 30.5 35.0 98-99 32.830875 35.0 34.0 35.0 31.0 35.0 100-101 31.597375 34.5 32.0 35.0 27.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 10.0 9 21.0 10 27.0 11 13.0 12 7.0 13 8.0 14 2.0 15 3.0 16 5.0 17 3.0 18 4.0 19 1.0 20 1.0 21 4.0 22 8.0 23 6.0 24 10.0 25 13.0 26 9.0 27 18.0 28 30.0 29 27.0 30 42.0 31 47.0 32 46.0 33 77.0 34 120.0 35 211.0 36 444.0 37 1006.0 38 1451.0 39 325.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.317488116087066 13.610207655741807 6.9051788841631225 56.16712534400801 2 17.9 19.225 47.175 15.7 3 23.95 23.0 26.05 27.0 4 26.924999999999997 29.075 22.825 21.175 5 25.275 30.625000000000004 27.175 16.925 6 21.175 35.199999999999996 27.025 16.6 7 18.45 17.5 45.275 18.775 8 19.025 22.3 35.65 23.025000000000002 9 20.025000000000002 20.575 38.425 20.974999999999998 10-11 23.575 29.6625 26.7125 20.05 12-13 21.5 25.0125 32.1625 21.325 14-15 22.4375 25.687500000000004 30.075000000000003 21.8 16-17 23.2625 26.137500000000003 29.65 20.95 18-19 22.900000000000002 26.775 27.987499999999997 22.3375 20-21 23.1875 25.900000000000002 28.95 21.9625 22-23 22.625 27.712500000000002 27.3875 22.275 24-25 23.674999999999997 27.200000000000003 26.237500000000004 22.8875 26-27 22.4625 27.6125 26.4625 23.4625 28-29 22.85 27.5875 25.974999999999998 23.5875 30-31 23.875 28.125 25.85 22.15 32-33 23.6875 27.437499999999996 26.6625 22.2125 34-35 23.025000000000002 27.1125 25.874999999999996 23.9875 36-37 24.349999999999998 26.187500000000004 25.362499999999997 24.099999999999998 38-39 23.400000000000002 27.925 25.8125 22.8625 40-41 23.75 27.5625 25.3125 23.375 42-43 23.400000000000002 27.150000000000002 26.6125 22.8375 44-45 22.9375 27.5125 26.75 22.8 46-47 23.150000000000002 27.150000000000002 26.5375 23.1625 48-49 23.4125 26.937499999999996 26.5875 23.0625 50-51 23.2875 27.025 26.825 22.8625 52-53 23.925 27.3375 26.187500000000004 22.55 54-55 23.4625 27.275 26.3625 22.900000000000002 56-57 22.525000000000002 28.175 26.150000000000002 23.150000000000002 58-59 23.25 26.75 26.05 23.95 60-61 22.975 27.125 26.237500000000004 23.6625 62-63 24.5375 26.55 25.412499999999998 23.5 64-65 23.1 27.525 25.837500000000002 23.5375 66-67 23.962500000000002 26.375 26.7125 22.95 68-69 23.0 27.025 26.424999999999997 23.549999999999997 70-71 22.825 28.000000000000004 26.1625 23.0125 72-73 23.6625 26.6125 26.700000000000003 23.025000000000002 74-75 24.3 26.525 26.0 23.175 76-77 23.925 26.6125 26.5 22.9625 78-79 23.0875 26.55 26.6125 23.75 80-81 24.05 26.35 26.7125 22.8875 82-83 23.45 26.6125 26.4625 23.474999999999998 84-85 23.5875 26.637499999999996 26.1625 23.6125 86-87 22.5125 27.675 26.4125 23.400000000000002 88-89 23.549999999999997 26.937499999999996 26.237500000000004 23.275000000000002 90-91 22.7125 27.474999999999998 27.125 22.6875 92-93 23.45 27.462500000000002 26.700000000000003 22.3875 94-95 23.4375 28.050000000000004 25.7125 22.8 96-97 22.7 27.8375 26.437500000000004 23.025000000000002 98-99 23.375 27.1625 25.7 23.7625 100-101 23.45 26.950000000000003 26.375 23.225 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 2.0 14 2.5 15 2.0 16 3.5 17 4.0 18 3.5 19 4.0 20 3.5 21 1.5 22 2.0 23 4.0 24 4.5 25 5.0 26 4.5 27 3.5 28 8.5 29 12.0 30 16.5 31 22.0 32 29.0 33 41.0 34 45.5 35 55.0 36 77.5 37 98.5 38 129.0 39 157.0 40 175.0 41 185.0 42 201.5 43 219.0 44 217.5 45 215.5 46 215.0 47 202.5 48 192.0 49 176.0 50 159.0 51 133.0 52 104.5 53 98.0 54 100.5 55 97.0 56 82.5 57 59.5 58 40.0 59 41.0 60 36.0 61 29.0 62 22.5 63 22.0 64 25.0 65 27.0 66 25.0 67 19.5 68 16.5 69 17.0 70 18.5 71 18.5 72 15.0 73 9.0 74 10.5 75 13.0 76 9.5 77 4.0 78 2.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.95 #Duplication Level Percentage of deduplicated Percentage of total 1 97.4726420010422 93.525 2 1.9020323084940074 3.65 3 0.28660760812923397 0.8250000000000001 4 0.20844189682126105 0.8 5 0.0 0.0 6 0.05211047420531526 0.3 7 0.02605523710265763 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05211047420531526 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTGTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAAT 16 0.4 No Hit CTGAAACATGCAACAGGAGACAGGAACGACGACACTGGGACACATGAACA 13 0.325 No Hit CAGGAAGCTCGTGTTCGGGGAACGGGCCCAGGAGGCGGAGAAGCTCGTCC 7 0.17500000000000002 No Hit CTCGTTGAATAATTTTACATGTGTGTTCGTAAGTGTCTTAGCTAGGTAAC 6 0.15 No Hit GTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAATGCTGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844638 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844638_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.96875 34.0 31.0 34.0 28.0 34.0 2 32.28175 34.0 31.0 34.0 29.0 34.0 3 32.441 34.0 31.0 34.0 29.0 34.0 4 35.895 37.0 37.0 37.0 33.0 37.0 5 35.73825 37.0 37.0 37.0 33.0 37.0 6 35.7705 37.0 37.0 37.0 33.0 37.0 7 35.80775 37.0 37.0 37.0 33.0 37.0 8 35.38225 37.0 36.0 37.0 33.0 37.0 9 37.1645 39.0 39.0 39.0 34.0 39.0 10-11 36.671875 39.0 39.0 39.0 33.5 39.0 12-13 36.263 39.0 38.0 39.0 32.5 39.0 14-15 37.62075 41.0 39.5 41.0 33.0 41.0 16-17 37.478125 41.0 39.0 41.0 32.0 41.0 18-19 37.467375000000004 41.0 39.0 41.0 31.5 41.0 20-21 37.215375 41.0 39.0 41.0 31.5 41.0 22-23 36.82 41.0 39.0 41.0 30.0 41.0 24-25 36.169124999999994 40.5 38.0 41.0 26.0 41.0 26-27 36.5115 41.0 38.5 41.0 28.0 41.0 28-29 36.51575 41.0 38.0 41.0 29.0 41.0 30-31 36.385374999999996 41.0 38.0 41.0 30.0 41.0 32-33 36.188625 40.0 38.0 41.0 29.5 41.0 34-35 36.071875 40.0 38.0 41.0 27.5 41.0 36-37 35.806625 40.0 38.0 41.0 26.5 41.0 38-39 35.503125 40.0 37.0 41.0 23.0 41.0 40-41 34.89625 40.0 36.5 41.0 2.0 41.0 42-43 34.836124999999996 40.0 36.5 41.0 2.0 41.0 44-45 34.306625 40.0 35.0 41.0 4.5 41.0 46-47 34.3125 40.0 35.0 41.0 2.0 41.0 48-49 34.4625 40.0 35.5 41.0 2.0 41.0 50-51 34.066625 39.0 35.0 40.5 2.0 40.5 52-53 34.121624999999995 39.0 35.0 40.5 2.0 41.0 54-55 34.54575 39.5 35.0 41.0 2.0 41.0 56-57 34.287875 39.0 35.0 41.0 2.0 41.0 58-59 34.30325 39.0 35.0 41.0 2.0 41.0 60-61 34.237125 39.0 35.0 41.0 2.0 41.0 62-63 34.073875 39.0 35.0 41.0 2.0 41.0 64-65 33.805 37.5 35.0 41.0 2.0 41.0 66-67 33.22525 37.0 35.0 40.0 2.0 41.0 68-69 32.833875 36.5 35.0 39.5 2.0 41.0 70-71 32.105875 36.0 34.0 39.0 2.0 41.0 72-73 31.553125 35.0 34.0 39.0 2.0 40.5 74-75 31.166125 35.0 34.0 37.0 2.0 39.5 76-77 30.70625 35.0 33.5 37.0 2.0 39.0 78-79 30.4835 35.0 33.5 36.5 2.0 39.0 80-81 30.099625 35.0 33.0 36.0 2.0 37.0 82-83 29.6485 35.0 32.5 35.5 2.0 37.0 84-85 24.9085 34.0 2.0 35.0 2.0 36.0 86-87 25.021875 34.0 3.5 35.0 2.0 36.0 88-89 25.308374999999998 34.0 10.5 35.0 2.0 35.5 90-91 25.824375 34.0 17.5 35.0 2.0 35.0 92-93 26.33725 34.0 21.5 35.0 2.0 35.0 94-95 26.4525 34.0 24.0 35.0 2.0 35.0 96-97 26.165999999999997 34.0 23.5 35.0 2.0 35.0 98-99 26.137375 34.0 23.5 35.0 2.0 35.0 100-101 24.5955 32.0 11.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 64.0 4 81.0 5 3.0 6 37.0 7 38.0 8 29.0 9 26.0 10 49.0 11 23.0 12 13.0 13 5.0 14 8.0 15 14.0 16 5.0 17 6.0 18 7.0 19 12.0 20 12.0 21 22.0 22 14.0 23 12.0 24 18.0 25 28.0 26 38.0 27 37.0 28 49.0 29 52.0 30 57.0 31 86.0 32 132.0 33 120.0 34 166.0 35 266.0 36 445.0 37 807.0 38 983.0 39 215.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.853566958698373 13.041301627033791 8.585732165206508 55.51939924906133 2 19.46946946946947 19.744744744744743 45.3953953953954 15.39039039039039 3 22.436218109054526 23.08654327163582 26.713356678339167 27.763881940970485 4 25.98149537384346 28.457114278569644 24.23105776444111 21.330332583145786 5 26.17197292554525 30.55903735271998 26.247179744296815 17.021809977437954 6 20.974999999999998 33.2 29.5 16.325 7 16.783391695847925 17.38369184592296 46.62331165582791 19.209604802401202 8 17.4930078820239 23.213831680650905 35.875921688278666 23.41723874904653 9 19.1467750126968 20.2133062468258 39.15693245302184 21.48298628745556 10-11 23.754045307443366 29.16504854368932 27.663430420711975 19.41747572815534 12-13 21.31083202511774 24.90842490842491 32.142857142857146 21.63788592360021 14-15 21.388045916347803 25.14843646919119 31.362976645995516 22.100540968465495 16-17 23.473932407649986 25.988996594183916 28.7267487555672 21.8103222425989 18-19 22.892508143322477 25.628664495114005 29.211726384364823 22.267100977198698 20-21 22.258485639686683 27.45430809399478 27.297650130548302 22.989556135770233 22-23 22.868013644712672 27.328785095775388 27.74862240881658 22.054578850695357 24-25 22.681359044995407 27.548209366391184 26.30198084743539 23.468450741178014 26-27 22.548132833699444 28.504974802946116 26.72179868200026 22.22509368135418 28-29 22.91747135316081 28.170464786919013 25.531093086133644 23.380970773786533 30-31 22.42811501597444 28.268370607028753 25.916932907348244 23.38658146964856 32-33 23.155183515775917 28.113329040566644 25.589182227945912 23.142305215711527 34-35 22.630906768837804 27.420178799489143 25.75989782886335 24.18901660280971 36-37 24.692622950819672 26.011782786885245 26.114241803278688 23.181352459016395 38-39 23.653670621984613 26.97874559916547 27.096101186595384 22.271482592254532 40-41 22.417231751096928 27.935115011301686 26.592208482914504 23.055444754686878 42-43 23.313373253493015 27.092481703260145 26.5602129075183 23.033932135728545 44-45 23.859465128474042 26.50760356581017 26.54693235448348 23.085998951232302 46-47 23.66706554979391 27.270309799228826 26.047068209014757 23.015556441962502 48-49 22.31438127090301 27.411371237458194 26.14046822742475 24.13377926421405 50-51 23.39097646599922 27.05759979196463 26.498504745806787 23.05291899622936 52-53 22.83958687410119 27.71604131258988 26.44790168649497 22.99647012681396 54-55 23.356899711966484 27.101335428122546 26.158680282796542 23.383084577114428 56-57 23.879231473010066 28.192393151222063 25.6829172657169 22.245458110050972 58-59 23.151419971207957 27.313178903284914 26.18767177071064 23.347729354796492 60-61 23.854741434620813 26.83177210316951 25.86936994738868 23.444116514820994 62-63 24.41541476159373 27.145656433703465 25.774003919007182 22.664924885695623 64-65 23.692509855453352 27.16162943495401 26.057818659658345 23.088042049934295 66-67 23.368337099561344 27.32952279675661 25.880632726305997 23.421507377376045 68-69 23.864836325237594 26.135163674762406 26.359556494192187 23.640443505807816 70-71 24.115281501340483 26.313672922252014 25.89812332439678 23.672922252010725 72-73 22.78925340893749 27.217496962332927 26.096935331443227 23.89631429728635 74-75 23.476726828606324 27.5885466141946 26.136517845026464 22.798208712172617 76-77 23.351424694708275 27.761194029850746 26.770691994572594 22.116689280868385 78-79 23.5947446837329 26.615197074360015 26.547473926588104 23.242584315318975 80-81 24.12420382165605 26.24734607218684 26.207537154989385 23.42091295116773 82-83 24.136592937524252 27.085758634070622 25.55943603673522 23.2182123916699 84-85 23.387096774193548 27.43516761543327 26.91334598355471 22.26438962681847 86-87 23.11495673671199 27.812113720642767 25.710754017305316 23.362175525339925 88-89 23.2078853046595 27.22520908004779 25.985663082437277 23.581242532855438 90-91 23.31288343558282 26.862401402278703 26.132047911189016 23.69266725094946 92-93 23.00961124659303 26.782384162960838 26.538516712092957 23.669487878353177 94-95 23.21072141431423 27.188480182492157 26.147704590818364 23.45309381237525 96-97 23.502432244614315 26.518415566365533 26.754690757470467 23.22446143154969 98-99 23.369185640452578 28.314010336639196 26.051124458723287 22.265679564184943 100-101 24.295283282165784 27.602567680714486 24.72788166341055 23.37426737370918 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 5.5 2 8.0 3 14.5 4 19.0 5 21.0 6 20.5 7 15.5 8 10.5 9 9.0 10 10.0 11 11.0 12 8.5 13 5.0 14 4.5 15 4.0 16 2.0 17 4.5 18 10.0 19 9.0 20 8.5 21 10.5 22 11.0 23 13.0 24 14.5 25 14.5 26 15.5 27 14.5 28 18.0 29 24.0 30 29.0 31 39.0 32 39.0 33 43.0 34 57.5 35 68.5 36 94.5 37 115.0 38 134.0 39 151.0 40 158.0 41 176.5 42 193.0 43 194.5 44 197.0 45 197.5 46 170.0 47 153.0 48 150.0 49 143.0 50 144.5 51 135.0 52 116.0 53 105.0 54 94.0 55 77.0 56 68.5 57 57.0 58 42.5 59 35.5 60 29.5 61 23.0 62 22.5 63 24.5 64 19.5 65 16.0 66 18.0 67 17.0 68 13.5 69 16.0 70 11.0 71 9.5 72 18.5 73 12.5 74 3.5 75 4.0 76 4.0 77 3.5 78 4.5 79 4.5 80 2.0 81 1.0 82 2.5 83 2.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.125 2 0.1 3 0.05 4 0.025 5 0.27499999999999997 6 0.0 7 0.05 8 1.675 9 1.55 10-11 3.4375000000000004 12-13 4.45 14-15 5.2625 16-17 4.575 18-19 4.0625 20-21 4.25 22-23 4.725 24-25 4.7125 26-27 3.2625 28-29 2.9125 30-31 2.1875 32-33 2.9375 34-35 2.125 36-37 2.4 38-39 4.1375 40-41 5.9875 42-43 6.0625 44-45 4.65 46-47 5.9875 48-49 6.5625 50-51 3.8625 52-53 4.387499999999999 54-55 4.5249999999999995 56-57 4.3625 58-59 4.4875 60-61 2.5875 62-63 4.3125 64-65 4.875 66-67 5.9624999999999995 68-69 5.3 70-71 6.75 72-73 7.4125 74-75 7.8875 76-77 7.875 78-79 7.7125 80-81 5.800000000000001 82-83 3.3625000000000003 84-85 20.95 86-87 19.1 88-89 16.3 90-91 14.424999999999999 92-93 12.862499999999999 94-95 12.325 96-97 10.0625 98-99 10.5125 100-101 10.424999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.6954945624029 94.325 2 1.6312791299844638 3.15 3 0.4401864319005696 1.275 4 0.12946659761781462 0.5 5 0.05178663904712584 0.25 6 0.02589331952356292 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02589331952356292 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTGTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAAT 14 0.35000000000000003 No Hit CCGTGTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAATG 6 0.15 No Hit CTGAAACATGCAACAGGAGACAGGAACGACGACACTGGGACACATGAACA 5 0.125 No Hit CTCGTGTTCGGGGAACGGGCCCAGGAGGCGGAGAAGCTCGTCCGTGGGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502910 spots for SRR13844638.sra Written 1502910 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra Read 1502901 spots for SRR13844638.sra Written 1502901 spots for SRR13844638.sra SRR ids: ['SRR13844638.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u1z34lar SRR13844638.sra spots: 30058029 blocks: [[1, 1502901], [1502902, 3005802], [3005803, 4508703], [4508704, 6011604], [6011605, 7514505], [7514506, 9017406], [9017407, 10520307], [10520308, 12023208], [12023209, 13526109], [13526110, 15029010], [15029011, 16531911], [16531912, 18034812], [18034813, 19537713], [19537714, 21040614], [21040615, 22543515], [22543516, 24046416], [24046417, 25549317], [25549318, 27052218], [27052219, 28555119], [28555120, 30058029]] SRR13844638 file size 7257978 SRR13844638 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844638 SRR13844638_1.fastq SRR13844638_2.fastq Input file: SRR13844638_1.fastq Paired file: SRR13844638_2.fastq trimmed: SRR13844638-trimmed-pair1.fastq, SRR13844638-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:48:44 2024 >> started Fri Dec 6 12:49:27 2024 >> done (42.463s) 30058029 read pairs processed; of these: 339622 ( 1.13%) short read pairs filtered out after trimming by size control 203560 ( 0.68%) empty read pairs filtered out after trimming by size control 29514847 (98.19%) read pairs available; of these: 6639546 (22.50%) trimmed read pairs available after processing 22875301 (77.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 100 0.00% 20 196 0.00% 21 311 0.00% 22 376 0.00% 23 469 0.00% 24 574 0.00% 25 653 0.00% 26 663 0.00% 27 886 0.00% 28 977 0.00% 29 1164 0.00% 30 1296 0.00% 31 1431 0.00% 32 1615 0.01% 33 1903 0.01% 34 2071 0.01% 35 2255 0.01% 36 2314 0.01% 37 2644 0.01% 38 2707 0.01% 39 2944 0.01% 40 3225 0.01% 41 3435 0.01% 42 3766 0.01% 43 4141 0.01% 44 4438 0.02% 45 4672 0.02% 46 5042 0.02% 47 5540 0.02% 48 5761 0.02% 49 6049 0.02% 50 6969 0.02% 51 7449 0.03% 52 8274 0.03% 53 9346 0.03% 54 10377 0.04% 55 11488 0.04% 56 13259 0.04% 57 14883 0.05% 58 17862 0.06% 59 178196 0.60% 60 231830 0.79% 61 240521 0.81% 62 274368 0.93% 63 231963 0.79% 64 159609 0.54% 65 107489 0.36% 66 78976 0.27% 67 64359 0.22% 68 57703 0.20% 69 56523 0.19% 70 53218 0.18% 71 50130 0.17% 72 49769 0.17% 73 53455 0.18% 74 49283 0.17% 75 52644 0.18% 76 45263 0.15% 77 47544 0.16% 78 46958 0.16% 79 47063 0.16% 80 50094 0.17% 81 51910 0.18% 82 58719 0.20% 83 65713 0.22% 84 66299 0.22% 85 70067 0.24% 86 71354 0.24% 87 75657 0.26% 88 84164 0.29% 89 94404 0.32% 90 106496 0.36% 91 141601 0.48% 92 203946 0.69% 93 138620 0.47% 94 148535 0.50% 95 166045 0.56% 96 197893 0.67% 97 253558 0.86% 98 350373 1.19% 99 519841 1.76% 100 1373836 4.65% 101 22875301 77.50% 29514847 reads passed initial QC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=39 prefix-density=0.78 prefix-fanout=1.9 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=27.59 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.2 sequence=CCGCGGCGGCGACATGGAGACGTTCCTCCGGATGGCCACCGGAGTGCTGTGAGTGAGTGAAGCTAGCTGCCAGAGAGGGGCAGTGACGGCAGTGCGTGGCATTGTCGTTTGTGTGGTAGCGGACGTGCGCATGGGTGAGCTGTGAGCCAGAGCGGGTGAAAGAGTTTGGACTTGTGTGTGTAGTGAGTACTAGCGTAAATAAGTGCTGGCTCGATCTGTATGACGATGTAAGGTACCATGGCATGTGCCCGTTTATATAAATAAAAACAAGGGCGTTTTGCGCCTCTTCTCCGGT criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.71 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=37.85 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.8 sequence=TTTGTTGGTGAGAGCATGGGTGATGATGCCAGCGTGGTGTTTGCATACTACAAGGAAGGAGCCACTGACCCGACATTCCTGTATTTCGCGCATGGGCTTAAGGAGGTCAAGTGCTAAGCGCACTGTATGCTAAAACTATCAGTTGTCCGTATTTTTGATCTGGTCTGTGGTTGTCAGTAGACTCACCAATGTTGGTGGCGTAACTGTTATCAGATGTTGAGTGTCTTGGAAACTTT SRR13844638 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:50:02 Started mapping on | Dec 06 12:50:02 Finished on | Dec 06 12:51:30 Mapping speed, Million of reads per hour | 1207.43 Number of input reads | 29514847 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 28467913 Uniquely mapped reads % | 96.45% Average mapped length | 192.63 Number of splices: Total | 10628100 Number of splices: Annotated (sjdb) | 10017762 Number of splices: GT/AG | 10357898 Number of splices: GC/AG | 133301 Number of splices: AT/AC | 4975 Number of splices: Non-canonical | 131926 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.46% Deletion average length | 1.02 Insertion rate per base | 0.02% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 530725 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 4071 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.64% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1807971 1807971 1807971 N_multimapping 530725 530725 530725 N_noFeature 1065567 14514178 14493757 N_ambiguous 606189 42504 41054 UnstrandedReadsAssigned:26796157 PositiveStrandReadsAssigned:13911231 NegativeStrandReadsAssigned:13933102 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844638 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844638-trimmed-pair1.fastq SRR13844638-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,514,847 reads, 27,899,604 reads pseudoaligned [quant] estimated average fragment length: 172.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 SRR13844638.ke.tsv 35125 SRR13844638.se.tsv 88098 total ==> SRR13844638.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 764.995 0 0 PNS24247 1044 872.915 3.86096 0.205311 PNS24249 1928 1756.92 0 0 PNS24246 1044 872.915 3.86096 0.205311 PNS24248 1044 872.915 3.86096 0.205311 PNS24244 1471 1299.92 1494.42 53.3636 PNS24243 293 127.979 1 0.362702 KQK14069 1603 1431.92 9.36254 0.303504 KQK14071 474 303.922 0 0 ==> SRR13844638.se.tsv <== BRADI_1g14170v3 18 BRADI_1g53295v3 737 BRADI_1g59795v3 924 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 1692 BRADI_1g74790v3 11 BRADI_1g09890v3 0 BRADI_1g77505v3 998 BRADI_1g48960v3 2 SRR13844638 completed mapping pipeline successfully