Starting /dee2/code/volunteer_pipeline.sh SRR13844639 current disk space = 1551325630464 free memory = 1602202632 SRR13844639 SRAfilesize 232ae4644058e64fccbfea1bd56aceb2 SRR13844639.sra SRR13844639.sra file validated SRR13844639 is paired end SRR13844639 is conventional basespace SRR13844639 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844639_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0535 34.0 33.0 34.0 31.0 34.0 2 33.17175 34.0 33.0 34.0 31.0 34.0 3 33.169 34.0 33.0 34.0 31.0 34.0 4 36.4845 37.0 37.0 37.0 35.0 37.0 5 36.45675 37.0 37.0 37.0 35.0 37.0 6 36.4175 37.0 37.0 37.0 35.0 37.0 7 36.367 37.0 37.0 37.0 35.0 37.0 8 36.434 37.0 37.0 37.0 35.0 37.0 9 38.06275 39.0 39.0 39.0 37.0 39.0 10-11 38.28125 39.0 39.0 39.0 37.0 39.0 12-13 38.278499999999994 39.0 39.0 39.0 37.0 39.0 14-15 39.74625 41.0 40.0 41.0 38.0 41.0 16-17 39.729124999999996 41.0 40.0 41.0 37.5 41.0 18-19 39.803124999999994 41.0 40.0 41.0 37.5 41.0 20-21 39.761250000000004 41.0 40.0 41.0 37.5 41.0 22-23 39.61825 41.0 40.0 41.0 37.0 41.0 24-25 39.445875 41.0 40.0 41.0 37.0 41.0 26-27 39.199749999999995 41.0 40.0 41.0 37.0 41.0 28-29 38.9925 41.0 40.0 41.0 36.5 41.0 30-31 38.8575 41.0 39.5 41.0 36.0 41.0 32-33 38.8705 41.0 39.0 41.0 36.0 41.0 34-35 38.523625 41.0 39.0 41.0 35.0 41.0 36-37 38.463750000000005 40.5 38.5 41.0 35.0 41.0 38-39 38.335 40.0 38.5 41.0 35.0 41.0 40-41 38.409 40.0 38.5 41.0 35.0 41.0 42-43 38.296375 40.0 38.0 41.0 34.5 41.0 44-45 38.08225 40.0 38.0 41.0 34.0 41.0 46-47 38.1385 40.0 38.0 41.0 34.0 41.0 48-49 37.944375 40.0 38.0 41.0 34.0 41.0 50-51 37.898250000000004 40.0 38.0 41.0 33.5 41.0 52-53 37.855374999999995 40.0 38.0 41.0 34.0 41.0 54-55 37.545249999999996 40.0 37.0 41.0 33.0 41.0 56-57 37.395375 40.0 37.0 41.0 33.0 41.0 58-59 37.044375 39.5 36.0 41.0 32.5 41.0 60-61 36.990125 39.0 35.5 41.0 33.0 41.0 62-63 37.021625 39.0 35.5 41.0 33.0 41.0 64-65 36.7675 39.0 35.0 41.0 33.0 41.0 66-67 36.452124999999995 37.5 35.0 40.5 33.0 41.0 68-69 36.100625 37.0 35.0 40.0 33.0 41.0 70-71 35.741749999999996 36.5 35.0 39.0 32.5 41.0 72-73 35.142125 36.0 35.0 39.0 31.5 41.0 74-75 35.000375000000005 36.0 35.0 38.0 32.0 39.5 76-77 34.047250000000005 35.0 34.0 37.0 30.5 39.0 78-79 34.224125 35.0 35.0 37.0 31.5 39.0 80-81 34.085499999999996 35.0 35.0 36.0 31.5 38.0 82-83 33.930375 35.0 35.0 36.0 32.0 37.0 84-85 33.775999999999996 35.0 35.0 36.0 31.5 37.0 86-87 33.544250000000005 35.0 34.5 35.0 31.5 36.0 88-89 33.419624999999996 35.0 34.5 35.0 31.0 36.0 90-91 33.37625 35.0 35.0 35.0 32.0 36.0 92-93 33.25975 35.0 34.5 35.0 31.5 36.0 94-95 33.179625 35.0 34.0 35.0 31.0 36.0 96-97 33.038 35.0 34.0 35.0 31.0 35.0 98-99 32.898250000000004 35.0 34.0 35.0 31.0 35.0 100-101 31.73525 34.5 32.5 35.0 27.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 3.0 7 1.0 8 10.0 9 19.0 10 20.0 11 20.0 12 7.0 13 2.0 14 5.0 15 3.0 16 2.0 17 3.0 18 5.0 19 2.0 20 2.0 21 3.0 22 5.0 23 4.0 24 7.0 25 6.0 26 11.0 27 19.0 28 20.0 29 19.0 30 35.0 31 40.0 32 47.0 33 83.0 34 107.0 35 208.0 36 420.0 37 975.0 38 1515.0 39 372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.187093546773387 14.357178589294648 7.328664332166084 54.127063531765884 2 17.2 19.5 47.449999999999996 15.85 3 21.9 23.400000000000002 27.650000000000002 27.05 4 27.875 28.499999999999996 23.575 20.05 5 27.55 30.349999999999998 26.5 15.6 6 21.725 34.2 28.15 15.925 7 18.099999999999998 18.6 45.324999999999996 17.974999999999998 8 20.1 21.825 34.8 23.275000000000002 9 19.35 20.025000000000002 38.375 22.25 10-11 24.0 29.299999999999997 27.037499999999998 19.662499999999998 12-13 21.875 25.112499999999997 31.2625 21.75 14-15 21.5 25.9875 30.612499999999997 21.9 16-17 23.275000000000002 25.775 28.025 22.925 18-19 24.425 26.35 27.537499999999998 21.6875 20-21 22.075 26.924999999999997 28.5875 22.412499999999998 22-23 23.0 27.5125 27.8125 21.675 24-25 22.2625 26.6625 27.500000000000004 23.575 26-27 21.8625 27.6875 26.6 23.849999999999998 28-29 23.2375 27.375 26.05 23.3375 30-31 22.787499999999998 27.800000000000004 26.075 23.3375 32-33 22.7125 27.5125 27.275 22.5 34-35 22.787499999999998 28.475 26.174999999999997 22.5625 36-37 23.7 27.200000000000003 26.4125 22.6875 38-39 22.9875 26.775 27.375 22.8625 40-41 23.2875 27.474999999999998 27.05 22.1875 42-43 22.525000000000002 27.3875 26.875 23.2125 44-45 22.675 27.224999999999998 27.450000000000003 22.650000000000002 46-47 23.5 27.125 26.187500000000004 23.1875 48-49 24.212500000000002 26.387500000000003 26.05 23.35 50-51 21.987499999999997 26.5 27.8125 23.7 52-53 22.8 26.937499999999996 27.187499999999996 23.075000000000003 54-55 24.5375 26.724999999999998 26.187500000000004 22.55 56-57 23.35 27.925 26.2125 22.5125 58-59 22.3875 27.075 26.787499999999998 23.75 60-61 23.225 27.0 25.900000000000002 23.875 62-63 22.75 26.5125 27.525 23.2125 64-65 23.8125 25.874999999999996 26.8375 23.474999999999998 66-67 23.1625 27.1 26.8375 22.900000000000002 68-69 22.900000000000002 26.825 27.675 22.6 70-71 22.775000000000002 26.724999999999998 27.025 23.474999999999998 72-73 23.8125 26.724999999999998 26.424999999999997 23.0375 74-75 23.8125 26.900000000000002 27.2625 22.025 76-77 22.8375 26.900000000000002 27.437499999999996 22.825 78-79 22.675 26.8625 26.8125 23.65 80-81 22.95 26.650000000000002 27.3375 23.0625 82-83 23.2125 27.5125 26.387500000000003 22.8875 84-85 23.275000000000002 26.687499999999996 26.625 23.4125 86-87 21.712500000000002 27.3875 27.725 23.175 88-89 22.1875 27.775 26.9625 23.075000000000003 90-91 22.25 27.325 25.912499999999998 24.5125 92-93 22.825 26.400000000000002 27.487499999999997 23.2875 94-95 23.95 26.450000000000003 26.450000000000003 23.150000000000002 96-97 23.075000000000003 28.1625 25.2625 23.5 98-99 23.6625 26.737499999999997 26.5625 23.0375 100-101 23.4375 28.712500000000002 25.9625 21.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.5 9 1.5 10 1.0 11 1.0 12 1.0 13 2.5 14 3.5 15 1.5 16 0.5 17 1.0 18 1.5 19 0.5 20 1.0 21 3.0 22 3.5 23 4.0 24 2.5 25 1.0 26 3.0 27 9.0 28 10.0 29 9.5 30 17.0 31 20.5 32 25.0 33 35.5 34 39.5 35 50.5 36 77.0 37 106.0 38 125.5 39 152.5 40 181.5 41 202.0 42 225.5 43 231.5 44 219.0 45 223.0 46 225.5 47 209.0 48 193.5 49 178.5 50 164.5 51 147.5 52 117.5 53 88.5 54 79.5 55 82.5 56 81.5 57 67.5 58 50.5 59 40.0 60 29.0 61 21.0 62 20.0 63 21.5 64 22.0 65 18.5 66 22.0 67 22.0 68 14.0 69 10.5 70 10.5 71 11.0 72 14.5 73 12.5 74 8.0 75 6.5 76 4.5 77 5.0 78 3.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.22576497814349 95.5 2 1.3113911031113397 2.55 3 0.23142195937258936 0.675 4 0.10285420416559526 0.4 5 0.07714065312419646 0.375 6 0.0 0.0 7 0.0 0.0 8 0.025713551041398816 0.2 9 0.0 0.0 >10 0.025713551041398816 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTGTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAAT 12 0.3 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGC 8 0.2 TruSeq Adapter, Index 12 (100% over 50bp) CTTATTTATTGCGGTTTTTGACAACTTTTCTTCAGACATATGCTCATTGT 5 0.125 No Hit GTCCCGTGTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCA 5 0.125 No Hit CTGAAACATGCAACAGGAGACAGGAACGACGACACTGGGACACATGAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844639 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844639_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0445 34.0 31.0 34.0 28.0 34.0 2 32.295 34.0 31.0 34.0 29.0 34.0 3 32.48 34.0 31.0 34.0 30.0 34.0 4 35.90425 37.0 37.0 37.0 33.0 37.0 5 35.66875 37.0 37.0 37.0 33.0 37.0 6 35.76325 37.0 37.0 37.0 33.0 37.0 7 35.75025 37.0 37.0 37.0 33.0 37.0 8 35.374 37.0 37.0 37.0 33.0 37.0 9 37.2085 39.0 39.0 39.0 34.0 39.0 10-11 36.7695 39.0 39.0 39.0 34.0 39.0 12-13 36.4135 39.0 39.0 39.0 33.0 39.0 14-15 37.795500000000004 41.0 40.0 41.0 34.0 41.0 16-17 37.68875 41.0 39.5 41.0 33.0 41.0 18-19 37.722875 41.0 39.5 41.0 33.5 41.0 20-21 37.54575 41.0 40.0 41.0 33.0 41.0 22-23 37.19675 41.0 39.0 41.0 32.5 41.0 24-25 36.676125 41.0 38.0 41.0 30.0 41.0 26-27 36.971125 41.0 39.0 41.0 30.5 41.0 28-29 37.04174999999999 41.0 39.0 41.0 31.0 41.0 30-31 36.93675 41.0 38.5 41.0 30.0 41.0 32-33 36.7805 40.5 38.0 41.0 30.0 41.0 34-35 36.673375 40.0 38.0 41.0 30.0 41.0 36-37 36.40175 40.0 38.0 41.0 29.5 41.0 38-39 36.160375 40.0 38.0 41.0 29.0 41.0 40-41 35.60325 40.0 37.5 41.0 23.0 41.0 42-43 35.508250000000004 40.0 37.0 41.0 22.0 41.0 44-45 35.137 40.0 36.0 41.0 20.5 41.0 46-47 35.15325 40.0 36.5 41.0 22.0 41.0 48-49 35.332499999999996 40.0 37.0 41.0 21.5 41.0 50-51 34.897625 39.5 36.0 40.5 21.0 40.5 52-53 34.918499999999995 39.0 35.0 40.5 24.0 41.0 54-55 35.302125000000004 40.0 36.0 41.0 25.0 41.0 56-57 35.190875000000005 40.0 35.0 41.0 24.0 41.0 58-59 35.182 39.5 35.0 41.0 24.5 41.0 60-61 35.03875 39.0 35.0 41.0 25.0 41.0 62-63 34.851625 39.0 35.0 41.0 25.5 41.0 64-65 34.661 38.5 35.0 41.0 26.0 41.0 66-67 34.111125 37.0 35.0 40.5 21.0 41.0 68-69 33.802125000000004 37.0 35.0 40.0 15.5 41.0 70-71 33.093375 36.0 35.0 39.0 2.0 41.0 72-73 32.634125 36.0 35.0 39.0 2.0 41.0 74-75 32.340625 35.0 34.5 37.5 2.0 39.5 76-77 31.823749999999997 35.0 34.0 37.0 2.0 39.0 78-79 31.549374999999998 35.0 34.0 36.5 2.0 39.0 80-81 31.123125 35.0 34.0 36.0 2.0 37.0 82-83 30.701375 35.0 33.0 35.5 2.0 37.0 84-85 26.596 34.0 24.0 35.0 2.0 36.0 86-87 26.621625 34.0 24.0 35.0 2.0 36.0 88-89 26.76225 34.0 24.5 35.0 2.0 36.0 90-91 27.137375 34.0 26.5 35.0 2.0 35.0 92-93 27.495875 34.0 28.0 35.0 2.0 35.0 94-95 27.528125000000003 34.0 29.0 35.0 2.0 35.0 96-97 27.327375 34.0 27.5 35.0 2.0 35.0 98-99 27.36125 34.0 29.0 35.0 2.0 35.0 100-101 25.604750000000003 32.0 22.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 58.0 4 73.0 5 7.0 6 24.0 7 40.0 8 17.0 9 22.0 10 32.0 11 15.0 12 4.0 13 7.0 14 5.0 15 10.0 16 3.0 17 8.0 18 2.0 19 3.0 20 7.0 21 14.0 22 21.0 23 15.0 24 13.0 25 15.0 26 27.0 27 36.0 28 33.0 29 40.0 30 50.0 31 78.0 32 158.0 33 113.0 34 162.0 35 250.0 36 446.0 37 822.0 38 1116.0 39 226.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.542491852594637 12.985710704437203 7.244923539734269 55.226873903233894 2 18.286573146292582 19.564128256513026 47.16933867735471 14.979959919839681 3 22.68970698722765 22.96518908089156 27.147508139243676 27.197595792637113 4 26.107634543178975 28.46057571964956 23.379224030037545 22.052565707133915 5 25.67194172318513 30.821401657874908 27.530771163024365 15.975885455915598 6 20.75 32.975 27.425 18.85 7 17.806160781367392 17.330328074129728 46.706736789381424 18.156774355121463 8 19.02823708979903 21.54668023403714 36.4792673619944 22.945815314169423 9 20.218440436880876 19.964439928879855 38.557277114554225 21.25984251968504 10-11 24.120538023797206 30.082772891877912 26.409725814795653 19.38696326952923 12-13 22.94440093970243 24.667188723570867 31.453928478204123 20.93448185852258 14-15 22.324601816506515 25.66802685270502 30.275108595498224 21.732262735290245 16-17 22.617335599424763 26.47404889528043 29.101843378219378 21.806772127075437 18-19 23.27003121748179 26.886056191467222 27.679500520291363 22.164412070759624 20-21 22.827361563517915 26.710097719869708 27.986970684039086 22.475570032573287 22-23 22.89156626506024 26.70246202200105 27.383446830801468 23.022524882137244 24-25 23.90365231051185 26.757428982851156 26.443251734520224 22.895666972116768 26-27 23.11661506707946 27.05108359133127 26.702786377708975 23.129514963880286 28-29 23.014649190439478 27.422256489334362 26.008738113595477 23.554356206630686 30-31 23.347398030942333 27.362229893875462 26.441631504922647 22.848740570259558 32-33 23.181701362117707 27.422256489334362 26.741197635569264 22.65484451297867 34-35 22.904172514992982 26.795967844838586 26.987367615158863 23.312492025009572 36-37 23.99846409829771 25.931140407013952 27.198259311404072 22.87213618328427 38-39 23.769851601145536 26.386357719343923 26.56860192658162 23.275188752928923 40-41 23.622881355932204 27.277542372881356 26.17849576271186 22.921080508474574 42-43 22.9627666622499 26.858354312972043 26.699350735391548 23.47952828938651 44-45 23.809523809523807 27.237048665620094 26.295133437990582 22.658294086865517 46-47 22.470868644067796 28.61493644067797 25.728283898305083 23.185911016949152 48-49 22.662061636556853 27.776301806588737 25.664187035069077 23.897449521785337 50-51 23.2736240913811 26.804257528556597 26.869158878504674 23.05295950155763 52-53 23.549354544269136 27.161298735167556 26.209414526013823 23.079932194549485 54-55 24.104575163398692 27.124183006535947 26.496732026143793 22.274509803921568 56-57 22.109109892978335 27.734273035760896 27.186113286348213 22.970503784912555 58-59 22.981447609093284 27.162268095113667 26.339169061928402 23.517115233864647 60-61 22.839189535778402 27.77635291100282 26.596563221338805 22.78789433187997 62-63 23.813868613138688 26.903023983315954 25.951511991657977 23.33159541188738 64-65 22.78032786885246 27.59344262295082 26.62295081967213 23.00327868852459 66-67 23.452380952380953 27.6984126984127 26.058201058201057 22.79100529100529 68-69 23.228864893336844 26.90281801422175 26.125888859626023 23.742428232815378 70-71 22.664359861591695 27.468725046579717 26.17780143731701 23.68911365451158 72-73 23.461744248261102 26.457998929909042 26.819154628143394 23.261102193686465 74-75 23.573634044838233 27.775540340985366 26.29883205799436 22.351993556182038 76-77 23.35257012481546 27.76808482082942 25.392564756408536 23.486780297946584 78-79 23.727224008574492 27.491961414790993 25.844051446945336 22.936763129689176 80-81 22.87866772402855 27.755749405233942 26.011102299762097 23.354480570975415 82-83 23.001420637995608 27.586206896551722 26.565930517887125 22.846441947565545 84-85 23.628946970841515 27.919625321045476 24.91312887143073 23.538298836682277 86-87 23.558263971462544 27.645659928656364 25.980975029726515 22.81510107015458 88-89 23.19557625145518 27.313736903376018 26.557043073341095 22.933643771827704 90-91 23.114285714285714 27.900000000000002 26.285714285714285 22.7 92-93 22.968793927466965 27.776215912285636 26.820354231093617 22.43463592915378 94-95 22.86193404136389 27.990497484628285 26.15986584684181 22.987702627166016 96-97 23.674475955610358 26.92149609535553 25.784354021098782 23.619673927935334 98-99 23.348926802421573 27.655476059438634 26.19702806824436 22.798569069895432 100-101 24.74948524365134 27.343857240905972 25.77899794097461 22.127659574468083 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5.0 1 6.0 2 11.5 3 19.0 4 15.5 5 13.5 6 16.5 7 12.0 8 7.5 9 6.5 10 9.0 11 10.5 12 9.0 13 6.5 14 5.5 15 6.0 16 6.0 17 5.5 18 5.0 19 7.0 20 8.5 21 8.5 22 11.5 23 13.5 24 12.0 25 9.0 26 11.5 27 17.0 28 15.5 29 17.0 30 23.0 31 27.0 32 36.0 33 44.5 34 51.0 35 63.0 36 81.5 37 105.0 38 127.0 39 149.5 40 167.0 41 182.5 42 199.5 43 204.0 44 215.0 45 219.0 46 203.0 47 191.5 48 158.0 49 128.0 50 136.0 51 142.0 52 118.5 53 96.5 54 80.5 55 70.5 56 75.0 57 57.0 58 39.5 59 38.5 60 32.0 61 24.5 62 21.0 63 19.5 64 21.0 65 25.0 66 21.0 67 13.5 68 10.5 69 9.5 70 9.5 71 8.0 72 10.5 73 11.5 74 7.0 75 6.0 76 6.5 77 5.5 78 3.0 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.27499999999999997 2 0.2 3 0.17500000000000002 4 0.125 5 0.475 6 0.0 7 0.17500000000000002 8 1.725 9 1.575 10-11 3.35 12-13 4.2250000000000005 14-15 5.0375000000000005 16-17 4.387499999999999 18-19 3.9 20-21 4.0625 22-23 4.55 24-25 4.5125 26-27 3.1 28-29 2.725 30-31 2.2375 32-33 2.725 34-35 2.0375 36-37 2.3375 38-39 3.975 40-41 5.6000000000000005 42-43 5.6625000000000005 44-45 4.45 46-47 5.6000000000000005 48-49 5.8999999999999995 50-51 3.6999999999999997 52-53 4.1375 54-55 4.375 56-57 4.2250000000000005 58-59 4.324999999999999 60-61 2.5250000000000004 62-63 4.1000000000000005 64-65 4.6875 66-67 5.5 68-69 5.075 70-71 6.075 72-73 6.550000000000001 74-75 6.8875 76-77 6.862500000000001 78-79 6.7 80-81 5.425 82-83 3.2125 84-85 17.2625 86-87 15.9 88-89 14.099999999999998 90-91 12.5 92-93 11.075 94-95 10.549999999999999 96-97 8.7625 98-99 9.15 100-101 8.9375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44029659933521 96.25 2 1.2784454103809768 2.5 3 0.1534134492457172 0.44999999999999996 4 0.0767067246228586 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025568908207619537 0.22499999999999998 >10 0.025568908207619537 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTGTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAAT 11 0.27499999999999997 No Hit GTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAATGCTGT 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 20 0.0024766352 66.87187 1 >>END_MODULE Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271243 spots for SRR13844639.sra Written 1271243 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra Read 1271238 spots for SRR13844639.sra Written 1271238 spots for SRR13844639.sra SRR ids: ['SRR13844639.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gehlxjke SRR13844639.sra spots: 25424765 blocks: [[1, 1271238], [1271239, 2542476], [2542477, 3813714], [3813715, 5084952], [5084953, 6356190], [6356191, 7627428], [7627429, 8898666], [8898667, 10169904], [10169905, 11441142], [11441143, 12712380], [12712381, 13983618], [13983619, 15254856], [15254857, 16526094], [16526095, 17797332], [17797333, 19068570], [19068571, 20339808], [20339809, 21611046], [21611047, 22882284], [22882285, 24153522], [24153523, 25424765]] SRR13844639 file size 6135859 SRR13844639 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844639 SRR13844639_1.fastq SRR13844639_2.fastq Input file: SRR13844639_1.fastq Paired file: SRR13844639_2.fastq trimmed: SRR13844639-trimmed-pair1.fastq, SRR13844639-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:48:00 2024 >> started Fri Dec 6 12:48:38 2024 >> done (37.876s) 25424765 read pairs processed; of these: 241292 ( 0.95%) short read pairs filtered out after trimming by size control 195468 ( 0.77%) empty read pairs filtered out after trimming by size control 24988005 (98.28%) read pairs available; of these: 5113027 (20.46%) trimmed read pairs available after processing 19874978 (79.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 46 0.00% 20 109 0.00% 21 170 0.00% 22 252 0.00% 23 310 0.00% 24 338 0.00% 25 402 0.00% 26 497 0.00% 27 535 0.00% 28 646 0.00% 29 766 0.00% 30 864 0.00% 31 962 0.00% 32 1144 0.00% 33 1268 0.01% 34 1461 0.01% 35 1528 0.01% 36 1671 0.01% 37 1842 0.01% 38 1978 0.01% 39 2131 0.01% 40 2312 0.01% 41 2607 0.01% 42 2684 0.01% 43 3108 0.01% 44 3087 0.01% 45 3426 0.01% 46 3818 0.02% 47 4090 0.02% 48 4262 0.02% 49 4531 0.02% 50 4879 0.02% 51 5489 0.02% 52 6122 0.02% 53 6794 0.03% 54 7391 0.03% 55 8298 0.03% 56 9509 0.04% 57 10762 0.04% 58 12845 0.05% 59 115831 0.46% 60 150340 0.60% 61 154854 0.62% 62 175131 0.70% 63 148011 0.59% 64 101380 0.41% 65 70254 0.28% 66 53224 0.21% 67 44784 0.18% 68 41671 0.17% 69 42086 0.17% 70 39081 0.16% 71 37277 0.15% 72 37492 0.15% 73 40069 0.16% 74 37561 0.15% 75 40326 0.16% 76 34308 0.14% 77 36407 0.15% 78 36487 0.15% 79 37230 0.15% 80 39326 0.16% 81 41769 0.17% 82 46422 0.19% 83 51394 0.21% 84 53456 0.21% 85 56310 0.23% 86 57829 0.23% 87 60883 0.24% 88 67834 0.27% 89 76321 0.31% 90 85792 0.34% 91 112512 0.45% 92 166637 0.67% 93 111751 0.45% 94 118466 0.47% 95 133536 0.53% 96 159936 0.64% 97 206918 0.83% 98 285863 1.14% 99 427753 1.71% 100 1153565 4.62% 101 19874978 79.54% 24988005 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=36 prefix-density=0.34 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=71.84 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=4.3 sequence=GAGAAGGTGGTCGGAGGAGCGAAGGAAGGCAGGGAGTACAAGCCTGAGTGAGCGGGCTGGTCTGACACGTTGCAAGTCTCCGAGCGTTGGGGAGTTTTGGGTCCTCCTGCATTTCGATCCTTTGCTTTAGCTAGACACGTTATAAAGGTGTCCTACTTAAGTACCCATGGAGTGTTTTCAGATCGCTAGAATAATAATGTCCGTGTATGATGTTTCTCTATGTACCTAAAGACTAGGTTGTGGTGCCTGATGATGAAGGTACGTGCTAGGAATGAGATGGTGGTGTACATACTAAAGTTGTGCTATGTGTTTGTGTTTAGCTCTGTCGAATAATGTTTGTACATGATCTTTCTGCTAGTGATGAAACT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=38 prefix-density=0.69 prefix-fanout=1.0 sequence=GCATGGGTTCAGTCAGACGTAGTTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=61.87 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.6 sequence=GAGAAGGTGGTCGGAGGAGCGAAGGAAGGCAGGGAGTACAAGCCTGAGTGAGCGGGCTGGTCTGACACGTTGCAAGTCTCCGAGCGTTGGGGAGTTTTGGGTCCTCCTGCATTTCGATCCTTTGCTTTAGCTAGACACGTTATAAAGGTGTCCTACTTAAGTACCCATGGAGTGTTTTCAGATCGCTAGAATAATAATGTCCGTGTATGATGTTTCTCTATGTACCTAAAGACTAGGTTGTGGTGCCTGATGATGAAGGTACGTGCTAGGAATGAGATGGTGGTGTACATACT SRR13844639 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:49:55 Started mapping on | Dec 06 12:49:55 Finished on | Dec 06 12:51:07 Mapping speed, Million of reads per hour | 1249.40 Number of input reads | 24988005 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 24078983 Uniquely mapped reads % | 96.36% Average mapped length | 194.14 Number of splices: Total | 11050752 Number of splices: Annotated (sjdb) | 10462376 Number of splices: GT/AG | 10791480 Number of splices: GC/AG | 145651 Number of splices: AT/AC | 5249 Number of splices: Non-canonical | 108372 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.46% Deletion average length | 1.02 Insertion rate per base | 0.02% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453854 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 4921 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.63% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1260492 1260492 1260492 N_multimapping 453854 453854 453854 N_noFeature 892660 12339445 12192276 N_ambiguous 501621 32493 31925 UnstrandedReadsAssigned:22684702 PositiveStrandReadsAssigned:11707045 NegativeStrandReadsAssigned:11854782 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844639 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844639-trimmed-pair1.fastq SRR13844639-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,988,005 reads, 23,606,807 reads pseudoaligned [quant] estimated average fragment length: 171.342 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR13844639.ke.tsv 35125 SRR13844639.se.tsv 88098 total ==> SRR13844639.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 765.736 0 0 PNS24247 1044 873.658 14.9167 1.01601 PNS24249 1928 1757.66 3.76826 0.127576 PNS24246 1044 873.658 14.9167 1.01601 PNS24248 1044 873.658 14.9167 1.01601 PNS24244 1471 1300.66 1102.48 50.4397 PNS24243 293 128.032 0 0 KQK14069 1603 1432.66 167.874 6.97277 KQK14071 474 304.47 8.4181 1.64525 ==> SRR13844639.se.tsv <== BRADI_1g14170v3 274 BRADI_1g53295v3 1359 BRADI_1g59795v3 780 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 889 BRADI_1g74790v3 0 BRADI_1g09890v3 0 BRADI_1g77505v3 748 BRADI_1g48960v3 0 SRR13844639 completed mapping pipeline successfully