Starting /dee2/code/volunteer_pipeline.sh SRR13844640 current disk space = 1551325630464 free memory = 1602208504 SRR13844640 SRAfilesize 7da2a3c2b2881d4723a7a9671b7e0f9c SRR13844640.sra SRR13844640.sra file validated SRR13844640 is paired end SRR13844640 is conventional basespace SRR13844640 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844640_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94175 34.0 33.0 34.0 31.0 34.0 2 33.084 34.0 33.0 34.0 31.0 34.0 3 33.08975 34.0 33.0 34.0 31.0 34.0 4 36.3055 37.0 37.0 37.0 35.0 37.0 5 36.30175 37.0 37.0 37.0 35.0 37.0 6 36.314 37.0 37.0 37.0 35.0 37.0 7 36.32 37.0 37.0 37.0 35.0 37.0 8 36.3385 37.0 37.0 37.0 35.0 37.0 9 37.97925 39.0 39.0 39.0 35.0 39.0 10-11 38.247625 39.0 39.0 39.0 37.0 39.0 12-13 38.235749999999996 39.0 39.0 39.0 37.0 39.0 14-15 39.672875 41.0 40.0 41.0 37.0 41.0 16-17 39.68625 41.0 40.0 41.0 37.0 41.0 18-19 39.702875000000006 41.0 40.0 41.0 37.0 41.0 20-21 39.694375 41.0 40.0 41.0 37.0 41.0 22-23 39.5025 41.0 40.0 41.0 36.5 41.0 24-25 39.3575 41.0 40.0 41.0 37.0 41.0 26-27 39.077375 41.0 39.5 41.0 36.0 41.0 28-29 38.829875 41.0 39.0 41.0 36.0 41.0 30-31 38.737875 41.0 39.0 41.0 35.5 41.0 32-33 38.782 41.0 39.0 41.0 36.0 41.0 34-35 38.406 40.5 38.5 41.0 35.0 41.0 36-37 38.37775 40.0 38.5 41.0 34.5 41.0 38-39 38.33275 40.0 39.0 41.0 35.0 41.0 40-41 38.408375 40.5 38.5 41.0 35.0 41.0 42-43 38.159625 40.0 38.0 41.0 35.0 41.0 44-45 37.872 40.0 38.0 41.0 33.5 41.0 46-47 38.022375 40.0 38.0 41.0 34.0 41.0 48-49 37.954 40.0 38.0 41.0 34.0 41.0 50-51 37.829875 40.0 38.0 41.0 33.5 41.0 52-53 37.74125 40.0 38.0 41.0 33.0 41.0 54-55 37.433 40.0 37.0 41.0 33.0 41.0 56-57 37.323750000000004 40.0 37.0 41.0 33.0 41.0 58-59 37.014250000000004 39.5 36.0 41.0 32.5 41.0 60-61 36.84375 39.0 36.0 41.0 32.0 41.0 62-63 36.913875000000004 39.0 36.0 41.0 33.0 41.0 64-65 36.750375000000005 39.0 35.0 41.0 33.0 41.0 66-67 36.471625 38.5 35.0 41.0 33.0 41.0 68-69 36.113875 37.0 35.0 40.0 33.0 41.0 70-71 35.712125 37.0 35.0 39.0 32.5 41.0 72-73 35.049375 36.0 35.0 39.0 31.0 41.0 74-75 34.8675 36.0 35.0 38.5 32.0 40.0 76-77 33.921625 35.0 34.0 37.0 30.5 39.0 78-79 34.11775 35.0 35.0 37.0 31.5 39.0 80-81 33.97425 35.0 35.0 36.0 31.0 38.0 82-83 33.812 35.0 35.0 36.0 31.5 37.0 84-85 33.651125 35.0 35.0 36.0 32.0 37.0 86-87 33.3935 35.0 34.5 35.0 31.0 36.5 88-89 33.220124999999996 35.0 34.0 35.0 31.0 36.0 90-91 33.154624999999996 35.0 34.5 35.0 31.0 36.0 92-93 33.052875 35.0 34.0 35.0 31.0 36.0 94-95 33.005250000000004 35.0 34.5 35.0 31.0 36.0 96-97 32.900999999999996 35.0 34.0 35.0 31.0 35.5 98-99 32.716125 35.0 34.0 35.0 31.0 35.0 100-101 31.52375 34.5 32.5 35.0 26.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 10.0 9 20.0 10 26.0 11 20.0 12 5.0 13 4.0 14 6.0 15 2.0 16 3.0 17 1.0 18 6.0 19 2.0 20 10.0 21 3.0 22 4.0 23 7.0 24 9.0 25 8.0 26 16.0 27 18.0 28 19.0 29 30.0 30 24.0 31 48.0 32 58.0 33 79.0 34 110.0 35 187.0 36 374.0 37 1002.0 38 1526.0 39 360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.36168084042021 12.831415707853926 13.206603301650826 50.60030015007504 2 19.875 20.775 40.949999999999996 18.4 3 23.875 22.875 25.974999999999998 27.275 4 27.675 27.375 22.325 22.625 5 27.075 30.2 27.0 15.725 6 21.375 33.550000000000004 28.475 16.6 7 19.85 16.400000000000002 45.95 17.8 8 20.349999999999998 21.85 35.375 22.425 9 20.525 19.875 39.15 20.45 10-11 23.724999999999998 31.112499999999997 26.200000000000003 18.9625 12-13 21.712500000000002 25.337500000000002 32.4 20.549999999999997 14-15 21.337500000000002 27.962500000000002 29.775000000000002 20.925 16-17 22.6875 26.8625 28.725 21.725 18-19 22.8 26.8375 29.3375 21.025 20-21 22.475 26.5125 29.4375 21.575 22-23 22.6 27.925 29.075 20.4 24-25 22.425 27.962500000000002 27.750000000000004 21.8625 26-27 21.637500000000003 27.725 27.8625 22.775000000000002 28-29 23.400000000000002 28.812500000000004 26.9125 20.875 30-31 22.912499999999998 28.0875 26.974999999999998 22.025 32-33 23.525 27.775 27.150000000000002 21.55 34-35 22.4625 28.075 27.3 22.162499999999998 36-37 21.825 28.9375 27.725 21.512500000000003 38-39 22.625 27.925 27.187499999999996 22.2625 40-41 22.4875 27.55 27.325 22.6375 42-43 22.8125 27.8375 27.325 22.025 44-45 22.8 27.6375 28.262500000000003 21.3 46-47 21.575 28.537499999999998 27.425 22.4625 48-49 22.25 28.1 26.937499999999996 22.7125 50-51 21.7 28.3625 27.8625 22.075 52-53 21.9625 28.6875 27.125 22.225 54-55 21.4875 28.212500000000002 27.575 22.725 56-57 22.6875 26.387500000000003 28.712500000000002 22.2125 58-59 22.900000000000002 27.725 27.1375 22.237499999999997 60-61 22.1375 28.475 27.125 22.2625 62-63 21.9625 28.5875 26.700000000000003 22.75 64-65 22.287499999999998 27.650000000000002 27.775 22.287499999999998 66-67 22.400000000000002 27.825 27.3125 22.4625 68-69 23.075000000000003 28.262500000000003 27.200000000000003 21.462500000000002 70-71 23.724999999999998 27.525 26.85 21.9 72-73 22.0875 28.8875 26.674999999999997 22.35 74-75 22.900000000000002 27.5625 27.2625 22.275 76-77 22.9875 28.262500000000003 27.1625 21.587500000000002 78-79 21.8875 28.000000000000004 28.15 21.9625 80-81 22.5125 27.800000000000004 27.375 22.3125 82-83 22.5 27.425 27.675 22.400000000000002 84-85 23.0 27.875 26.5375 22.5875 86-87 21.725 29.2 27.375 21.7 88-89 23.525 27.275 26.900000000000002 22.3 90-91 22.525000000000002 28.325 27.3625 21.7875 92-93 22.537499999999998 28.512500000000003 27.037499999999998 21.912499999999998 94-95 22.575 28.175 27.325 21.925 96-97 21.987499999999997 28.075 26.950000000000003 22.9875 98-99 22.662499999999998 28.237499999999997 27.250000000000004 21.85 100-101 22.175 29.049999999999997 26.55 22.225 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.5 14 2.0 15 3.5 16 3.0 17 2.0 18 4.0 19 4.0 20 3.5 21 3.5 22 5.5 23 6.0 24 3.5 25 5.5 26 6.5 27 9.0 28 12.0 29 13.0 30 14.5 31 18.0 32 30.5 33 46.0 34 69.0 35 84.5 36 104.0 37 139.5 38 160.0 39 174.5 40 201.5 41 224.5 42 232.5 43 244.0 44 233.0 45 198.0 46 185.0 47 175.0 48 166.5 49 165.5 50 144.0 51 124.0 52 117.5 53 99.5 54 83.0 55 71.5 56 60.0 57 53.0 58 47.5 59 38.0 60 30.5 61 28.0 62 21.0 63 20.5 64 22.0 65 16.0 66 8.5 67 8.0 68 9.0 69 7.0 70 5.0 71 3.5 72 4.5 73 4.5 74 4.0 75 3.5 76 2.5 77 2.5 78 2.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41715598672454 96.375 2 1.404135818228236 2.75 3 0.051059484299208584 0.15 4 0.051059484299208584 0.2 5 0.025529742149604292 0.125 6 0.0 0.0 7 0.025529742149604292 0.17500000000000002 8 0.0 0.0 9 0.025529742149604292 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 19 (97% over 40bp) GCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit GGCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844640 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844640_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.179 34.0 31.0 34.0 30.0 34.0 2 32.4665 34.0 31.0 34.0 30.0 34.0 3 32.62575 34.0 31.0 34.0 30.0 34.0 4 35.98525 37.0 37.0 37.0 35.0 37.0 5 35.8305 37.0 37.0 37.0 33.0 37.0 6 35.894 37.0 37.0 37.0 35.0 37.0 7 35.86475 37.0 37.0 37.0 35.0 37.0 8 35.60625 37.0 37.0 37.0 35.0 37.0 9 37.47175 39.0 39.0 39.0 35.0 39.0 10-11 37.104124999999996 39.0 39.0 39.0 35.0 39.0 12-13 36.78825 39.0 39.0 39.0 35.0 39.0 14-15 38.222875 41.0 40.0 41.0 35.5 41.0 16-17 38.055625 41.0 39.5 41.0 34.5 41.0 18-19 38.053 41.0 40.0 41.0 34.5 41.0 20-21 37.85725 41.0 40.0 41.0 34.0 41.0 22-23 37.5975 41.0 40.0 41.0 33.5 41.0 24-25 37.024125 41.0 38.5 41.0 31.0 41.0 26-27 37.226 41.0 39.0 41.0 31.5 41.0 28-29 37.23325 41.0 39.0 41.0 31.5 41.0 30-31 37.079499999999996 41.0 39.0 41.0 30.5 41.0 32-33 36.974999999999994 41.0 39.0 41.0 30.0 41.0 34-35 36.829499999999996 41.0 38.0 41.0 30.0 41.0 36-37 36.59875 40.0 38.0 41.0 30.0 41.0 38-39 36.417875 40.0 38.0 41.0 30.0 41.0 40-41 35.995374999999996 40.0 38.0 41.0 27.5 41.0 42-43 35.797375 40.0 38.0 41.0 25.0 41.0 44-45 35.373125 40.0 37.0 41.0 22.0 41.0 46-47 35.390375 40.0 37.0 41.0 21.5 41.0 48-49 35.62075 40.0 37.5 41.0 23.0 41.0 50-51 35.212625 39.5 36.5 40.5 23.5 41.0 52-53 35.213750000000005 39.5 36.0 40.5 25.5 41.0 54-55 35.642125 40.0 37.0 41.0 26.5 41.0 56-57 35.462125 40.0 36.0 41.0 25.5 41.0 58-59 35.42175 40.0 36.0 41.0 24.5 41.0 60-61 35.2975 39.5 35.5 41.0 26.5 41.0 62-63 35.095625 39.0 35.0 41.0 25.0 41.0 64-65 34.926874999999995 39.0 35.0 41.0 26.0 41.0 66-67 34.397999999999996 38.0 35.0 41.0 21.5 41.0 68-69 34.047625 37.0 35.0 40.0 19.0 41.0 70-71 33.460125000000005 37.0 35.0 39.0 6.0 41.0 72-73 32.960499999999996 36.0 35.0 39.0 2.0 41.0 74-75 32.495625000000004 36.0 35.0 38.0 2.0 40.0 76-77 32.09525 35.0 34.0 37.0 2.0 39.0 78-79 31.84375 35.0 34.0 37.0 2.0 39.0 80-81 31.37575 35.0 34.0 36.0 2.0 38.0 82-83 30.915374999999997 35.0 33.5 36.0 2.0 37.0 84-85 27.470999999999997 34.0 27.5 35.0 2.0 36.0 86-87 27.505625000000002 34.5 28.0 35.0 2.0 36.0 88-89 27.547625 34.0 28.0 35.0 2.0 36.0 90-91 27.788625 34.5 29.0 35.0 2.0 36.0 92-93 28.07625 35.0 29.5 35.0 2.0 35.0 94-95 28.0875 34.5 29.5 35.0 2.0 35.0 96-97 27.876125000000002 34.0 29.0 35.0 2.0 35.0 98-99 27.968375 34.5 30.0 35.0 2.0 35.0 100-101 26.3095 32.5 24.5 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 45.0 4 53.0 5 4.0 6 25.0 7 42.0 8 27.0 9 18.0 10 44.0 11 17.0 12 7.0 13 3.0 14 6.0 15 4.0 16 3.0 17 6.0 18 4.0 19 9.0 20 9.0 21 23.0 22 22.0 23 14.0 24 14.0 25 13.0 26 21.0 27 31.0 28 35.0 29 29.0 30 46.0 31 92.0 32 107.0 33 91.0 34 131.0 35 231.0 36 381.0 37 822.0 38 1277.0 39 267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.386579869804706 12.018027040560842 12.819228843264895 50.77616424636956 2 20.100125156445557 20.550688360450565 40.200250312891114 19.148936170212767 3 24.0990990990991 22.47247247247247 27.3023023023023 26.126126126126124 4 28.103103103103106 26.676676676676674 22.94794794794795 22.27227227227227 5 26.710097719869708 28.589325983462793 28.238536707592083 16.46203958907542 6 22.575 32.425 27.975 17.025000000000002 7 17.86786786786787 17.167167167167165 47.32232232232232 17.64264264264264 8 18.427704752275027 23.281092012133467 36.627906976744185 21.66329625884732 9 20.060636685194545 20.060636685194545 38.90853966649823 20.970186963112685 10-11 22.069937235814013 30.882541309081596 27.70590495708979 19.341616498014602 12-13 20.688765639107444 25.91254998065265 32.03921062814394 21.359473752095962 14-15 21.139371917985986 27.39423825590449 31.300285491824553 20.166104334284974 16-17 21.711036443525458 26.880330834841043 30.201602481261308 21.20703024037219 18-19 22.463674938922466 26.205477690626207 30.101581586730102 21.229265783721228 20-21 21.832710400824848 27.59376208274262 29.269235726253385 21.304291790179146 22-23 22.769588828549264 27.46314972847168 28.34238427721748 21.424877165761572 24-25 22.146089204912734 28.04137039431157 27.653522947640596 22.1590174531351 26-27 22.44064334950217 28.223129946387544 27.406178197600205 21.930048506510083 28-29 21.993127147766323 29.133256968308512 26.25684103347334 22.616774850451826 30-31 22.67714539231842 27.443275446824693 28.051717581442514 21.827861579414375 32-33 22.036919159770846 28.796944621260344 27.027371101209418 22.13876511775939 34-35 22.244742842665318 28.464656701292117 27.425893083354445 21.864707372688116 36-37 22.542545085090172 28.143256286512575 27.343154686309372 21.971043942087885 38-39 21.867353509336766 27.533805537669025 28.396651641983254 22.202189311010947 40-41 21.426704990854457 27.985367128298925 27.515024823621637 23.07290305722498 42-43 22.573894846978813 28.341616531519747 27.243002877321477 21.841485744179963 44-45 22.058633604546042 28.399845021309574 26.527185845279604 23.014335528864784 46-47 21.275483533716674 28.175640355462622 27.509147935180344 23.039728175640356 48-49 22.29650019661817 27.51343557478044 27.290601651592606 22.899462577008784 50-51 22.31341369581944 28.443190561682485 27.737881508078992 21.50551423441908 52-53 22.275248290984134 27.80859022313943 28.143944279633693 21.772217206242743 54-55 22.926074054960647 27.84156882982841 27.99638756289511 21.23596955231583 56-57 22.057496454815006 28.451721026169913 27.227020755446695 22.26376176356839 58-59 22.377260981912144 28.010335917312663 26.976744186046513 22.635658914728683 60-61 22.294289711306117 28.004578405188855 27.07617957522574 22.624952308279283 62-63 21.765463917525775 29.239690721649485 27.33247422680412 21.66237113402062 64-65 21.858418532418792 28.096285751261806 27.5397955221949 22.505500194124497 66-67 22.075718015665796 28.10704960835509 27.12793733681462 22.68929503916449 68-69 22.74499610085781 28.25578372757993 27.177021055367817 21.822199116194437 70-71 21.765940697979534 27.77486224088166 27.289425347677778 23.169771713461035 72-73 21.82848109603478 28.626004478988275 27.348175470952444 22.197338954024502 74-75 22.41766962042058 28.54119825419918 27.033461182383284 22.007670942996956 76-77 22.492401215805472 27.276331439143647 27.263116162283602 22.96815118276728 78-79 22.40855671464413 28.35071966195695 27.149082265944802 22.091641357454115 80-81 22.740904941974183 28.686921371756423 26.70491589516234 21.867257791107054 82-83 22.156837661506973 27.18434181911219 27.478572342330814 23.180248177050018 84-85 22.272265000726428 27.72047072497458 27.778584919366555 22.228679354932442 86-87 21.90914318573893 27.386428982173662 28.004600345025878 22.69982748706153 88-89 22.856335640627208 26.86820172340726 27.800536798982904 22.474925836982624 90-91 21.981079577072897 28.728436282693377 27.19810795770729 22.092376182526433 92-93 23.081147878621447 28.03789647123438 27.365096800768914 21.515858849375256 94-95 22.03830369357045 28.782489740082077 27.099863201094394 22.07934336525308 96-97 22.177310697925087 28.563729452977633 27.18943680948531 22.069523039611965 98-99 22.76225192385581 28.14904819765087 27.20399621979209 21.88470365870123 100-101 21.54323485768245 28.665857277755297 27.181977606906788 22.608930257655473 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 5.0 2 7.5 3 9.5 4 12.5 5 9.5 6 8.0 7 9.0 8 9.5 9 10.0 10 7.0 11 6.5 12 7.0 13 7.0 14 7.5 15 4.5 16 3.5 17 4.5 18 7.0 19 9.0 20 12.0 21 12.5 22 10.5 23 12.5 24 11.5 25 10.5 26 15.5 27 21.0 28 23.0 29 26.0 30 23.5 31 29.0 32 46.0 33 52.5 34 71.0 35 83.5 36 99.0 37 127.5 38 156.0 39 185.5 40 190.0 41 202.0 42 213.0 43 217.0 44 217.5 45 216.0 46 205.0 47 180.5 48 163.5 49 140.0 50 113.5 51 101.0 52 100.5 53 85.0 54 70.0 55 68.5 56 56.5 57 41.5 58 36.5 59 33.0 60 26.0 61 22.0 62 19.5 63 16.0 64 14.0 65 10.5 66 11.0 67 10.5 68 6.5 69 6.0 70 8.0 71 6.0 72 4.0 73 5.0 74 3.5 75 2.0 76 1.0 77 1.0 78 1.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.15 2 0.125 3 0.1 4 0.1 5 0.22499999999999998 6 0.0 7 0.1 8 1.0999999999999999 9 1.05 10-11 2.4125 12-13 3.0875 14-15 3.675 16-17 3.2750000000000004 18-19 2.7875 20-21 3.0124999999999997 22-23 3.325 24-25 3.3125 26-27 2.075 28-29 1.7874999999999999 30-31 1.3875 32-33 1.8124999999999998 34-35 1.325 36-37 1.575 38-39 2.9375 40-41 4.324999999999999 42-43 4.425 44-45 3.2125 46-47 4.35 48-49 4.6375 50-51 2.5250000000000004 52-53 3.0875 54-55 3.1125 56-57 3.0375 58-59 3.25 60-61 1.7125000000000001 62-63 3.0 64-65 3.4125 66-67 4.25 68-69 3.8249999999999997 70-71 4.725 72-73 5.1125 74-75 5.4875 76-77 5.4125 78-79 5.3374999999999995 80-81 4.1375 82-83 2.2875 84-85 13.9625 86-87 13.05 88-89 11.512500000000001 90-91 10.15 92-93 8.9625 94-95 8.625 96-97 7.225 98-99 7.4125 100-101 7.3374999999999995 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44625573102394 96.625 2 1.3245033112582782 2.6 3 0.1782985226693836 0.525 4 0.0 0.0 5 0.05094243504839531 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTTT 5 0.125 No Hit CGGAGAGTGAAGGATACCAGTATATCGCTTTCAAGACCAACGCAAACTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039490 spots for SRR13844640.sra Written 1039490 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra Read 1039479 spots for SRR13844640.sra Written 1039479 spots for SRR13844640.sra SRR ids: ['SRR13844640.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z46a8lh2 SRR13844640.sra spots: 20789591 blocks: [[1, 1039479], [1039480, 2078958], [2078959, 3118437], [3118438, 4157916], [4157917, 5197395], [5197396, 6236874], [6236875, 7276353], [7276354, 8315832], [8315833, 9355311], [9355312, 10394790], [10394791, 11434269], [11434270, 12473748], [12473749, 13513227], [13513228, 14552706], [14552707, 15592185], [15592186, 16631664], [16631665, 17671143], [17671144, 18710622], [18710623, 19750101], [19750102, 20789591]] SRR13844640 file size 5013278 SRR13844640 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844640 SRR13844640_1.fastq SRR13844640_2.fastq Input file: SRR13844640_1.fastq Paired file: SRR13844640_2.fastq trimmed: SRR13844640-trimmed-pair1.fastq, SRR13844640-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:47:36 2024 >> started Fri Dec 6 12:47:57 2024 >> done (20.405s) 20789591 read pairs processed; of these: 204905 ( 0.99%) short read pairs filtered out after trimming by size control 178844 ( 0.86%) empty read pairs filtered out after trimming by size control 20405842 (98.15%) read pairs available; of these: 4239591 (20.78%) trimmed read pairs available after processing 16166251 (79.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 38 0.00% 20 78 0.00% 21 138 0.00% 22 189 0.00% 23 247 0.00% 24 280 0.00% 25 296 0.00% 26 345 0.00% 27 450 0.00% 28 505 0.00% 29 591 0.00% 30 713 0.00% 31 748 0.00% 32 867 0.00% 33 988 0.00% 34 1080 0.01% 35 1183 0.01% 36 1328 0.01% 37 1432 0.01% 38 1471 0.01% 39 1670 0.01% 40 1828 0.01% 41 1981 0.01% 42 2318 0.01% 43 2473 0.01% 44 2741 0.01% 45 2986 0.01% 46 3356 0.02% 47 3425 0.02% 48 3765 0.02% 49 4144 0.02% 50 4681 0.02% 51 5224 0.03% 52 6005 0.03% 53 6797 0.03% 54 7431 0.04% 55 8231 0.04% 56 9537 0.05% 57 11018 0.05% 58 12907 0.06% 59 113063 0.55% 60 146530 0.72% 61 152105 0.75% 62 173578 0.85% 63 148797 0.73% 64 103368 0.51% 65 71922 0.35% 66 52855 0.26% 67 43078 0.21% 68 38364 0.19% 69 38075 0.19% 70 35597 0.17% 71 33540 0.16% 72 33004 0.16% 73 33503 0.16% 74 33558 0.16% 75 39765 0.19% 76 45236 0.22% 77 45658 0.22% 78 41608 0.20% 79 38555 0.19% 80 37775 0.19% 81 37857 0.19% 82 39827 0.20% 83 42764 0.21% 84 45336 0.22% 85 47549 0.23% 86 47850 0.23% 87 50051 0.25% 88 54434 0.27% 89 59100 0.29% 90 67008 0.33% 91 84152 0.41% 92 124350 0.61% 93 83120 0.41% 94 85257 0.42% 95 96336 0.47% 96 114777 0.56% 97 150269 0.74% 98 209050 1.02% 99 316494 1.55% 100 868978 4.26% 101 16166251 79.22% 20405842 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=30 prefix-density=0.23 prefix-fanout=2.1 sequence=AGGATCCATCCACAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=20 fanout-score=152.00 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=13.7 sequence=TGCTGCTGCTAGCTAGAAATAAAGTTCGTGTCCAAATAAAACCGTGTGCAATGATGTAATGGCAATGGCGTGTCTGTGTCCGTGTCGCTCTGTGAGCTGAGCGTAATTTCCATGCGAGGAGAGGAGGGGCCCCTGGTTTCTGAAGATGAACTCTGATTGCCTTGATTGTAATCAGTCTGTGTTTCCTAGTACTAG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.04 fanout-score-rank=19 prefix-density=0.30 prefix-fanout=3.1 sequence=GTAGTGTTCCCCGTCCTGCTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=125.45 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.9 sequence=AACAAAACTCATAACAGTACTTTCTCTTAACAGAAACAAAATCCAACAAGACAATAGTTTTCACCAACACCATCACAGGATGTCAATTCAAGAGTGCACTGTAAACACAAAGGAACCACCCCCATAAACAACTAAAGCCTTCATACTGTCTACTCCTTGCTTAGCAACCAAGATGAGACTGCAATCTAAGACCTGGGCTTCTCCTTCTTCTC SRR13844640 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:49:59 Started mapping on | Dec 06 12:49:59 Finished on | Dec 06 12:50:56 Mapping speed, Million of reads per hour | 1288.79 Number of input reads | 20405842 Average input read length | 194 UNIQUE READS: Uniquely mapped reads number | 19195395 Uniquely mapped reads % | 94.07% Average mapped length | 193.26 Number of splices: Total | 6126169 Number of splices: Annotated (sjdb) | 5694431 Number of splices: GT/AG | 5950999 Number of splices: GC/AG | 75528 Number of splices: AT/AC | 2985 Number of splices: Non-canonical | 96657 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.47% Deletion average length | 1.02 Insertion rate per base | 0.02% Insertion average length | 1.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 736161 % of reads mapped to multiple loci | 3.61% Number of reads mapped to too many loci | 4053 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.28% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1285973 1285973 1285973 N_multimapping 736161 736161 736161 N_noFeature 913526 9964697 9746953 N_ambiguous 460796 35028 34620 UnstrandedReadsAssigned:17821073 PositiveStrandReadsAssigned:9195670 NegativeStrandReadsAssigned:9413822 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844640 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844640-trimmed-pair1.fastq SRR13844640-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,405,842 reads, 19,041,245 reads pseudoaligned [quant] estimated average fragment length: 160.228 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52973 SRR13844640.ke.tsv 35125 SRR13844640.se.tsv 88098 total ==> SRR13844640.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 776.813 0 0 PNS24247 1044 884.772 0.407543 0.0315842 PNS24249 1928 1768.77 3.84772 0.149163 PNS24246 1044 884.772 0.407543 0.0315842 PNS24248 1044 884.772 0.407543 0.0315842 PNS24244 1471 1311.77 1460.93 76.3659 PNS24243 293 136.77 0 0 KQK14069 1603 1443.77 427.447 20.3008 KQK14071 474 315.425 6.58834 1.43221 ==> SRR13844640.se.tsv <== BRADI_1g14170v3 596 BRADI_1g53295v3 170 BRADI_1g59795v3 291 BRADI_1g07683v3 0 BRADI_1g00485v3 17 BRADI_1g20270v3 953 BRADI_1g74790v3 20 BRADI_1g09890v3 2 BRADI_1g77505v3 656 BRADI_1g48960v3 1 SRR13844640 completed mapping pipeline successfully