Starting /dee2/code/volunteer_pipeline.sh SRR13844641 current disk space = 1551160356864 free memory = 1600165140 SRR13844641 SRAfilesize 720f3d43a1b4f2541ec78857e699c6a5 SRR13844641.sra SRR13844641.sra file validated SRR13844641 is paired end SRR13844641 is conventional basespace SRR13844641 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844641_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06 34.0 33.0 34.0 31.0 34.0 2 33.194 34.0 33.0 34.0 31.0 34.0 3 33.14075 34.0 33.0 34.0 31.0 34.0 4 36.53725 37.0 37.0 37.0 35.0 37.0 5 36.52125 37.0 37.0 37.0 35.0 37.0 6 36.50025 37.0 37.0 37.0 35.0 37.0 7 36.4325 37.0 37.0 37.0 35.0 37.0 8 36.49 37.0 37.0 37.0 35.0 37.0 9 38.43 39.0 39.0 39.0 37.0 39.0 10-11 38.223 39.0 39.0 39.0 37.0 39.0 12-13 38.329875 39.0 39.0 39.0 37.0 39.0 14-15 39.816874999999996 41.0 40.0 41.0 38.0 41.0 16-17 39.537 41.0 39.5 41.0 37.0 41.0 18-19 39.494 41.0 39.0 41.0 36.5 41.0 20-21 39.471000000000004 41.0 40.0 41.0 36.0 41.0 22-23 39.175124999999994 41.0 39.5 41.0 35.5 41.0 24-25 38.9975 41.0 39.5 41.0 36.0 41.0 26-27 38.68625 41.0 39.0 41.0 36.0 41.0 28-29 38.49325 41.0 39.0 41.0 35.5 41.0 30-31 38.390625 41.0 39.0 41.0 35.0 41.0 32-33 38.253 41.0 39.0 41.0 35.0 41.0 34-35 37.971999999999994 40.5 38.5 41.0 34.5 41.0 36-37 37.974875 40.5 38.5 41.0 34.0 41.0 38-39 37.880250000000004 40.0 38.0 41.0 34.0 41.0 40-41 37.71125 40.0 38.0 41.0 33.5 41.0 42-43 37.589749999999995 40.0 38.0 41.0 33.0 41.0 44-45 37.50775 40.0 38.0 41.0 33.0 41.0 46-47 37.441874999999996 40.0 38.0 41.0 33.0 41.0 48-49 37.429500000000004 40.0 38.0 41.0 33.0 41.0 50-51 37.462500000000006 40.0 38.0 41.0 33.0 41.0 52-53 37.189499999999995 40.0 37.5 41.0 32.0 41.0 54-55 37.129000000000005 40.0 37.0 41.0 33.0 41.0 56-57 36.970749999999995 40.0 37.0 41.0 33.0 41.0 58-59 36.76475 40.0 36.0 41.0 32.0 41.0 60-61 36.312375 39.0 35.5 41.0 31.0 41.0 62-63 36.49275 39.0 35.5 41.0 32.0 41.0 64-65 36.24675 39.0 35.0 41.0 32.5 41.0 66-67 36.0075 38.5 35.0 41.0 32.5 41.0 68-69 35.478750000000005 37.0 35.0 40.0 31.0 41.0 70-71 34.881 37.0 35.0 39.0 30.0 41.0 72-73 34.66737500000001 36.0 35.0 39.0 30.5 41.0 74-75 34.428625 36.0 35.0 38.5 31.0 40.5 76-77 33.70925 35.0 34.0 37.0 30.0 39.0 78-79 33.59225 35.0 34.5 37.0 30.0 39.0 80-81 33.460499999999996 35.0 35.0 36.5 30.0 39.0 82-83 33.2475 35.0 35.0 36.0 30.5 37.0 84-85 32.868624999999994 35.0 34.5 36.0 29.5 37.0 86-87 32.6995 35.0 34.0 35.0 29.0 37.0 88-89 32.679249999999996 35.0 34.0 35.0 29.0 36.0 90-91 32.516375 35.0 34.0 35.0 29.0 36.0 92-93 32.448125000000005 35.0 34.0 35.0 29.0 36.0 94-95 32.362750000000005 35.0 34.0 35.0 29.0 36.0 96-97 32.19675 35.0 34.0 35.0 29.5 36.0 98-99 32.026875 35.0 34.0 35.0 28.0 35.0 100-101 30.979625 34.5 32.0 35.0 24.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 4.0 8 12.0 9 34.0 10 44.0 11 24.0 12 7.0 13 10.0 14 5.0 15 7.0 16 6.0 17 6.0 18 8.0 19 2.0 20 1.0 21 7.0 22 11.0 23 5.0 24 13.0 25 15.0 26 15.0 27 16.0 28 23.0 29 27.0 30 31.0 31 44.0 32 47.0 33 82.0 34 116.0 35 161.0 36 354.0 37 922.0 38 1515.0 39 425.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.9 15.125 6.575 53.400000000000006 2 15.15 18.9 52.5 13.450000000000001 3 20.375 23.825 29.2 26.6 4 23.625 28.799999999999997 26.275 21.3 5 25.25 30.025000000000002 29.425 15.299999999999999 6 19.900000000000002 34.2 31.825 14.075 7 17.1 17.825 48.1 16.975 8 17.05 22.225 39.975 20.75 9 19.650000000000002 20.200000000000003 39.800000000000004 20.349999999999998 10-11 22.2125 30.325000000000003 29.25 18.212500000000002 12-13 20.549999999999997 24.5 35.0875 19.8625 14-15 19.950000000000003 26.887499999999996 33.387499999999996 19.775000000000002 16-17 20.8125 27.487499999999997 31.0625 20.6375 18-19 21.6125 26.775 31.0375 20.575 20-21 21.3125 27.575 30.0875 21.025 22-23 22.35 26.75 30.5375 20.3625 24-25 21.975 27.750000000000004 29.675 20.599999999999998 26-27 22.8 28.15 27.9375 21.1125 28-29 21.85 28.95 27.6375 21.5625 30-31 22.0625 28.6625 28.237499999999997 21.0375 32-33 21.725 29.599999999999998 27.5875 21.087500000000002 34-35 21.892973243310827 28.94473618404601 27.7569392348087 21.405351337834457 36-37 21.435717858929465 28.001500750375186 29.37718859429715 21.1855927963982 38-39 21.912499999999998 28.037499999999998 28.3125 21.7375 40-41 21.817954488622153 27.394348587146787 28.33208302075519 22.455613903475868 42-43 21.7375 28.6875 28.3625 21.212500000000002 44-45 22.112499999999997 28.050000000000004 28.5875 21.25 46-47 21.275 27.775 28.9375 22.0125 48-49 21.2375 28.0875 28.025 22.650000000000002 50-51 22.2625 27.55 27.750000000000004 22.4375 52-53 21.925 28.349999999999998 27.800000000000004 21.925 54-55 22.912499999999998 27.462500000000002 27.775 21.85 56-57 21.3125 28.6375 27.3375 22.7125 58-59 21.837500000000002 28.725 27.775 21.6625 60-61 21.712500000000002 28.925 27.35 22.0125 62-63 22.662499999999998 28.512500000000003 27.212500000000002 21.6125 64-65 21.1875 28.712500000000002 27.825 22.275 66-67 23.075000000000003 28.425 27.200000000000003 21.3 68-69 20.7375 29.2875 27.825 22.15 70-71 21.6875 28.000000000000004 28.299999999999997 22.0125 72-73 21.725 29.2 27.150000000000002 21.925 74-75 21.75 28.825 28.349999999999998 21.075 76-77 22.6 29.2375 27.187499999999996 20.974999999999998 78-79 21.4875 28.6375 26.8125 23.0625 80-81 21.837500000000002 29.212500000000002 27.537499999999998 21.4125 82-83 22.025 29.512500000000003 27.200000000000003 21.2625 84-85 21.95 29.8875 26.3125 21.85 86-87 22.0 29.6375 27.1 21.2625 88-89 21.6875 28.962500000000002 26.887499999999996 22.4625 90-91 22.275 29.5375 26.7125 21.475 92-93 21.9 29.262500000000003 27.0875 21.75 94-95 22.237499999999997 29.175 26.637499999999996 21.95 96-97 21.5375 28.499999999999996 27.450000000000003 22.5125 98-99 22.1375 29.075 26.775 22.0125 100-101 21.125 29.825000000000003 26.8 22.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.5 10 1.5 11 2.0 12 2.5 13 3.0 14 3.5 15 4.5 16 4.0 17 4.5 18 5.5 19 5.5 20 6.5 21 7.0 22 9.0 23 10.0 24 8.5 25 10.5 26 12.0 27 13.0 28 17.0 29 21.0 30 25.0 31 34.0 32 47.0 33 64.0 34 88.5 35 102.0 36 120.5 37 152.0 38 179.0 39 211.0 40 226.0 41 222.5 42 221.0 43 216.5 44 212.5 45 207.5 46 204.5 47 183.5 48 162.5 49 145.5 50 117.5 51 103.5 52 87.5 53 73.5 54 62.0 55 45.5 56 36.5 57 38.0 58 31.5 59 21.5 60 23.5 61 23.0 62 21.5 63 22.5 64 19.5 65 18.0 66 14.5 67 9.0 68 8.0 69 7.0 70 6.5 71 9.0 72 9.5 73 6.5 74 3.5 75 1.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.025 36-37 0.05 38-39 0.0 40-41 0.025 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.1 #Duplication Level Percentage of deduplicated Percentage of total 1 96.52996845425868 91.8 2 2.6550998948475293 5.050000000000001 3 0.4468980021030494 1.275 4 0.13144058885383808 0.5 5 0.10515247108307045 0.5 6 0.10515247108307045 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026288117770767613 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 2 (100% over 50bp) CTTTATTCCACATCATAAACACCATACATCATCCAACTCGCAGACTCTCT 6 0.15 No Hit CGCAGAGTCAGGTGAAGAAGGTGCTCCAGGCAGCGAAGAACCTTCCTTCC 6 0.15 No Hit CGGGAACTGTGTGTACTTGTGTTGAGGGAATAATAAGTGTAGCAGAGGAG 6 0.15 No Hit CTCTTGTAGTAGATAGATAGGGATCACCGCTGTTTTAGTCGATGTAGCAG 6 0.15 No Hit GCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTTT 5 0.125 No Hit CTCTTTGCCACTTTATTCCACATCATAAACACCATACATCATCCAACTCG 5 0.125 No Hit GTCGTGTTTTCCGATCGATCGAGTGCGTGTGTTTAGGCTTTGGGTTTGCG 5 0.125 No Hit CAAACATCAAGTGCTGCACACTTGCGATTTATTTATTTTACTCTACAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1125 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.42500000000000004 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844641 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844641_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.307 34.0 31.0 34.0 29.0 34.0 2 32.4015 34.0 31.0 34.0 29.0 34.0 3 32.33075 34.0 31.0 34.0 28.0 34.0 4 35.76025 37.0 37.0 37.0 32.0 37.0 5 35.7785 37.0 37.0 37.0 32.0 37.0 6 35.5445 37.0 36.0 37.0 32.0 37.0 7 35.6815 37.0 37.0 37.0 32.0 37.0 8 35.55625 37.0 36.0 37.0 32.0 37.0 9 36.656 39.0 38.0 39.0 32.0 39.0 10-11 36.487375 39.0 38.0 39.0 32.0 39.0 12-13 36.33725 39.0 38.0 39.0 32.0 39.0 14-15 37.765125 41.0 39.0 41.0 32.0 41.0 16-17 37.69375 41.0 39.0 41.0 32.0 41.0 18-19 37.1185 41.0 38.0 41.0 31.0 41.0 20-21 36.628 41.0 38.5 41.0 30.0 41.0 22-23 36.599125 41.0 38.0 41.0 30.0 41.0 24-25 36.536500000000004 41.0 38.5 41.0 29.0 41.0 26-27 36.18425 41.0 38.0 41.0 27.5 41.0 28-29 36.08175 40.5 38.0 41.0 26.5 41.0 30-31 36.016125 41.0 38.0 41.0 25.5 41.0 32-33 35.778875 40.0 38.0 41.0 24.0 41.0 34-35 35.74725 40.0 38.0 41.0 24.5 41.0 36-37 35.544125 40.0 38.0 41.0 14.5 41.0 38-39 35.313125 40.0 38.0 41.0 2.0 41.0 40-41 35.063375 40.0 37.5 41.0 2.0 41.0 42-43 34.84 40.0 37.0 41.0 2.0 41.0 44-45 34.3625 40.0 36.0 41.0 2.0 41.0 46-47 34.372125 40.0 36.0 41.0 2.0 41.0 48-49 34.399625 40.0 36.0 41.0 2.0 41.0 50-51 33.819125 39.0 35.0 40.5 2.0 41.0 52-53 33.628125 39.0 34.5 40.5 2.0 41.0 54-55 34.055125000000004 39.5 35.0 41.0 2.0 41.0 56-57 34.27575 40.0 35.0 41.0 2.0 41.0 58-59 34.40775 40.0 35.0 41.0 2.0 41.0 60-61 33.957499999999996 39.0 35.0 41.0 2.0 41.0 62-63 33.589124999999996 39.0 35.0 41.0 2.0 41.0 64-65 33.351 38.5 35.0 41.0 2.0 41.0 66-67 32.93425 37.0 34.5 40.0 2.0 41.0 68-69 32.530875 37.0 34.5 40.0 2.0 41.0 70-71 31.848125 36.0 34.0 39.0 2.0 41.0 72-73 31.601 36.0 34.0 39.0 2.0 41.0 74-75 31.393375 35.0 34.0 38.0 2.0 40.5 76-77 31.01075 35.0 33.5 37.0 2.0 39.0 78-79 30.542749999999998 35.0 33.5 37.0 2.0 39.0 80-81 30.110875 35.0 33.0 36.0 2.0 38.0 82-83 29.62925 35.0 32.5 36.0 2.0 37.0 84-85 24.810875 33.5 2.0 35.0 2.0 36.0 86-87 24.797125 34.0 2.0 35.0 2.0 36.0 88-89 24.7515 33.0 6.0 35.0 2.0 35.5 90-91 24.774124999999998 33.0 9.0 35.0 2.0 35.0 92-93 25.098125 33.0 11.0 35.0 2.0 35.0 94-95 25.198999999999998 33.0 11.0 35.0 2.0 35.0 96-97 24.938375 33.0 2.0 35.0 2.0 35.0 98-99 24.708750000000002 33.0 2.0 35.0 2.0 35.0 100-101 23.028750000000002 31.0 2.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 34.0 4 34.0 5 8.0 6 73.0 7 83.0 8 27.0 9 44.0 10 43.0 11 32.0 12 24.0 13 16.0 14 20.0 15 12.0 16 8.0 17 6.0 18 8.0 19 14.0 20 9.0 21 8.0 22 10.0 23 24.0 24 24.0 25 21.0 26 26.0 27 31.0 28 40.0 29 44.0 30 56.0 31 88.0 32 177.0 33 128.0 34 156.0 35 230.0 36 427.0 37 764.0 38 981.0 39 248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.525 13.350000000000001 6.4750000000000005 52.65 2 15.299999999999999 16.8 53.574999999999996 14.325 3 19.625 22.225 31.4 26.75 4 23.125 26.950000000000003 29.125 20.8 5 24.6 28.725 31.85 14.825 6 19.113573407202217 31.679677663057166 34.07202216066482 15.1347267690758 7 16.75 17.424999999999997 51.5 14.325 8 17.43602609131962 19.944806823883592 40.642247867536376 21.976919217260413 9 17.265264238070806 18.419702411493073 44.15084658799384 20.16418676244228 10-11 21.260656161198657 29.243089640919663 31.606819943167142 17.889434254714544 12-13 19.543213080716328 24.059174669089025 37.321567609654814 19.076044640539838 14-15 20.17418432341089 26.192642662160402 34.524892759651635 19.10828025477707 16-17 21.263322069144788 26.306212633220692 32.947751494671174 19.482713802963346 18-19 20.95545513234345 26.00387346675274 32.74370561652679 20.296965784377015 20-21 21.786267423851317 27.232834279814146 30.265875064532782 20.715023231801755 22-23 22.029988465974625 27.476611559656543 29.70652313212867 20.786876842240165 24-25 21.247142494284986 28.05435610871222 29.806959613919226 20.891541783083568 26-27 22.635092580929587 29.436956795566193 28.038795818113112 19.889154805391108 28-29 21.425867507886434 29.86750788643533 27.078864353312305 21.62776025236593 30-31 22.16637346066851 29.027393817542098 28.286001507916563 20.520231213872833 32-33 23.17914002757929 27.942835652500943 27.37871380218127 21.499310517738497 34-35 21.645841221759436 28.398333964407424 28.007068029786698 21.94875678404645 36-37 21.913619569371896 28.984584023442476 27.812460186010956 21.289336221174672 38-39 22.21938775510204 27.512755102040813 29.03061224489796 21.237244897959183 40-41 21.309156378600825 28.03497942386831 29.179526748971192 21.476337448559672 42-43 22.72258064516129 27.92258064516129 28.064516129032256 21.29032258064516 44-45 21.935400181605917 28.408353872097546 28.99208717083928 20.66415877545726 46-47 22.40798341109383 28.252980819077244 27.941938828408503 21.397096941420422 48-49 21.326583592938732 27.725856697819314 29.01090342679128 21.936656282450677 50-51 22.194869137082147 27.947654832858255 28.25861622181912 21.598859808240476 52-53 21.442270809359417 27.912031709500063 28.743127477304693 21.902570003835827 54-55 22.085030549898164 28.640529531568227 27.64765784114053 21.626782077393074 56-57 22.664974619289342 28.705583756345177 27.66497461928934 20.96446700507614 58-59 22.225044450088898 29.222758445516888 27.673355346710693 20.878841757683517 60-61 22.393920202659913 28.00506649778341 27.77707409753008 21.823939202026597 62-63 21.42129393785023 29.3428425878757 27.63627101375446 21.599592460519613 64-65 21.82052937378954 28.366688185926403 27.863137508069723 21.949644932214333 66-67 22.11886304909561 27.906976744186046 28.100775193798448 21.873385012919897 68-69 21.634241245136188 28.067444876783398 27.704280155642024 22.594033722438393 70-71 22.310085558724396 27.5213896810993 28.16956183562354 21.99896292455276 72-73 21.613155833985903 28.713129731140697 27.825632993996347 21.848081440877056 74-75 22.11613915772953 29.074025634318595 28.18467172377714 20.62516348417473 76-77 22.051016444386896 28.874789589537748 27.657645992489964 21.416547973585395 78-79 22.134905042567123 28.382449246889323 27.38703339882122 22.09561231172233 80-81 20.852280109133428 28.517604261400546 28.34870728855398 22.281408340912044 82-83 21.817948058626897 27.294934430444844 28.992028799177167 21.895088711751093 84-85 21.081409477521262 28.827460510328066 27.506075334143375 22.585054678007292 86-87 21.233388084216813 29.77452590712259 26.89263849484844 22.099447513812155 88-89 21.365543179516852 29.20584406191234 27.3542600896861 22.074352668884707 90-91 21.891891891891895 29.786628733997155 26.78520625889047 21.53627311522048 92-93 22.788689232483634 27.984398941356737 27.66402005850397 21.56289176765566 94-95 20.984743411927877 30.499306518723994 26.28294036061026 22.233009708737864 96-97 22.197403322630183 28.61929359207036 27.963143934105823 21.220159151193634 98-99 20.26578073089701 28.737541528239202 28.806755260243634 22.189922480620154 100-101 22.493820379016753 29.332600933809395 27.162867344136227 21.010711343037627 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 2.5 3 5.5 4 9.5 5 10.0 6 8.0 7 4.5 8 3.5 9 6.5 10 10.0 11 8.5 12 7.0 13 11.0 14 13.0 15 12.0 16 12.5 17 14.5 18 17.0 19 17.0 20 18.0 21 22.0 22 17.5 23 16.0 24 20.0 25 20.5 26 21.5 27 26.0 28 30.5 29 38.0 30 44.5 31 53.5 32 59.5 33 70.0 34 91.5 35 110.5 36 133.0 37 139.0 38 157.0 39 182.5 40 194.5 41 220.5 42 212.5 43 193.0 44 205.5 45 204.5 46 173.0 47 146.0 48 136.0 49 129.5 50 111.0 51 86.0 52 79.0 53 65.0 54 50.5 55 49.0 56 36.5 57 28.5 58 25.0 59 26.0 60 30.0 61 25.0 62 18.5 63 15.5 64 13.0 65 8.0 66 7.0 67 5.5 68 6.5 69 5.5 70 7.5 71 9.5 72 8.5 73 6.0 74 4.0 75 5.5 76 3.0 77 1.5 78 1.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.7250000000000001 7 0.0 8 0.35000000000000003 9 2.55 10-11 3.225 12-13 3.675 14-15 3.8375 16-17 3.8249999999999997 18-19 3.1875 20-21 3.15 22-23 2.4625 24-25 1.575 26-27 0.7625 28-29 0.9375 30-31 0.525 32-33 0.2875 34-35 0.9625 36-37 1.8875 38-39 2.0 40-41 2.8000000000000003 42-43 3.125 44-45 3.6374999999999997 46-47 3.55 48-49 3.6999999999999997 50-51 3.5249999999999995 52-53 2.2375 54-55 1.7999999999999998 56-57 1.5 58-59 1.575 60-61 1.3125 62-63 1.8499999999999999 64-65 3.1875 66-67 3.25 68-69 3.6249999999999996 70-71 3.5749999999999997 72-73 4.2250000000000005 74-75 4.425 76-77 3.4625000000000004 78-79 4.5625 80-81 3.7875 82-83 2.775 84-85 17.7 86-87 16.287499999999998 88-89 13.5875 90-91 12.125 92-93 10.2625 94-95 9.875 96-97 10.4625 98-99 9.700000000000001 100-101 8.975 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.5 #Duplication Level Percentage of deduplicated Percentage of total 1 96.83246073298429 92.475 2 2.2774869109947646 4.35 3 0.6806282722513088 1.95 4 0.07853403141361257 0.3 5 0.0 0.0 6 0.052356020942408384 0.3 7 0.026178010471204192 0.17500000000000002 8 0.026178010471204192 0.2 9 0.0 0.0 >10 0.026178010471204192 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTTT 10 0.25 No Hit CTCACATTTATTTTGCCGGAAAACTGTCACGTACAAAACGTACACGGTAC 8 0.2 No Hit CTTTATTCCACATCATAAACACCATACATCATCCAACTCGCAGACTCTCT 7 0.17500000000000002 No Hit CTTGTAGTAGATAGATAGGGATCACCGCTGTTTTAGTCGATGTAGCAGCA 6 0.15 No Hit CGGCGTTTAAGTTCTACCTGTCGTGTTTTCCGATCGATCGAGTGCGTGTG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1125 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.16249999999999998 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.1875 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 20 0.002288271 68.20253 1 >>END_MODULE Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181264 spots for SRR13844641.sra Written 1181264 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra Read 1181247 spots for SRR13844641.sra Written 1181247 spots for SRR13844641.sra SRR ids: ['SRR13844641.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xkke0yic SRR13844641.sra spots: 23624957 blocks: [[1, 1181247], [1181248, 2362494], [2362495, 3543741], [3543742, 4724988], [4724989, 5906235], [5906236, 7087482], [7087483, 8268729], [8268730, 9449976], [9449977, 10631223], [10631224, 11812470], [11812471, 12993717], [12993718, 14174964], [14174965, 15356211], [15356212, 16537458], [16537459, 17718705], [17718706, 18899952], [18899953, 20081199], [20081200, 21262446], [21262447, 22443693], [22443694, 23624957]] SRR13844641 file size 5699968 SRR13844641 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844641 SRR13844641_1.fastq SRR13844641_2.fastq Input file: SRR13844641_1.fastq Paired file: SRR13844641_2.fastq trimmed: SRR13844641-trimmed-pair1.fastq, SRR13844641-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:51:54 2024 >> started Fri Dec 6 12:52:17 2024 >> done (22.870s) 23624957 read pairs processed; of these: 322284 ( 1.36%) short read pairs filtered out after trimming by size control 190918 ( 0.81%) empty read pairs filtered out after trimming by size control 23111755 (97.83%) read pairs available; of these: 12218703 (52.87%) trimmed read pairs available after processing 10893052 (47.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 29 0.00% 19 125 0.00% 20 247 0.00% 21 391 0.00% 22 463 0.00% 23 608 0.00% 24 658 0.00% 25 778 0.00% 26 897 0.00% 27 981 0.00% 28 1182 0.01% 29 1377 0.01% 30 1513 0.01% 31 1736 0.01% 32 1931 0.01% 33 2215 0.01% 34 2342 0.01% 35 2612 0.01% 36 2803 0.01% 37 2942 0.01% 38 3293 0.01% 39 3391 0.01% 40 3843 0.02% 41 4052 0.02% 42 4461 0.02% 43 5040 0.02% 44 5329 0.02% 45 5803 0.03% 46 6121 0.03% 47 6562 0.03% 48 7075 0.03% 49 7838 0.03% 50 10918 0.05% 51 19208 0.08% 52 33764 0.15% 53 47026 0.20% 54 49278 0.21% 55 44269 0.19% 56 39208 0.17% 57 36464 0.16% 58 37274 0.16% 59 241984 1.05% 60 305666 1.32% 61 298228 1.29% 62 331389 1.43% 63 275456 1.19% 64 189948 0.82% 65 127945 0.55% 66 92354 0.40% 67 74021 0.32% 68 64305 0.28% 69 58374 0.25% 70 56548 0.24% 71 52159 0.23% 72 50048 0.22% 73 50382 0.22% 74 48787 0.21% 75 52913 0.23% 76 50574 0.22% 77 51586 0.22% 78 50137 0.22% 79 49193 0.21% 80 49213 0.21% 81 55136 0.24% 82 57418 0.25% 83 62074 0.27% 84 68014 0.29% 85 71375 0.31% 86 80425 0.35% 87 92320 0.40% 88 112011 0.48% 89 142484 0.62% 90 208944 0.90% 91 468883 2.03% 92 3113393 13.47% 93 850550 3.68% 94 511776 2.21% 95 406465 1.76% 96 378015 1.64% 97 390980 1.69% 98 466737 2.02% 99 579626 2.51% 100 1074820 4.65% 101 10893052 47.13% 23111755 reads passed initial QC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.80 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=52.08 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.2 sequence=TGTAATGTTATTCAAACAAAAGCTTTATTCAGGAACAGATGTTCCTTATTTCCTAGTTGCATCTAGTACTAGCCAGTGGCCACACAAGATGATGTATGGCACTTTTATTTTGACACCGCTAATCATCAATCGACTTAACGGTGATACATC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=24 prefix-density=0.64 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=78.07 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=1.0 sequence=GCCGGCGGCTACGGTGGTGGCTACGGCCAGCAGCGCGGCGGCACCGACGGCCAGTGGAGGAACTGAGCGGCTGCGCGCGGCCCAGTTGTCTCCTGCTGCTCCCTGTCGTCTTCGATTTATCAATCTATCGAATCTATCTATCCCGAGTTAACATCATCGGTCGGTCGTGTCAGTCGTCGTGTTGTTTGTGTTTTTGATCGGGAGCTTCGAGTGAGTCTGTCTCTGTGTCTGTGTCTGGTTTTAATTAGCGCAAGAAGAAAAAACATATCAAGTGTTTATGTGATGATGCAATCCCTTTCTGTTCCATGGATTGGATCGG SRR13844641 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:52:53 Started mapping on | Dec 06 12:52:54 Finished on | Dec 06 12:53:51 Mapping speed, Million of reads per hour | 1459.69 Number of input reads | 23111755 Average input read length | 186 UNIQUE READS: Uniquely mapped reads number | 21643434 Uniquely mapped reads % | 93.65% Average mapped length | 183.84 Number of splices: Total | 4458013 Number of splices: Annotated (sjdb) | 4009285 Number of splices: GT/AG | 4289482 Number of splices: GC/AG | 68251 Number of splices: AT/AC | 1876 Number of splices: Non-canonical | 98404 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.33% Deletion average length | 1.03 Insertion rate per base | 0.02% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 788955 % of reads mapped to multiple loci | 3.41% Number of reads mapped to too many loci | 17164 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2515434 2515434 2515434 N_multimapping 788955 788955 788955 N_noFeature 1177156 11216008 11118218 N_ambiguous 551389 36021 34247 UnstrandedReadsAssigned:19914889 PositiveStrandReadsAssigned:10391405 NegativeStrandReadsAssigned:10490969 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844641 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844641-trimmed-pair1.fastq SRR13844641-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,111,755 reads, 21,302,757 reads pseudoaligned [quant] estimated average fragment length: 162.709 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,244 rounds 52973 SRR13844641.ke.tsv 35125 SRR13844641.se.tsv 88098 total ==> SRR13844641.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 774.306 0 0 PNS24247 1044 882.291 1.57905 0.104633 PNS24249 1928 1766.29 0 0 PNS24246 1044 882.291 1.57905 0.104633 PNS24248 1044 882.291 1.57905 0.104633 PNS24244 1471 1309.29 1242.26 55.4705 PNS24243 293 135.649 1 0.430991 KQK14069 1603 1441.29 1589.81 64.4879 KQK14071 474 312.927 22.59 4.22044 ==> SRR13844641.se.tsv <== BRADI_1g14170v3 2073 BRADI_1g53295v3 643 BRADI_1g59795v3 621 BRADI_1g07683v3 0 BRADI_1g00485v3 32 BRADI_1g20270v3 492 BRADI_1g74790v3 1 BRADI_1g09890v3 2 BRADI_1g77505v3 699 BRADI_1g48960v3 1 SRR13844641 completed mapping pipeline successfully