Starting /dee2/code/volunteer_pipeline.sh SRR13844642 current disk space = 1551184781312 free memory = 1598996600 SRR13844642 SRAfilesize 47452f460d654acb70de9fbf889cc9e5 SRR13844642.sra SRR13844642.sra file validated SRR13844642 is paired end SRR13844642 is conventional basespace SRR13844642 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844642_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.042 34.0 33.0 34.0 31.0 34.0 2 33.19375 34.0 33.0 34.0 31.0 34.0 3 33.0765 34.0 33.0 34.0 31.0 34.0 4 36.474 37.0 37.0 37.0 35.0 37.0 5 36.48675 37.0 37.0 37.0 35.0 37.0 6 36.47025 37.0 37.0 37.0 35.0 37.0 7 36.406 37.0 37.0 37.0 35.0 37.0 8 36.4685 37.0 37.0 37.0 35.0 37.0 9 38.408 39.0 39.0 39.0 37.0 39.0 10-11 38.2205 39.0 39.0 39.0 37.0 39.0 12-13 38.330625 39.0 39.0 39.0 37.0 39.0 14-15 39.821875 41.0 40.0 41.0 38.0 41.0 16-17 39.591625 41.0 39.5 41.0 37.0 41.0 18-19 39.5435 41.0 39.5 41.0 37.0 41.0 20-21 39.453374999999994 41.0 40.0 41.0 37.0 41.0 22-23 39.10325 41.0 39.5 41.0 35.5 41.0 24-25 38.960125000000005 41.0 39.5 41.0 36.0 41.0 26-27 38.640125 41.0 39.0 41.0 35.5 41.0 28-29 38.441 41.0 39.0 41.0 35.0 41.0 30-31 38.36525 41.0 39.0 41.0 35.5 41.0 32-33 38.160125 41.0 39.0 41.0 35.0 41.0 34-35 37.9015 41.0 38.5 41.0 34.0 41.0 36-37 37.857875 40.5 38.5 41.0 34.0 41.0 38-39 37.676125 40.0 38.0 41.0 34.0 41.0 40-41 37.531625000000005 40.0 38.0 41.0 33.0 41.0 42-43 37.37075 40.0 38.0 41.0 32.5 41.0 44-45 37.356624999999994 40.0 38.0 41.0 33.0 41.0 46-47 37.293375 40.0 38.0 41.0 33.0 41.0 48-49 37.317 40.0 38.0 41.0 33.0 41.0 50-51 37.341875 40.0 38.0 41.0 33.0 41.0 52-53 37.070499999999996 40.0 37.0 41.0 33.0 41.0 54-55 36.9435 40.0 37.0 41.0 32.0 41.0 56-57 36.832875 40.0 36.5 41.0 32.0 41.0 58-59 36.59525 40.0 36.0 41.0 32.0 41.0 60-61 36.095749999999995 39.0 35.0 41.0 30.5 41.0 62-63 36.326625 39.0 35.0 41.0 32.5 41.0 64-65 36.0975 39.0 35.0 41.0 32.0 41.0 66-67 35.856125000000006 38.5 35.0 40.5 32.5 41.0 68-69 35.377125 37.0 35.0 40.0 31.0 41.0 70-71 34.72825 36.5 35.0 39.0 30.0 41.0 72-73 34.431875 36.0 35.0 39.0 30.5 41.0 74-75 34.18825 36.0 35.0 38.0 30.5 40.0 76-77 33.443875 35.0 34.0 37.0 29.5 39.0 78-79 33.37375 35.0 34.5 37.0 29.5 39.0 80-81 33.235875 35.0 35.0 36.0 30.0 38.0 82-83 33.021625 35.0 35.0 36.0 29.5 37.0 84-85 32.6575 35.0 34.5 35.5 28.5 37.0 86-87 32.443375 35.0 34.0 35.0 28.5 36.5 88-89 32.409375 35.0 34.0 35.0 29.0 36.0 90-91 32.2055 35.0 34.0 35.0 29.0 36.0 92-93 32.12325 35.0 34.0 35.0 28.0 36.0 94-95 32.088625 35.0 34.0 35.0 28.0 36.0 96-97 31.914 35.0 34.0 35.0 27.5 36.0 98-99 31.76075 35.0 34.0 35.0 27.5 35.0 100-101 30.677 34.5 32.0 35.0 22.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 31.0 9 20.0 10 51.0 11 28.0 12 13.0 13 10.0 14 3.0 15 5.0 16 0.0 17 3.0 18 3.0 19 7.0 20 8.0 21 9.0 22 6.0 23 6.0 24 7.0 25 12.0 26 21.0 27 29.0 28 20.0 29 21.0 30 28.0 31 41.0 32 60.0 33 70.0 34 135.0 35 184.0 36 382.0 37 925.0 38 1477.0 39 382.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.11808856642482 13.960470352764572 5.904428321240931 56.017012759569674 2 16.1 16.725 51.449999999999996 15.725 3 20.625 21.525 28.775000000000002 29.075 4 24.55 26.025 26.625 22.8 5 25.374999999999996 27.825 29.95 16.85 6 19.3 34.425 32.45 13.825000000000001 7 16.725 18.525 48.55 16.2 8 16.575 23.35 40.125 19.950000000000003 9 19.0 18.275 41.949999999999996 20.775 10-11 20.974999999999998 29.9375 31.125000000000004 17.962500000000002 12-13 19.6 24.887500000000003 34.675 20.837500000000002 14-15 21.0375 25.674999999999997 33.8375 19.45 16-17 20.9875 26.887499999999996 32.0375 20.0875 18-19 20.6625 27.4125 31.2375 20.6875 20-21 21.75 27.700000000000003 30.4 20.150000000000002 22-23 21.7375 28.050000000000004 29.3875 20.825 24-25 22.0 27.675 29.25 21.075 26-27 21.8625 28.275 28.749999999999996 21.1125 28-29 21.4375 28.799999999999997 28.075 21.6875 30-31 22.375 28.475 27.224999999999998 21.925 32-33 22.0 27.900000000000002 28.375 21.725 34-35 21.2375 28.0875 28.6625 22.0125 36-37 22.6 27.700000000000003 27.425 22.275 38-39 22.7125 27.5125 27.85 21.925 40-41 21.4375 27.537499999999998 29.125 21.9 42-43 22.1 27.8125 28.5625 21.525 44-45 21.125 29.025000000000002 28.475 21.375 46-47 21.55 27.9375 29.1125 21.4 48-49 21.3 28.375 27.762500000000003 22.5625 50-51 21.512500000000003 28.849999999999998 27.6 22.037499999999998 52-53 22.3375 29.262500000000003 26.650000000000002 21.75 54-55 21.9625 28.8375 27.0875 22.112499999999997 56-57 21.875 28.349999999999998 27.237499999999997 22.537499999999998 58-59 22.3375 28.625 27.187499999999996 21.85 60-61 22.3875 28.512500000000003 26.887499999999996 22.2125 62-63 20.837500000000002 29.9625 26.6 22.6 64-65 22.05 29.65 26.5375 21.762500000000003 66-67 21.55 28.925 26.825 22.7 68-69 21.1875 29.15 27.650000000000002 22.0125 70-71 22.05 28.212500000000002 27.85 21.8875 72-73 22.1375 29.3375 26.450000000000003 22.075 74-75 21.587500000000002 29.125 27.425 21.8625 76-77 21.9375 28.512500000000003 27.537499999999998 22.0125 78-79 22.0875 29.012500000000003 26.387500000000003 22.5125 80-81 21.637500000000003 28.962500000000002 26.8 22.6 82-83 21.9 29.812499999999996 26.7125 21.575 84-85 22.1375 29.725 26.125 22.0125 86-87 21.825 29.849999999999998 25.912499999999998 22.412499999999998 88-89 22.275 29.65 26.950000000000003 21.125 90-91 21.2625 29.262500000000003 26.9125 22.5625 92-93 21.2 29.075 27.05 22.675 94-95 21.9375 30.7875 26.525 20.75 96-97 22.6125 29.512500000000003 25.775 22.1 98-99 21.2 30.375000000000004 26.35 22.075 100-101 22.162499999999998 29.8875 26.137500000000003 21.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 2.0 14 2.0 15 2.0 16 3.0 17 5.0 18 7.0 19 6.0 20 7.5 21 8.5 22 7.5 23 8.5 24 11.0 25 13.5 26 15.5 27 19.0 28 21.0 29 23.0 30 32.0 31 43.5 32 54.0 33 70.5 34 93.0 35 108.0 36 119.0 37 138.5 38 151.0 39 193.0 40 214.5 41 195.5 42 212.0 43 213.5 44 201.0 45 209.0 46 203.0 47 185.0 48 172.0 49 158.0 50 129.0 51 102.0 52 84.0 53 69.0 54 75.0 55 65.5 56 47.5 57 40.5 58 28.5 59 24.5 60 25.5 61 23.0 62 20.0 63 17.5 64 18.5 65 18.0 66 15.0 67 13.5 68 11.5 69 8.0 70 7.5 71 7.0 72 5.5 73 6.0 74 3.0 75 2.0 76 2.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 96.70706006322445 91.77499999999999 2 2.344573234984194 4.45 3 0.5005268703898841 1.425 4 0.21074815595363539 0.8 5 0.10537407797681769 0.5 6 0.0 0.0 7 0.07903055848261328 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.052687038988408846 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCGTTTTATTATCAACAACTCCCGCACGTACGTACGGTACATACGTAC 11 0.27499999999999997 No Hit CTGGTTTTCTCTTTGTGATTGAATCAATTGAGGAGAGGATACGACTTCTC 10 0.25 No Hit CGATCATCTTCGTTTTATTATCAACAACTCCCGCACGTACGTACGGTACA 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 4 (100% over 50bp) CTCTCTCTGAATGTGTGCGAGTGTGTCGGTGTCTGTGTTCCGTGTGTGTT 7 0.17500000000000002 No Hit CTCCGTTTTAAATTACCCCGCACGTGTGCCTAGCTAATTAAGTTTTAATT 5 0.125 No Hit GTGTGTTTCAGCAGTGTGCTGTGCTGAGTGCTACCTTGATGTGGCGTGTG 5 0.125 No Hit CTCCTTTATTCAAATCGAAGACAGCATGCGAGCAGTACACAAGAACAACA 5 0.125 No Hit CGTGGTTATACTTGCAGGGGGTGGTTGTTAATTTTGCTTTCTTCATACTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.1375 0.0 0.0 0.0 0.0 60-61 0.2375 0.0 0.0 0.0 0.0 62-63 0.2625 0.0 0.0 0.0 0.0 64-65 0.275 0.0 0.0 0.0 0.0 66-67 0.3125 0.0 0.0 0.0 0.0 68-69 0.3375 0.0 0.0 0.0 0.0 70-71 0.375 0.0 0.0 0.0 0.0 72-73 0.4625 0.0 0.0 0.0 0.0 74-75 0.55 0.0 0.0 0.0 0.0 76-77 0.6125 0.0 0.0 0.0 0.0 78-79 0.7124999999999999 0.0 0.0 0.0 0.0 80-81 0.7875000000000001 0.0 0.0 0.0 0.0 82-83 0.85 0.0 0.0 0.0 0.0 84-85 0.9625 0.0 0.0 0.0 0.0 86-87 1.1375 0.0 0.0 0.0 0.0 88-89 1.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844642 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844642_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3955 34.0 31.0 34.0 30.0 34.0 2 32.51975 34.0 31.0 34.0 30.0 34.0 3 32.45825 34.0 31.0 34.0 30.0 34.0 4 35.8855 37.0 37.0 37.0 33.0 37.0 5 35.8845 37.0 37.0 37.0 33.0 37.0 6 35.65825 37.0 36.0 37.0 33.0 37.0 7 35.76 37.0 37.0 37.0 35.0 37.0 8 35.7015 37.0 37.0 37.0 33.0 37.0 9 36.9315 39.0 38.0 39.0 34.0 39.0 10-11 36.772125 39.0 38.0 39.0 33.0 39.0 12-13 36.600375 39.0 38.5 39.0 33.5 39.0 14-15 38.049625 41.0 39.5 41.0 33.5 41.0 16-17 38.01525 41.0 39.5 41.0 33.5 41.0 18-19 37.550375 41.0 39.0 41.0 32.0 41.0 20-21 36.984 41.0 39.0 41.0 31.0 41.0 22-23 36.877875 41.0 39.0 41.0 30.0 41.0 24-25 36.86225 41.0 39.0 41.0 30.0 41.0 26-27 36.623000000000005 41.0 38.5 41.0 30.0 41.0 28-29 36.477875 41.0 38.5 41.0 29.5 41.0 30-31 36.375875 41.0 38.0 41.0 29.5 41.0 32-33 36.107 40.5 38.0 41.0 27.0 41.0 34-35 36.14725 40.0 38.0 41.0 29.0 41.0 36-37 35.955 40.0 38.0 41.0 25.5 41.0 38-39 35.795249999999996 40.0 38.0 41.0 24.0 41.0 40-41 35.5035 40.0 38.0 41.0 16.0 41.0 42-43 35.327375 40.0 37.5 41.0 13.5 41.0 44-45 34.888 40.0 36.5 41.0 2.0 41.0 46-47 34.915375 40.0 37.0 41.0 2.0 41.0 48-49 34.8735 40.0 36.5 41.0 2.0 41.0 50-51 34.35025 39.5 35.5 40.5 2.0 41.0 52-53 34.079875 39.0 35.0 40.5 4.5 41.0 54-55 34.496750000000006 39.5 35.0 41.0 2.0 41.0 56-57 34.682625 40.0 35.0 41.0 2.0 41.0 58-59 34.794375 40.0 35.0 41.0 2.0 41.0 60-61 34.364125 39.0 35.0 41.0 2.0 41.0 62-63 33.953625 39.0 35.0 41.0 2.0 41.0 64-65 33.71525 38.0 35.0 41.0 2.0 41.0 66-67 33.25075 37.0 35.0 40.5 2.0 41.0 68-69 32.877250000000004 37.0 35.0 39.5 2.0 41.0 70-71 32.239125 36.0 34.0 39.0 2.0 41.0 72-73 31.998625 36.0 34.0 39.0 2.0 41.0 74-75 31.738 35.0 34.0 37.5 2.0 40.5 76-77 31.373 35.0 34.0 37.0 2.0 39.0 78-79 30.957875 35.0 33.5 36.5 2.0 39.0 80-81 30.597250000000003 35.0 33.0 36.0 2.0 38.0 82-83 29.975749999999998 35.0 32.5 35.5 2.0 37.0 84-85 25.665374999999997 33.5 17.5 35.0 2.0 36.0 86-87 25.72 34.0 16.0 35.0 2.0 36.0 88-89 25.69725 34.0 17.5 35.0 2.0 35.5 90-91 25.625375 33.0 18.5 35.0 2.0 35.0 92-93 25.897375 33.5 23.0 35.0 2.0 35.0 94-95 25.753125 33.0 21.5 35.0 2.0 35.0 96-97 25.41575 33.0 19.0 35.0 2.0 35.0 98-99 25.03125 33.0 7.5 35.0 2.0 35.0 100-101 23.140124999999998 31.0 2.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 37.0 4 35.0 5 3.0 6 52.0 7 74.0 8 43.0 9 37.0 10 31.0 11 26.0 12 18.0 13 13.0 14 16.0 15 17.0 16 9.0 17 9.0 18 9.0 19 13.0 20 11.0 21 15.0 22 8.0 23 11.0 24 9.0 25 17.0 26 30.0 27 39.0 28 43.0 29 45.0 30 63.0 31 90.0 32 149.0 33 114.0 34 142.0 35 261.0 36 443.0 37 817.0 38 1004.0 39 230.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.900000000000002 13.15 5.75 54.2 2 13.975000000000001 16.725 53.449999999999996 15.85 3 19.15 20.775 30.15 29.925 4 24.875 24.625 28.725 21.775 5 24.975 28.000000000000004 32.65 14.374999999999998 6 20.191339375629404 32.17522658610272 32.4269889224572 15.206445115810673 7 16.8 18.05 49.425000000000004 15.725 8 15.666582977655032 22.570926437358775 41.074566909364805 20.68792367562139 9 16.756066411238827 19.310344827586206 44.31673052362707 19.616858237547895 10-11 20.555341303509447 28.47409692762566 32.497750353515876 18.472811415349017 12-13 19.48353776630084 24.118786313750807 36.72046481601033 19.677211103938024 14-15 20.50518134715026 25.025906735751295 35.479274611398964 18.989637305699482 16-17 21.18073537027447 24.495080269290522 34.2180217503884 20.106162610046606 18-19 21.08642609477334 25.87646076794658 32.5542570951586 20.482856042121483 20-21 21.795530439249937 27.31826354996147 30.50346776265091 20.382738248137684 22-23 21.955578248659688 27.993362267041107 28.98902221087567 21.062037273423538 24-25 22.087132725430596 27.760891590678828 28.685410334346507 21.466565349544073 26-27 20.66708621774701 29.7293895531781 28.495909376966644 21.107614852108245 28-29 22.06809583858764 28.32282471626734 29.00378310214376 20.60529634300126 30-31 22.27946720281478 29.002261874842926 28.059814023624025 20.65845689871827 32-33 21.670428893905193 28.618008527715073 28.179082016553803 21.532480561825935 34-35 22.281100176633863 27.92076709563462 27.731516527882917 22.0666161998486 36-37 21.18784179066514 29.098308533638562 27.99186061299758 21.721989062698714 38-39 21.477619532044763 28.25534079348932 28.980162767039673 21.286876907426247 40-41 21.06881968473664 28.73253876714084 28.8478790208894 21.350762527233115 42-43 21.474441304906243 28.2686873876188 28.615463652709995 21.64140765476496 44-45 21.624418003103983 27.612519399896534 29.229177444386963 21.53388515261252 46-47 21.777835118049286 28.18991097922849 28.44794220100632 21.584311701715908 48-49 21.333333333333336 27.93527508090615 29.203883495145632 21.527508090614887 50-51 22.48742097793833 28.886595278028643 27.428718874983872 21.197264869049153 52-53 22.036706602090238 29.186846800917664 27.389752740249808 21.38669385674229 54-55 21.659687856870953 28.384722750919934 28.194391574673265 21.761197817535844 56-57 22.548771218647072 28.13529262731188 27.185203952368887 22.130732201672156 58-59 22.50095020904599 28.417585202077788 27.4420372481946 21.639427340681618 60-61 23.009745601822555 27.52816099227946 27.705353752689533 21.756739653208452 62-63 21.46670055922725 28.88917132689375 27.402135231316727 22.24199288256228 64-65 22.066572419997428 28.222593496979826 27.28441074412029 22.426423338902453 66-67 21.987641606591144 28.656024716786817 27.690525231719874 21.66580844490216 68-69 21.175710594315245 29.521963824289404 28.11369509043928 21.188630490956072 70-71 21.550387596899228 28.656330749354 27.532299741602067 22.260981912144704 72-73 22.47103241765395 28.26454888686369 27.19697955995313 22.06743913552923 74-75 21.967127576310983 28.372032350639188 27.132794156013567 22.528045917036263 76-77 22.25952227243383 29.218850871530023 27.566171723692705 20.95545513234345 78-79 22.499347088012538 29.57691303212327 26.4690519717942 21.454687908069992 80-81 22.39192337561481 29.42013978772974 26.404348951592027 21.783587885063422 82-83 22.31330856923274 29.44793134366594 26.629947483028047 21.608812604073268 84-85 22.63344146269537 28.737835446770866 27.263344146269535 21.36537894426423 86-87 22.659094218727247 28.877238968982088 26.85306538517548 21.61060142711519 88-89 23.0213790174147 29.491717400538015 26.589268016423617 20.897635565623673 90-91 22.722834426000837 28.316362114660343 26.74013112010043 22.220672339238387 92-93 23.708791208791208 28.20054945054945 26.799450549450547 21.291208791208792 94-95 23.106423777564718 29.14669223394056 26.106012874948636 21.64087111354609 96-97 23.827160493827158 29.53360768175583 26.28257887517147 20.35665294924554 98-99 23.78680479825518 28.803162486368596 26.11777535441658 21.292257360959653 100-101 22.961257111893797 29.815768084529935 26.253047954483883 20.96992684909239 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 4.0 2 5.0 3 4.5 4 7.5 5 8.5 6 6.5 7 5.0 8 7.5 9 6.0 10 4.0 11 3.5 12 4.0 13 7.0 14 10.5 15 12.0 16 9.0 17 7.0 18 9.5 19 10.5 20 9.0 21 13.5 22 17.5 23 17.5 24 20.0 25 25.0 26 29.0 27 24.0 28 25.0 29 35.5 30 34.5 31 44.5 32 63.5 33 76.5 34 98.0 35 111.0 36 128.0 37 150.0 38 156.5 39 175.5 40 202.5 41 200.0 42 196.5 43 200.5 44 191.5 45 196.0 46 186.0 47 164.0 48 154.0 49 138.0 50 123.5 51 100.5 52 76.0 53 66.5 54 61.5 55 57.0 56 44.5 57 37.0 58 31.5 59 24.0 60 23.5 61 19.5 62 15.5 63 12.0 64 9.5 65 10.5 66 12.5 67 13.5 68 11.5 69 5.5 70 5.5 71 7.0 72 5.5 73 5.0 74 2.0 75 0.0 76 0.0 77 1.0 78 1.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.7000000000000001 7 0.0 8 0.42500000000000004 9 2.125 10-11 2.7625 12-13 3.1875 14-15 3.5000000000000004 16-17 3.45 18-19 2.6625 20-21 2.675 22-23 2.075 24-25 1.3 26-27 0.6875 28-29 0.8750000000000001 30-31 0.525 32-33 0.325 34-35 0.9249999999999999 36-37 1.7125000000000001 38-39 1.7000000000000002 40-41 2.4625 42-43 2.675 44-45 3.35 46-47 3.1125 48-49 3.4375000000000004 50-51 3.1125 52-53 1.925 54-55 1.4874999999999998 56-57 1.325 58-59 1.3375 60-61 1.2375 62-63 1.6500000000000001 64-65 2.7375 66-67 2.9000000000000004 68-69 3.25 70-71 3.25 72-73 3.9875000000000003 74-75 4.175 76-77 3.1875 78-79 4.275 80-81 3.4250000000000003 82-83 2.4125 84-85 15.225 86-87 14.1625 88-89 11.7125 90-91 10.3875 92-93 9.0 94-95 8.737499999999999 96-97 8.875 98-99 8.3 100-101 7.725 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 97.08966963817515 92.575 2 1.9664394336654432 3.75 3 0.550603041426324 1.575 4 0.2097535395909806 0.8 5 0.05243838489774515 0.25 6 0.026219192448872573 0.15 7 0.026219192448872573 0.17500000000000002 8 0.0 0.0 9 0.05243838489774515 0.44999999999999996 >10 0.026219192448872573 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGGTTTTCTCTTTGTGATTGAATCAATTGAGGAGAGGATACGACTTCTC 11 0.27499999999999997 No Hit CTGTGTTCCGTGTGTGTTTCAGCAGTGTGCTGTGCTGAGTGCTACCTTGA 9 0.22499999999999998 No Hit CTTCGTTTTATTATCAACAACTCCCGCACGTACGTACGGTACATACGTAC 9 0.22499999999999998 No Hit CTCTCTCTGAATGTGTGCGAGTGTGTCGGTGTCTGTGTTCCGTGTGTGTT 7 0.17500000000000002 No Hit CTCTGAATGTGTGCGAGTGTGTCGGTGTCTGTGTTCCGTGTGTGTTTCAG 6 0.15 No Hit GCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTTT 5 0.125 No Hit CTCCTTTATTCAAATCGAAGACAGCATGCGAGCAGTACACAAGAACAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.025 0.0 0.0 0.025 0.0 44-45 0.025 0.0 0.0 0.025 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.05 0.0 0.0 0.025 0.0 50-51 0.075 0.0 0.0 0.025 0.0 52-53 0.1 0.0 0.0 0.025 0.0 54-55 0.125 0.0 0.0 0.025 0.0 56-57 0.125 0.0 0.0 0.025 0.0 58-59 0.1375 0.0 0.0 0.025 0.0 60-61 0.2375 0.0 0.0 0.025 0.0 62-63 0.2625 0.0 0.0 0.025 0.0 64-65 0.275 0.0 0.0 0.025 0.0 66-67 0.3125 0.0 0.0 0.025 0.0 68-69 0.3625 0.0 0.0 0.025 0.0 70-71 0.42500000000000004 0.0 0.0 0.025 0.0 72-73 0.475 0.0 0.0 0.025 0.0 74-75 0.475 0.0 0.0 0.025 0.0 76-77 0.475 0.0 0.0 0.025 0.0 78-79 0.475 0.0 0.0 0.025 0.0 80-81 0.475 0.0 0.0 0.025 0.0 82-83 0.475 0.0 0.0 0.025 0.0 84-85 0.5625 0.0 0.0 0.025 0.0 86-87 0.7 0.0 0.0 0.025 0.0 88-89 0.825 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 55 1.3278623E-10 66.65455 1 GAAGAGC 15 0.0075356965 50.916664 92-93 >>END_MODULE Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997616 spots for SRR13844642.sra Written 997616 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra Read 997601 spots for SRR13844642.sra Written 997601 spots for SRR13844642.sra SRR ids: ['SRR13844642.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cok_t1v6 SRR13844642.sra spots: 19952035 blocks: [[1, 997601], [997602, 1995202], [1995203, 2992803], [2992804, 3990404], [3990405, 4988005], [4988006, 5985606], [5985607, 6983207], [6983208, 7980808], [7980809, 8978409], [8978410, 9976010], [9976011, 10973611], [10973612, 11971212], [11971213, 12968813], [12968814, 13966414], [13966415, 14964015], [14964016, 15961616], [15961617, 16959217], [16959218, 17956818], [17956819, 18954419], [18954420, 19952035]] SRR13844642 file size 4810433 SRR13844642 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844642 SRR13844642_1.fastq SRR13844642_2.fastq Input file: SRR13844642_1.fastq Paired file: SRR13844642_2.fastq trimmed: SRR13844642-trimmed-pair1.fastq, SRR13844642-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:57:49 2024 >> started Fri Dec 6 12:58:07 2024 >> done (17.618s) 19952035 read pairs processed; of these: 317186 ( 1.59%) short read pairs filtered out after trimming by size control 168212 ( 0.84%) empty read pairs filtered out after trimming by size control 19466637 (97.57%) read pairs available; of these: 10440846 (53.63%) trimmed read pairs available after processing 9025791 (46.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 104 0.00% 20 196 0.00% 21 295 0.00% 22 359 0.00% 23 421 0.00% 24 481 0.00% 25 548 0.00% 26 659 0.00% 27 815 0.00% 28 859 0.00% 29 1014 0.01% 30 1279 0.01% 31 1561 0.01% 32 1899 0.01% 33 2406 0.01% 34 3074 0.02% 35 3882 0.02% 36 4816 0.02% 37 6028 0.03% 38 7112 0.04% 39 8393 0.04% 40 9838 0.05% 41 10788 0.06% 42 12188 0.06% 43 13638 0.07% 44 14388 0.07% 45 15876 0.08% 46 17290 0.09% 47 18426 0.09% 48 20167 0.10% 49 22227 0.11% 50 25263 0.13% 51 31253 0.16% 52 40006 0.21% 53 45602 0.23% 54 47173 0.24% 55 45936 0.24% 56 45095 0.23% 57 44311 0.23% 58 45877 0.24% 59 205937 1.06% 60 246907 1.27% 61 216628 1.11% 62 206171 1.06% 63 172353 0.89% 64 127371 0.65% 65 96899 0.50% 66 75225 0.39% 67 62339 0.32% 68 55017 0.28% 69 50371 0.26% 70 48940 0.25% 71 45539 0.23% 72 43493 0.22% 73 41567 0.21% 74 41835 0.21% 75 45933 0.24% 76 50493 0.26% 77 51385 0.26% 78 49489 0.25% 79 46838 0.24% 80 46081 0.24% 81 50529 0.26% 82 51670 0.27% 83 55067 0.28% 84 63454 0.33% 85 62844 0.32% 86 71182 0.37% 87 81968 0.42% 88 97797 0.50% 89 122585 0.63% 90 178984 0.92% 91 401525 2.06% 92 2645449 13.59% 93 709392 3.64% 94 429890 2.21% 95 336620 1.73% 96 320607 1.65% 97 347443 1.78% 98 405421 2.08% 99 498875 2.56% 100 911158 4.68% 101 9025791 46.37% 19466637 reads passed initial QC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=26 prefix-density=1.08 prefix-fanout=2.0 sequence=ACCGTACGTACG criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=103.82 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=7.7 sequence=TGTGTGTATGTGTGAGCTGGGGGTGTCCGGTTCGTGTGCGCCCCGTGGTTATACTTGCAGGGGGTGGTTGTTAATTTTGCTTTCTTCATACTATGTCAACAAGATGAGGTGATGCTTAATTTGGCTTGGCCCGGGGGTTAACGTAGGCCAGACCAAAGATAAGGCACACGATCAATCAAT criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=31 prefix-density=0.92 prefix-fanout=2.2 sequence=TACGTACGCGCGTACGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=122.33 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=7.3 sequence=TGTGTGTGTATGTGTGAGCTGGGGGTGTCCGGTTCGTGTGCGCCCCGTGGTTATACTTGCAGGGGGTGGTTGTTAATTTTGCTTTCTTCATACTATGTCAACAAGATGAGGTGATGCTTAATTTGGCT SRR13844642 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:58:39 Started mapping on | Dec 06 12:58:39 Finished on | Dec 06 12:59:35 Mapping speed, Million of reads per hour | 1251.43 Number of input reads | 19466637 Average input read length | 186 UNIQUE READS: Uniquely mapped reads number | 17811875 Uniquely mapped reads % | 91.50% Average mapped length | 185.12 Number of splices: Total | 3544850 Number of splices: Annotated (sjdb) | 3229546 Number of splices: GT/AG | 3412388 Number of splices: GC/AG | 45649 Number of splices: AT/AC | 1246 Number of splices: Non-canonical | 85567 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.33% Deletion average length | 1.03 Insertion rate per base | 0.02% Insertion average length | 1.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 797415 % of reads mapped to multiple loci | 4.10% Number of reads mapped to too many loci | 7699 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.29% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2077632 2077632 2077632 N_multimapping 797415 797415 797415 N_noFeature 629604 8990995 8922542 N_ambiguous 623682 50762 49939 UnstrandedReadsAssigned:16558589 PositiveStrandReadsAssigned:8770118 NegativeStrandReadsAssigned:8839394 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844642 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844642-trimmed-pair1.fastq SRR13844642-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,466,637 reads, 18,321,190 reads pseudoaligned [quant] estimated average fragment length: 162.802 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52973 SRR13844642.ke.tsv 35125 SRR13844642.se.tsv 88098 total ==> SRR13844642.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 774.337 0 0 PNS24247 1044 882.198 0 0 PNS24249 1928 1766.2 3.86477 0.148889 PNS24246 1044 882.198 0 0 PNS24248 1044 882.198 0 0 PNS24244 1471 1309.2 306.135 15.9107 PNS24243 293 135.801 0 0 KQK14069 1603 1441.2 6691.98 315.945 KQK14071 474 313.011 38.0755 8.27688 ==> SRR13844642.se.tsv <== BRADI_1g14170v3 6763 BRADI_1g53295v3 52 BRADI_1g59795v3 271 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 547 BRADI_1g74790v3 194 BRADI_1g09890v3 223 BRADI_1g77505v3 406 BRADI_1g48960v3 0 SRR13844642 completed mapping pipeline successfully