Starting /dee2/code/volunteer_pipeline.sh SRR13844643 current disk space = 1551106068480 free memory = 1598978168 SRR13844643 SRAfilesize 2187e9f73ea77f2bb4fc98f27ade3d06 SRR13844643.sra SRR13844643.sra file validated SRR13844643 is paired end SRR13844643 is conventional basespace SRR13844643 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844643_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0375 34.0 33.0 34.0 31.0 34.0 2 33.184 34.0 33.0 34.0 31.0 34.0 3 33.123 34.0 33.0 34.0 31.0 34.0 4 36.539 37.0 37.0 37.0 35.0 37.0 5 36.5195 37.0 37.0 37.0 35.0 37.0 6 36.46675 37.0 37.0 37.0 35.0 37.0 7 36.41575 37.0 37.0 37.0 35.0 37.0 8 36.48625 37.0 37.0 37.0 35.0 37.0 9 38.4245 39.0 39.0 39.0 37.0 39.0 10-11 38.231875 39.0 39.0 39.0 37.0 39.0 12-13 38.290875 39.0 39.0 39.0 37.0 39.0 14-15 39.806125 41.0 40.0 41.0 38.0 41.0 16-17 39.538875000000004 41.0 39.5 41.0 37.0 41.0 18-19 39.473 41.0 39.5 41.0 36.0 41.0 20-21 39.5295 41.0 40.0 41.0 36.0 41.0 22-23 39.1975 41.0 39.5 41.0 36.0 41.0 24-25 39.014125 41.0 39.5 41.0 36.0 41.0 26-27 38.7585 41.0 39.0 41.0 36.0 41.0 28-29 38.4995 41.0 39.0 41.0 36.0 41.0 30-31 38.518 41.0 39.0 41.0 36.0 41.0 32-33 38.315 41.0 39.0 41.0 35.0 41.0 34-35 38.050375 40.5 39.0 41.0 34.5 41.0 36-37 38.07725 40.5 38.5 41.0 34.5 41.0 38-39 37.86625 40.0 38.0 41.0 34.0 41.0 40-41 37.732 40.0 38.0 41.0 33.5 41.0 42-43 37.630624999999995 40.0 38.0 41.0 33.5 41.0 44-45 37.671875 40.0 38.0 41.0 33.5 41.0 46-47 37.626000000000005 40.0 38.0 41.0 33.0 41.0 48-49 37.694625 40.0 38.0 41.0 33.5 41.0 50-51 37.71225 40.0 38.0 41.0 33.5 41.0 52-53 37.502375 40.0 38.0 41.0 33.0 41.0 54-55 37.32325 40.0 37.5 41.0 33.0 41.0 56-57 37.34587500000001 40.0 37.0 41.0 33.0 41.0 58-59 37.121750000000006 40.0 37.0 41.0 33.0 41.0 60-61 36.622249999999994 39.0 36.0 41.0 31.5 41.0 62-63 36.870000000000005 39.0 36.0 41.0 33.0 41.0 64-65 36.575625 39.0 35.0 41.0 32.5 41.0 66-67 36.35275 38.5 35.0 41.0 33.0 41.0 68-69 35.84175 37.0 35.0 40.0 32.0 41.0 70-71 35.30225 37.0 35.0 39.0 31.0 41.0 72-73 35.088499999999996 36.0 35.0 39.0 31.5 41.0 74-75 34.75475 36.0 35.0 39.0 31.5 40.5 76-77 33.97687500000001 35.0 34.0 37.0 30.5 39.0 78-79 33.86125 35.0 34.5 37.0 30.5 39.0 80-81 33.79875 35.0 35.0 36.5 31.0 38.5 82-83 33.61575 35.0 35.0 36.0 31.0 37.0 84-85 33.17825 35.0 34.5 36.0 30.0 37.0 86-87 32.937 35.0 34.0 35.0 29.5 36.5 88-89 32.948875 35.0 34.0 35.0 30.5 36.0 90-91 32.814750000000004 35.0 34.0 35.0 30.5 36.0 92-93 32.79275 35.0 34.0 35.0 30.5 36.0 94-95 32.650375 35.0 34.0 35.0 30.0 36.0 96-97 32.47925 35.0 34.0 35.0 29.5 36.0 98-99 32.332 35.0 34.0 35.0 29.5 35.0 100-101 31.354875 34.5 32.5 35.0 25.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 6.0 8 18.0 9 36.0 10 30.0 11 28.0 12 13.0 13 4.0 14 3.0 15 2.0 16 6.0 17 2.0 18 1.0 19 6.0 20 0.0 21 6.0 22 4.0 23 8.0 24 10.0 25 8.0 26 13.0 27 7.0 28 13.0 29 26.0 30 41.0 31 28.0 32 55.0 33 88.0 34 101.0 35 198.0 36 360.0 37 936.0 38 1511.0 39 432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.455863965991497 15.228807201800452 7.376844211052763 53.93848462115529 2 16.35 18.975 50.025 14.649999999999999 3 22.625 23.775 27.625 25.974999999999998 4 24.425 29.9 25.424999999999997 20.25 5 25.724999999999998 30.4 28.575 15.299999999999999 6 20.0 35.075 30.15 14.774999999999999 7 16.950000000000003 19.075 46.975 17.0 8 16.925 22.25 39.2 21.625 9 18.45 19.7 41.25 20.599999999999998 10-11 21.987499999999997 31.5 28.525 17.9875 12-13 20.5625 25.7125 34.0875 19.6375 14-15 21.6 26.1125 32.6375 19.650000000000002 16-17 21.5375 27.175 31.2375 20.05 18-19 21.087500000000002 27.6375 30.312499999999996 20.962500000000002 20-21 21.6625 27.5125 30.7125 20.1125 22-23 21.65 27.650000000000002 30.337500000000002 20.3625 24-25 21.099999999999998 29.1875 29.325000000000003 20.3875 26-27 22.380595148787197 27.94448612153038 28.89472368092023 20.78019504876219 28-29 22.4375 28.537499999999998 27.6875 21.337500000000002 30-31 21.637500000000003 29.2 27.925 21.2375 32-33 20.8125 29.3875 28.4 21.4 34-35 21.767941985496375 29.394848712178046 27.51937984496124 21.31782945736434 36-37 22.50562640660165 28.694673668417103 27.59439859964991 21.205301325331334 38-39 21.875 28.575 28.675 20.875 40-41 21.66791697924481 29.057264316079017 27.969492373093274 21.305326331582897 42-43 22.537499999999998 28.212500000000002 27.500000000000004 21.75 44-45 21.987499999999997 29.5 27.224999999999998 21.2875 46-47 22.162499999999998 28.499999999999996 28.050000000000004 21.2875 48-49 21.8875 27.237499999999997 28.962500000000002 21.912499999999998 50-51 22.075 28.8625 27.1125 21.95 52-53 21.7 29.225 27.9125 21.1625 54-55 21.775 29.1875 27.750000000000004 21.2875 56-57 21.975 28.1 27.6625 22.2625 58-59 21.975 28.537499999999998 27.8625 21.625 60-61 22.5 28.349999999999998 27.6375 21.512500000000003 62-63 22.3375 28.287499999999998 27.437499999999996 21.9375 64-65 21.6125 28.812500000000004 26.9125 22.662499999999998 66-67 21.8125 29.049999999999997 27.3375 21.8 68-69 22.112499999999997 27.950000000000003 28.225 21.712500000000002 70-71 21.15 28.8875 27.6 22.3625 72-73 21.6 29.462500000000002 27.287499999999998 21.65 74-75 22.35 29.025000000000002 27.212500000000002 21.4125 76-77 21.425 29.862499999999997 27.525 21.1875 78-79 22.7125 28.849999999999998 27.85 20.5875 80-81 21.7375 29.75 27.450000000000003 21.0625 82-83 21.6875 27.875 28.487499999999997 21.95 84-85 21.825 28.3375 28.1375 21.7 86-87 21.837500000000002 28.7 28.050000000000004 21.4125 88-89 22.5125 28.025 28.3375 21.125 90-91 21.575 29.3375 27.775 21.3125 92-93 21.1375 29.1125 27.55 22.2 94-95 21.2875 29.1875 27.650000000000002 21.875 96-97 20.6625 29.212500000000002 28.1125 22.0125 98-99 22.675 28.7375 27.500000000000004 21.087500000000002 100-101 21.15 29.1375 28.025 21.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 1.0 11 0.5 12 2.0 13 3.5 14 3.5 15 4.0 16 3.5 17 3.0 18 2.5 19 5.0 20 7.0 21 7.0 22 7.5 23 9.0 24 10.0 25 9.0 26 8.0 27 15.0 28 21.5 29 21.0 30 25.0 31 33.0 32 43.5 33 59.5 34 85.5 35 106.5 36 130.5 37 156.0 38 177.5 39 220.0 40 244.5 41 244.0 42 237.0 43 221.5 44 213.5 45 208.5 46 191.0 47 154.0 48 138.0 49 129.0 50 124.0 51 114.0 52 97.5 53 89.0 54 69.0 55 56.5 56 42.5 57 35.5 58 31.5 59 22.5 60 19.0 61 17.0 62 19.5 63 21.0 64 14.0 65 10.0 66 10.0 67 9.0 68 7.5 69 3.5 70 3.0 71 5.0 72 6.0 73 5.0 74 3.0 75 2.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.025 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.025 36-37 0.025 38-39 0.0 40-41 0.025 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.25 #Duplication Level Percentage of deduplicated Percentage of total 1 97.9948586118252 95.3 2 1.4910025706940875 2.9000000000000004 3 0.35989717223650386 1.05 4 0.07712082262210797 0.3 5 0.051413881748071974 0.25 6 0.0 0.0 7 0.0 0.0 8 0.025706940874035987 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCC 8 0.2 No Hit CTTAGAACAGGAAACCATTCATACTGCCAGGATCCATCCACATGGGTTCA 5 0.125 No Hit CTTCGTTTTATTATCAACAACTCCCGCACGTACGTACGGTACATACGTAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACCTTT 15 0.009957196 47.5 22-23 >>END_MODULE SRR13844643 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844643_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3515 34.0 31.0 34.0 30.0 34.0 2 32.49 34.0 31.0 34.0 30.0 34.0 3 32.4105 34.0 31.0 34.0 29.0 34.0 4 35.8825 37.0 37.0 37.0 33.0 37.0 5 35.838 37.0 35.0 37.0 33.0 37.0 6 35.6235 37.0 36.0 37.0 33.0 37.0 7 35.737 37.0 37.0 37.0 33.0 37.0 8 35.66075 37.0 36.0 37.0 32.0 37.0 9 36.61825 39.0 38.0 39.0 33.0 39.0 10-11 36.452625 39.0 38.0 39.0 33.0 39.0 12-13 36.32875 39.0 38.0 39.0 32.5 39.0 14-15 37.700625 41.0 39.0 41.0 32.5 41.0 16-17 37.661125 41.0 39.0 41.0 33.0 41.0 18-19 37.390375 41.0 39.0 41.0 32.5 41.0 20-21 37.048500000000004 41.0 38.5 41.0 31.0 41.0 22-23 36.931375 41.0 38.5 41.0 31.0 41.0 24-25 36.9895 41.0 39.0 41.0 30.5 41.0 26-27 36.721625 41.0 38.0 41.0 29.5 41.0 28-29 36.598625 41.0 38.0 41.0 29.5 41.0 30-31 36.429 40.5 38.0 41.0 30.0 41.0 32-33 36.169125 40.0 38.0 41.0 29.0 41.0 34-35 36.230999999999995 40.0 38.0 41.0 29.5 41.0 36-37 36.005375 40.0 38.0 41.0 26.5 41.0 38-39 35.71575 40.0 38.0 41.0 23.0 41.0 40-41 35.437875000000005 40.0 37.5 41.0 17.0 41.0 42-43 35.279250000000005 40.0 37.5 41.0 12.5 41.0 44-45 34.844 40.0 36.0 41.0 2.0 41.0 46-47 34.8635 40.0 36.0 41.0 2.0 41.0 48-49 34.90425 40.0 36.5 41.0 2.0 41.0 50-51 34.37075 39.5 36.0 40.5 2.0 40.5 52-53 34.141125 39.0 35.5 40.5 6.5 41.0 54-55 34.623374999999996 39.5 35.5 41.0 5.5 41.0 56-57 34.818625 40.0 35.5 41.0 2.0 41.0 58-59 34.9385 40.0 35.5 41.0 2.0 41.0 60-61 34.54175 39.5 35.0 41.0 2.0 41.0 62-63 34.12625 39.0 35.0 41.0 2.0 41.0 64-65 33.987875 39.0 35.0 41.0 2.0 41.0 66-67 33.62325 38.0 35.0 41.0 2.0 41.0 68-69 33.220749999999995 37.0 35.0 40.0 2.0 41.0 70-71 32.493375 36.5 34.0 39.0 2.0 41.0 72-73 32.312875 36.0 34.0 39.0 2.0 41.0 74-75 32.043625000000006 36.0 34.0 38.5 2.0 40.5 76-77 31.616 35.0 34.0 37.0 2.0 39.0 78-79 31.232 35.0 34.0 37.0 2.0 39.0 80-81 30.77825 35.0 33.5 36.0 2.0 38.5 82-83 30.289749999999998 35.0 33.0 36.0 2.0 37.0 84-85 25.30775 34.0 2.0 35.0 2.0 36.0 86-87 25.276875 34.0 6.0 35.0 2.0 36.0 88-89 25.289749999999998 34.0 11.0 35.0 2.0 36.0 90-91 25.50325 33.0 15.0 35.0 2.0 35.0 92-93 25.909374999999997 33.5 23.0 35.0 2.0 35.0 94-95 25.9435 34.0 23.0 35.0 2.0 35.0 96-97 25.682875 33.5 21.5 35.0 2.0 35.0 98-99 25.371625 33.0 18.0 35.0 2.0 35.0 100-101 23.553125 31.5 2.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 41.0 4 34.0 5 8.0 6 33.0 7 82.0 8 29.0 9 39.0 10 52.0 11 25.0 12 24.0 13 11.0 14 14.0 15 6.0 16 6.0 17 11.0 18 12.0 19 11.0 20 12.0 21 11.0 22 7.0 23 9.0 24 17.0 25 19.0 26 25.0 27 42.0 28 37.0 29 48.0 30 57.0 31 89.0 32 157.0 33 124.0 34 157.0 35 248.0 36 422.0 37 777.0 38 1052.0 39 236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.375 14.475 7.3 53.849999999999994 2 14.725 18.85 52.0 14.424999999999999 3 19.650000000000002 22.75 30.425 27.175 4 24.975 28.525 26.85 19.650000000000002 5 25.674999999999997 29.4 29.525000000000002 15.4 6 19.304435483870968 32.45967741935484 32.03125 16.204637096774192 7 17.45 18.224999999999998 49.4 14.924999999999999 8 17.92168674698795 21.335341365461847 39.081325301204814 21.66164658634538 9 19.148387096774194 18.78709677419355 42.167741935483875 19.896774193548385 10-11 20.913929637803452 29.533947812540568 30.46864857847592 19.08347397118006 12-13 19.69775924960917 25.195414278269933 35.18759770713913 19.91922876498176 14-15 21.4173640167364 26.04602510460251 32.70135983263599 19.835251046025103 16-17 20.690105868513918 27.421252123905372 31.98274735328715 19.905894654293558 18-19 21.599169262720665 26.57061266874351 30.63343717549325 21.196780893042575 20-21 21.1865506945346 27.76840192132935 29.80656886927171 21.23847851486434 22-23 22.036082474226802 28.13144329896907 29.40721649484536 20.425257731958762 24-25 21.290650406504067 28.760162601626014 28.442581300813007 21.506605691056908 26-27 21.702395964691046 28.991172761664565 28.14627994955864 21.16015132408575 28-29 22.660098522167488 29.60717443476064 26.702033598585324 21.03069344448655 30-31 22.27809906965049 29.444304752325873 27.369876791551423 20.907719386472216 32-33 21.884803614004266 29.3386874137282 27.85794955452378 20.918559417743758 34-35 21.77317504420308 29.085627683758524 27.45642839100783 21.684768881030564 36-37 21.72523961661342 28.626198083067095 27.78274760383387 21.86581469648562 38-39 21.98617865369849 28.3849500895828 29.216790376247758 20.412080880470953 40-41 22.715506083354907 28.307015273103804 28.177582190007765 20.799896453533524 42-43 22.61456575360249 28.67713877709983 27.87225756198883 20.836037907308842 44-45 21.948356807511736 28.20813771517997 27.947313510693796 21.896191966614502 46-47 22.254034357105674 28.552837064029152 27.706923477355545 21.486205101509633 48-49 21.125473299386343 28.7635461548505 28.00626713670192 22.104713409061237 50-51 21.294607970825734 28.692367804115655 27.455066423547798 22.55795780151081 52-53 22.327852004110994 29.48355601233299 27.852004110996916 20.336587872559093 54-55 21.133231240428792 28.713629402756506 27.986217457886674 22.166921898928024 56-57 21.38779652416593 29.075225168083218 28.37752124825574 21.159457059495114 58-59 20.965079365079365 29.25714285714286 27.58095238095238 22.1968253968254 60-61 21.560678996706358 29.148720547251077 28.198631872308084 21.091968583734484 62-63 21.914132379248656 28.814209046767186 28.098645540506006 21.17301303347815 64-65 21.581612777561357 29.69744189066355 26.892611349175432 21.828333982599663 66-67 21.810859963626918 27.87737074564822 28.00727461678358 22.30449467394128 68-69 21.587052988775778 28.16496998172801 28.191072826938136 22.056904202558076 70-71 21.187214611872147 28.78016960208741 28.688845401174166 21.343770384866275 72-73 22.111213356119364 28.39489943473117 27.777047456290262 21.71683975285921 74-75 22.31437598736177 27.90942601369142 27.935755660874147 21.84044233807267 76-77 22.236704900938477 28.845151199165798 27.632950990615225 21.2851929092805 78-79 21.671500131821777 28.76351173213815 27.32665436330082 22.238333772739256 80-81 21.558373643613542 29.284873839717612 28.029807818015428 21.126944698653418 82-83 22.286896908549995 29.4399172164015 27.447936877506145 20.82524899754236 84-85 21.84065934065934 28.785103785103782 28.15934065934066 21.214896214896214 86-87 22.628726287262875 28.289671785606746 26.784101174345075 22.297500752785307 88-89 21.144927536231883 29.246376811594203 27.811594202898547 21.797101449275363 90-91 21.72678216415791 28.50042601533655 27.46378869639307 22.30900312411247 92-93 22.080827856243882 27.968116347364003 27.198993147811496 22.75206264858062 94-95 20.97872932017239 29.973585430279435 26.776032253579867 22.271652995968303 96-97 22.343553128937423 29.06341873162537 27.607447851042977 20.98558028839423 98-99 21.234396671289876 29.02912621359223 27.739251040221912 21.997226074895977 100-101 21.999175030936343 29.96012649525643 26.907740959714012 21.13295751409322 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 4.0 3 9.0 4 10.5 5 8.5 6 8.5 7 6.5 8 6.5 9 7.5 10 8.0 11 9.5 12 9.5 13 12.0 14 14.0 15 14.5 16 13.5 17 12.0 18 12.0 19 13.0 20 14.5 21 12.0 22 12.0 23 15.0 24 18.0 25 16.0 26 18.0 27 25.0 28 31.0 29 34.5 30 37.0 31 51.5 32 62.5 33 76.5 34 90.5 35 109.5 36 139.0 37 154.0 38 165.0 39 196.5 40 218.0 41 228.5 42 218.5 43 181.0 44 182.5 45 197.0 46 172.5 47 142.0 48 122.5 49 113.0 50 117.5 51 100.0 52 80.0 53 69.5 54 60.0 55 50.0 56 41.0 57 38.5 58 27.0 59 22.0 60 22.5 61 20.5 62 16.0 63 12.5 64 16.5 65 13.5 66 8.0 67 8.5 68 9.0 69 7.0 70 2.0 71 1.0 72 4.5 73 4.5 74 2.0 75 2.5 76 2.5 77 1.5 78 1.0 79 1.5 80 1.0 81 1.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8 7 0.0 8 0.4 9 3.125 10-11 3.7125 12-13 4.05 14-15 4.3999999999999995 16-17 4.3625 18-19 3.6999999999999997 20-21 3.7125 22-23 3.0 24-25 1.6 26-27 0.8750000000000001 28-29 1.0375 30-31 0.575 32-33 0.3875 34-35 1.0250000000000001 36-37 2.1875 38-39 2.325 40-41 3.4250000000000003 42-43 3.7125 44-45 4.15 46-47 3.95 48-49 4.2625 50-51 4.025 52-53 2.7 54-55 2.0500000000000003 56-57 1.4625000000000001 58-59 1.5625 60-61 1.325 62-63 2.175 64-65 3.7375 66-67 3.775 68-69 4.2250000000000005 70-71 4.1875 72-73 4.9125000000000005 74-75 5.050000000000001 76-77 4.1000000000000005 78-79 5.175 80-81 4.387499999999999 82-83 3.3625000000000003 84-85 18.099999999999998 86-87 16.975 88-89 13.750000000000002 90-91 11.975 92-93 10.612499999999999 94-95 10.0875 96-97 10.7125 98-99 9.875 100-101 9.0875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.20420728578758 95.7 2 1.3596716264751154 2.65 3 0.2565418163160595 0.75 4 0.0513083632632119 0.2 5 0.07696254489481785 0.375 6 0.02565418163160595 0.15 7 0.02565418163160595 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTAAG 7 0.17500000000000002 No Hit CTCCGTTTCCTGCATCTTGACTATGCTGCAGCAAGTCATGTTTACCAGTA 6 0.15 No Hit CTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCC 5 0.125 No Hit CCCGTCTTGATTCTGCAGCAAGTCATGCCAGTATTATCCGTAGTGTTCCC 5 0.125 No Hit CTCCCGAGTATCCTAGATCTCGCTCCATCGCGTAGGGTTTGAGATGTTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0125 0.0 0.0 46-47 0.025 0.0 0.025 0.0 0.0 48-49 0.025 0.0 0.025 0.0 0.0 50-51 0.025 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.025 0.0 0.025 0.0 0.0 82-83 0.025 0.0 0.025 0.0 0.0 84-85 0.075 0.0 0.025 0.0 0.0 86-87 0.0875 0.0 0.025 0.0 0.0 88-89 0.16249999999999998 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 50 4.873291E-7 53.7975 1 >>END_MODULE Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193158 spots for SRR13844643.sra Written 1193158 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra Read 1193144 spots for SRR13844643.sra Written 1193144 spots for SRR13844643.sra SRR ids: ['SRR13844643.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nkae6gyv SRR13844643.sra spots: 23862894 blocks: [[1, 1193144], [1193145, 2386288], [2386289, 3579432], [3579433, 4772576], [4772577, 5965720], [5965721, 7158864], [7158865, 8352008], [8352009, 9545152], [9545153, 10738296], [10738297, 11931440], [11931441, 13124584], [13124585, 14317728], [14317729, 15510872], [15510873, 16704016], [16704017, 17897160], [17897161, 19090304], [19090305, 20283448], [20283449, 21476592], [21476593, 22669736], [22669737, 23862894]] SRR13844643 file size 5757594 SRR13844643 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844643 SRR13844643_1.fastq SRR13844643_2.fastq Input file: SRR13844643_1.fastq Paired file: SRR13844643_2.fastq trimmed: SRR13844643-trimmed-pair1.fastq, SRR13844643-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:58:57 2024 >> started Fri Dec 6 12:59:20 2024 >> done (23.014s) 23862894 read pairs processed; of these: 306137 ( 1.28%) short read pairs filtered out after trimming by size control 182512 ( 0.76%) empty read pairs filtered out after trimming by size control 23374245 (97.95%) read pairs available; of these: 11990632 (51.30%) trimmed read pairs available after processing 11383613 (48.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 107 0.00% 20 214 0.00% 21 319 0.00% 22 419 0.00% 23 539 0.00% 24 562 0.00% 25 621 0.00% 26 694 0.00% 27 826 0.00% 28 956 0.00% 29 1037 0.00% 30 1223 0.01% 31 1410 0.01% 32 1514 0.01% 33 1736 0.01% 34 1820 0.01% 35 1987 0.01% 36 2090 0.01% 37 2333 0.01% 38 2509 0.01% 39 2709 0.01% 40 2989 0.01% 41 3277 0.01% 42 3717 0.02% 43 4030 0.02% 44 4359 0.02% 45 4743 0.02% 46 5329 0.02% 47 5722 0.02% 48 6229 0.03% 49 7046 0.03% 50 9785 0.04% 51 16783 0.07% 52 28907 0.12% 53 41250 0.18% 54 43672 0.19% 55 40241 0.17% 56 36654 0.16% 57 34003 0.15% 58 34902 0.15% 59 201536 0.86% 60 249015 1.07% 61 245654 1.05% 62 281759 1.21% 63 246416 1.05% 64 176716 0.76% 65 118619 0.51% 66 83930 0.36% 67 66164 0.28% 68 55363 0.24% 69 49585 0.21% 70 47737 0.20% 71 43933 0.19% 72 42691 0.18% 73 41197 0.18% 74 40589 0.17% 75 41535 0.18% 76 39977 0.17% 77 42144 0.18% 78 42141 0.18% 79 42019 0.18% 80 43525 0.19% 81 49393 0.21% 82 51684 0.22% 83 54272 0.23% 84 61974 0.27% 85 66187 0.28% 86 75074 0.32% 87 86700 0.37% 88 105722 0.45% 89 136362 0.58% 90 202542 0.87% 91 464105 1.99% 92 3217713 13.77% 93 875609 3.75% 94 526922 2.25% 95 419760 1.80% 96 389021 1.66% 97 417444 1.79% 98 480789 2.06% 99 604178 2.58% 100 1103649 4.72% 101 11383613 48.70% 23374245 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=30 prefix-density=0.56 prefix-fanout=1.9 sequence=AGGATCCATCCACATGGGTTCACGTTCTTCCTACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=106.68 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.0 sequence=GCGGCGGCGGGTGCTTCTCCTGCGGCGAGTCTGGCCACTTCTCCCGCGAGTGCCCCAACAAGAAGTACTAGGCGCTGATACCACTGTATGAAGATCTCAGATCTGACTGCTGTGCTTCTTCCCGCTCCGTTTCCTGCATCTTGACTATGCTGCAGCAAGT criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=19 prefix-density=0.84 prefix-fanout=2.0 sequence=TGCTCGTAGGAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=110.93 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=5.7 sequence=GCGGCGGCGGGTGCTTCTCCTGCGGCGAGTCTGGCCACTTCTCCCGCGAGTGCCCCAACAAGAAGTACTAGGCGCTGATACCACTGTATGAAGATCTCAGATCTGACTGCTGTGCTTCTTCCCGCTCCGTTTCCTGCATCTTGACTATGCTGCAGCAAGT SRR13844643 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:59:57 Started mapping on | Dec 06 12:59:57 Finished on | Dec 06 13:01:32 Mapping speed, Million of reads per hour | 885.76 Number of input reads | 23374245 Average input read length | 188 UNIQUE READS: Uniquely mapped reads number | 22040918 Uniquely mapped reads % | 94.30% Average mapped length | 185.78 Number of splices: Total | 4495562 Number of splices: Annotated (sjdb) | 4101626 Number of splices: GT/AG | 4336844 Number of splices: GC/AG | 57794 Number of splices: AT/AC | 1938 Number of splices: Non-canonical | 98986 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.34% Deletion average length | 1.03 Insertion rate per base | 0.03% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 377342 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 5666 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.97% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2464828 2464828 2464828 N_multimapping 377342 377342 377342 N_noFeature 827066 11217211 11181128 N_ambiguous 532481 32833 32069 UnstrandedReadsAssigned:20681371 PositiveStrandReadsAssigned:10790874 NegativeStrandReadsAssigned:10827721 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844643 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844643-trimmed-pair1.fastq SRR13844643-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,374,245 reads, 21,666,254 reads pseudoaligned [quant] estimated average fragment length: 166.341 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52973 SRR13844643.ke.tsv 35125 SRR13844643.se.tsv 88098 total ==> SRR13844643.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.69 0 0 PNS24247 1044 878.659 0 0 PNS24249 1928 1762.66 3.85702 0.132753 PNS24246 1044 878.659 0 0 PNS24248 1044 878.659 0 0 PNS24244 1471 1305.66 2570.14 119.423 PNS24243 293 131.66 0 0 KQK14069 1603 1437.66 13.6799 0.57728 KQK14071 474 309.288 0 0 ==> SRR13844643.se.tsv <== BRADI_1g14170v3 26 BRADI_1g53295v3 49 BRADI_1g59795v3 178 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 689 BRADI_1g74790v3 28 BRADI_1g09890v3 0 BRADI_1g77505v3 709 BRADI_1g48960v3 1 SRR13844643 completed mapping pipeline successfully