Starting /dee2/code/volunteer_pipeline.sh SRR13844644 current disk space = 1551120543744 free memory = 1328127324 SRR13844644 SRAfilesize 2b01495423e4a3681fbae55b56b1ea61 SRR13844644.sra SRR13844644.sra file validated SRR13844644 is paired end SRR13844644 is conventional basespace SRR13844644 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844644_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0695 34.0 33.0 34.0 31.0 34.0 2 33.193 34.0 33.0 34.0 31.0 34.0 3 33.08675 34.0 33.0 34.0 31.0 34.0 4 36.5115 37.0 37.0 37.0 35.0 37.0 5 36.50725 37.0 37.0 37.0 35.0 37.0 6 36.492 37.0 37.0 37.0 35.0 37.0 7 36.4035 37.0 37.0 37.0 35.0 37.0 8 36.45975 37.0 37.0 37.0 35.0 37.0 9 38.3935 39.0 39.0 39.0 37.0 39.0 10-11 38.163125 39.0 39.0 39.0 37.0 39.0 12-13 38.253249999999994 39.0 39.0 39.0 37.0 39.0 14-15 39.755250000000004 41.0 40.0 41.0 37.5 41.0 16-17 39.51575 41.0 40.0 41.0 37.0 41.0 18-19 39.527625 41.0 39.5 41.0 37.0 41.0 20-21 39.566874999999996 41.0 40.0 41.0 36.5 41.0 22-23 39.330625 41.0 39.5 41.0 36.0 41.0 24-25 39.258750000000006 41.0 40.0 41.0 36.0 41.0 26-27 39.073375 41.0 40.0 41.0 36.0 41.0 28-29 38.896375 41.0 39.5 41.0 36.0 41.0 30-31 38.941 41.0 40.0 41.0 36.0 41.0 32-33 38.790625 41.0 39.0 41.0 36.0 41.0 34-35 38.560625 41.0 39.0 41.0 35.0 41.0 36-37 38.521875 40.5 39.0 41.0 35.0 41.0 38-39 38.32925 40.0 38.0 41.0 35.0 41.0 40-41 38.203375 40.0 38.0 41.0 34.5 41.0 42-43 38.172375 40.0 38.0 41.0 34.5 41.0 44-45 38.094750000000005 40.0 38.0 41.0 34.5 41.0 46-47 38.06175 40.0 38.0 41.0 34.0 41.0 48-49 37.9945 40.0 38.0 41.0 34.0 41.0 50-51 38.123374999999996 40.0 38.0 41.0 34.5 41.0 52-53 37.84075 40.0 38.0 41.0 33.5 41.0 54-55 37.766 40.0 37.5 41.0 33.5 41.0 56-57 37.685125 40.0 37.0 41.0 33.5 41.0 58-59 37.4865 40.0 37.0 41.0 33.0 41.0 60-61 36.950374999999994 39.0 36.0 41.0 32.0 41.0 62-63 37.268875 39.0 36.0 41.0 33.5 41.0 64-65 37.01275 39.0 35.0 41.0 33.5 41.0 66-67 36.733625 38.5 35.0 41.0 33.5 41.0 68-69 36.27225 37.0 35.0 40.0 32.5 41.0 70-71 35.76575 37.0 35.0 39.5 32.0 41.0 72-73 35.485625 36.5 35.0 39.0 32.0 41.0 74-75 35.200874999999996 36.0 35.0 39.0 32.0 40.5 76-77 34.44775 35.0 34.0 37.0 30.5 39.0 78-79 34.318125 35.0 35.0 37.0 31.0 39.0 80-81 34.256625 35.0 35.0 36.5 32.0 38.5 82-83 34.023125 35.0 35.0 36.0 31.5 37.0 84-85 33.66525 35.0 34.5 36.0 31.0 37.0 86-87 33.439375 35.0 34.0 35.5 31.0 36.5 88-89 33.43025 35.0 34.5 35.0 31.0 36.0 90-91 33.248000000000005 35.0 34.0 35.0 30.5 36.0 92-93 33.2115 35.0 34.0 35.0 31.0 36.0 94-95 33.16275 35.0 34.0 35.0 31.0 36.0 96-97 32.981625 35.0 34.0 35.0 30.5 35.5 98-99 32.84975 35.0 34.0 35.0 30.5 35.0 100-101 31.83975 34.5 32.5 35.0 27.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 8.0 9 19.0 10 25.0 11 12.0 12 13.0 13 3.0 14 5.0 15 5.0 16 0.0 17 2.0 18 0.0 19 2.0 20 5.0 21 5.0 22 6.0 23 8.0 24 7.0 25 12.0 26 7.0 27 10.0 28 22.0 29 28.0 30 32.0 31 52.0 32 47.0 33 74.0 34 97.0 35 197.0 36 384.0 37 936.0 38 1560.0 39 412.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.655663915978995 15.603900975243812 8.077019254813704 53.66341585396349 2 15.275 20.724999999999998 48.55 15.45 3 20.0 25.525 27.025 27.450000000000003 4 23.925 29.825000000000003 23.599999999999998 22.650000000000002 5 25.1 31.574999999999996 26.650000000000002 16.675 6 19.6 35.6 29.125 15.675 7 17.375 18.85 46.525 17.25 8 17.525 21.725 37.574999999999996 23.175 9 18.85 20.95 38.800000000000004 21.4 10-11 22.525000000000002 31.8125 27.1 18.5625 12-13 20.8875 25.45 32.3125 21.349999999999998 14-15 21.099999999999998 26.3625 31.0125 21.525 16-17 21.0625 27.55 30.125 21.2625 18-19 22.112499999999997 26.775 30.45 20.6625 20-21 22.2 27.8875 29.1875 20.724999999999998 22-23 22.5125 28.075 28.237499999999997 21.175 24-25 21.6625 28.050000000000004 28.762500000000003 21.525 26-27 21.85 28.475 27.925 21.75 28-29 22.662499999999998 29.25 26.5 21.587500000000002 30-31 22.125 28.812500000000004 27.224999999999998 21.837500000000002 32-33 21.837500000000002 29.025000000000002 27.4125 21.725 34-35 22.025 29.95 26.775 21.25 36-37 21.7375 29.262500000000003 27.400000000000002 21.6 38-39 22.5125 27.825 27.200000000000003 22.4625 40-41 21.8875 27.925 27.150000000000002 23.0375 42-43 22.2625 28.4125 26.8375 22.4875 44-45 23.3 27.9125 26.825 21.9625 46-47 22.325 27.962500000000002 27.962500000000002 21.75 48-49 22.25 27.8625 27.825 22.0625 50-51 21.6625 28.425 26.85 23.0625 52-53 21.6 28.4375 28.5625 21.4 54-55 22.7125 27.9125 27.750000000000004 21.625 56-57 21.5625 28.0875 27.9125 22.4375 58-59 21.9375 28.287499999999998 27.0875 22.6875 60-61 22.6 27.6625 27.4125 22.325 62-63 22.2 28.262500000000003 27.05 22.4875 64-65 21.95 28.050000000000004 27.3 22.7 66-67 22.5625 29.312500000000004 26.687499999999996 21.4375 68-69 22.1 27.275 28.537499999999998 22.0875 70-71 21.8125 28.462500000000002 27.725 22.0 72-73 21.8625 27.762500000000003 27.224999999999998 23.150000000000002 74-75 21.3875 28.3875 27.425 22.8 76-77 22.162499999999998 28.975 26.400000000000002 22.4625 78-79 21.875 28.1625 28.1875 21.775 80-81 22.4875 27.987499999999997 27.6375 21.8875 82-83 21.875 27.8375 27.925 22.3625 84-85 22.5875 28.0625 27.3875 21.9625 86-87 21.6875 29.275000000000002 26.987499999999997 22.05 88-89 22.375 27.787499999999998 28.125 21.712500000000002 90-91 22.3375 28.3125 27.762500000000003 21.587500000000002 92-93 21.9 28.725 27.3875 21.987499999999997 94-95 22.075 28.287499999999998 27.487499999999997 22.15 96-97 21.7375 28.275 27.975 22.0125 98-99 22.525000000000002 27.962500000000002 26.8375 22.675 100-101 21.0125 28.475 27.775 22.7375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 1.0 13 3.0 14 2.5 15 1.0 16 1.0 17 3.0 18 3.5 19 3.0 20 6.0 21 6.5 22 4.0 23 2.5 24 3.5 25 5.5 26 6.0 27 8.0 28 11.5 29 14.0 30 16.0 31 25.0 32 38.0 33 52.0 34 63.5 35 96.0 36 132.5 37 160.5 38 204.5 39 227.5 40 228.0 41 235.5 42 223.0 43 217.0 44 217.0 45 196.0 46 171.0 47 154.0 48 158.5 49 153.0 50 137.0 51 108.5 52 93.5 53 88.0 54 75.5 55 70.0 56 60.0 57 48.0 58 40.0 59 32.5 60 27.5 61 26.0 62 18.5 63 15.5 64 15.5 65 13.0 66 10.0 67 8.0 68 9.0 69 8.0 70 9.0 71 9.5 72 4.5 73 4.0 74 5.0 75 2.0 76 0.5 77 1.5 78 1.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4725050916497 96.7 2 1.2729124236252547 2.5 3 0.20366598778004072 0.6 4 0.05091649694501018 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844644 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844644_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3325 34.0 31.0 34.0 30.0 34.0 2 32.50875 34.0 31.0 34.0 30.0 34.0 3 32.43025 34.0 31.0 34.0 30.0 34.0 4 35.90925 37.0 37.0 37.0 33.0 37.0 5 35.90325 37.0 37.0 37.0 35.0 37.0 6 35.6695 37.0 37.0 37.0 33.0 37.0 7 35.75025 37.0 37.0 37.0 35.0 37.0 8 35.6625 37.0 37.0 37.0 33.0 37.0 9 36.84325 39.0 38.0 39.0 33.0 39.0 10-11 36.661874999999995 39.0 38.0 39.0 33.5 39.0 12-13 36.510125 39.0 38.5 39.0 33.5 39.0 14-15 38.003249999999994 41.0 39.0 41.0 34.0 41.0 16-17 38.019375 41.0 39.0 41.0 34.5 41.0 18-19 37.787375 41.0 39.0 41.0 33.0 41.0 20-21 37.474999999999994 41.0 39.0 41.0 32.5 41.0 22-23 37.5255 41.0 39.0 41.0 32.5 41.0 24-25 37.613 41.0 39.0 41.0 32.5 41.0 26-27 37.36175 41.0 38.5 41.0 31.0 41.0 28-29 37.203 41.0 38.5 41.0 30.5 41.0 30-31 37.108375 41.0 38.5 41.0 30.0 41.0 32-33 36.874375 40.0 38.0 41.0 30.0 41.0 34-35 36.87125 40.0 38.0 41.0 30.0 41.0 36-37 36.752625 40.0 38.0 41.0 30.0 41.0 38-39 36.535375 40.0 38.0 41.0 30.0 41.0 40-41 36.2685 40.0 38.0 41.0 30.0 41.0 42-43 36.157125 40.0 38.0 41.0 29.5 41.0 44-45 35.636 40.0 37.0 41.0 24.0 41.0 46-47 35.582625 40.0 37.0 41.0 24.5 41.0 48-49 35.55025 40.0 37.0 41.0 25.0 41.0 50-51 34.998125 39.0 36.0 40.5 24.5 40.5 52-53 34.744875 39.0 35.5 40.5 21.0 41.0 54-55 35.291875 40.0 35.5 41.0 25.0 41.0 56-57 35.59 40.0 36.0 41.0 27.0 41.0 58-59 35.746625 40.0 36.0 41.0 28.0 41.0 60-61 35.337500000000006 39.5 35.5 41.0 27.0 41.0 62-63 34.885875 39.0 35.0 41.0 25.0 41.0 64-65 34.673625 39.0 35.0 41.0 24.0 41.0 66-67 34.234875 38.0 35.0 41.0 21.0 41.0 68-69 33.921875 37.0 35.0 40.0 19.5 41.0 70-71 33.230000000000004 36.5 34.0 39.0 11.0 41.0 72-73 32.948375 36.0 34.0 39.0 7.0 41.0 74-75 32.718375 36.0 34.5 38.5 7.0 40.5 76-77 32.32825 35.0 34.0 37.0 2.0 39.0 78-79 31.883499999999998 35.0 34.0 37.0 2.0 39.0 80-81 31.470625 35.0 34.0 36.5 2.0 38.0 82-83 30.899250000000002 35.0 33.5 36.0 2.0 37.0 84-85 26.49425 34.0 24.5 35.0 2.0 36.0 86-87 26.441000000000003 34.0 24.0 35.0 2.0 36.0 88-89 26.334 34.0 23.5 35.0 2.0 36.0 90-91 26.326875 33.5 24.0 35.0 2.0 35.0 92-93 26.515375 34.0 24.5 35.0 2.0 35.0 94-95 26.38225 34.0 25.0 35.0 2.0 35.0 96-97 26.068875 33.5 24.0 35.0 2.0 35.0 98-99 25.725375 33.0 23.0 35.0 2.0 35.0 100-101 23.87125 31.0 10.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 37.0 4 27.0 5 2.0 6 27.0 7 69.0 8 17.0 9 32.0 10 27.0 11 28.0 12 18.0 13 3.0 14 19.0 15 16.0 16 4.0 17 7.0 18 8.0 19 9.0 20 8.0 21 7.0 22 10.0 23 19.0 24 16.0 25 22.0 26 23.0 27 27.0 28 44.0 29 52.0 30 61.0 31 89.0 32 157.0 33 129.0 34 150.0 35 273.0 36 497.0 37 748.0 38 1075.0 39 226.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.35 14.000000000000002 7.5249999999999995 55.125 2 16.900000000000002 19.15 47.525 16.425 3 21.349999999999998 23.674999999999997 27.625 27.35 4 25.900000000000002 28.999999999999996 23.225 21.875 5 25.424999999999997 30.875000000000004 27.200000000000003 16.5 6 20.251889168765743 33.5264483627204 30.22670025188917 15.994962216624685 7 16.150000000000002 17.4 48.449999999999996 18.0 8 18.11339688911189 22.503763171098846 37.23030607124937 22.15253386853989 9 19.892610585527997 20.173868575811813 38.63462030171312 21.29890053694707 10-11 21.93864398040732 30.8455787574117 28.61562258313998 18.60015467904099 12-13 21.373056994818654 25.414507772020727 33.18652849740933 20.025906735751295 14-15 21.584415584415584 26.233766233766232 32.5974025974026 19.584415584415584 16-17 21.798365122615802 26.67704684053458 30.491760736992347 21.032827299857274 18-19 21.918866709594333 26.9671603348358 29.40115904700579 21.71281390856407 20-21 22.13072568193515 28.38394235717962 28.924343798250128 20.5609881626351 22-23 21.69244535344497 27.610890962546335 29.24709190847501 21.449571775533684 24-25 22.13353604459648 28.949702267832254 27.657417965285696 21.25934372228557 26-27 21.91556395715186 28.25456836798992 27.989918084436045 21.83994959042218 28-29 21.790178007827294 28.153010983461684 28.6706223961621 21.38618861254892 30-31 21.259743525270306 30.198642192607494 26.94241890872517 21.599195373397034 32-33 22.091273821464394 29.074724172517552 26.855566700100304 21.978435305917753 34-35 22.24185811663721 28.818480181772284 27.291088109063367 21.64857359252714 36-37 21.47582697201018 28.51145038167939 28.3587786259542 21.653944020356235 38-39 21.816097809475295 28.884360672440142 27.81456953642384 21.48497198166072 40-41 21.989461508803494 28.389667137900016 27.438632566508158 22.18223878678833 42-43 22.08762886597938 28.749999999999996 27.139175257731956 22.02319587628866 44-45 22.153047989623865 28.936446173800263 27.30220492866407 21.608300907911804 46-47 22.387673183995858 28.42159782467953 26.85484915188398 22.33587983944063 48-49 21.822666493573934 28.43048163053356 27.32701544852655 22.41983642736596 50-51 22.117251197101073 28.316293516241746 28.04451921832535 21.521936068331822 52-53 21.917283635435282 28.184835333163132 27.54659177942303 22.351289251978553 54-55 22.14876033057851 28.862047043865225 27.794024157660523 21.19516846789574 56-57 22.84881510581675 27.803827144848565 27.43631985806615 21.911037891268535 58-59 22.112336756688222 28.578673766958286 27.70381640674528 21.605173069608217 60-61 22.282677464254082 27.82487662912818 27.103631532329498 22.788814374288243 62-63 21.952150674471877 28.976838890302876 27.14431152965131 21.92669890557394 64-65 22.576070139247033 28.623001547189276 26.843733883445076 21.95719443011862 66-67 22.10458360232408 27.695287282117498 27.798579728857327 22.4015493867011 68-69 22.915587778353185 27.291558777835316 27.524598653547383 22.268254790264113 70-71 22.680812524259284 28.218398240393324 27.390348039849915 21.710441195497477 72-73 22.669270833333332 29.401041666666668 26.822916666666668 21.106770833333332 74-75 22.472935959306117 28.42050345637146 26.503195513238552 22.603365071083868 76-77 21.168260532437323 29.374515378650813 27.229258206254848 22.227965882657017 78-79 22.782495101241018 28.00783801436969 27.054212932723708 22.155453951665578 80-81 22.23663725998962 27.906071613907628 27.594706798131813 22.262584327970938 82-83 22.440590879897236 27.552986512524086 27.540141297366734 22.466281310211947 84-85 22.51285819250551 27.494489346069066 28.537839823659073 21.45481263776635 86-87 22.743787240226712 28.179043743641913 27.307077459671557 21.770091556459818 88-89 21.950183979620718 27.90829323521087 27.35635437305406 22.785168412114352 90-91 22.516741071428573 28.61328125 27.260044642857146 21.609933035714285 92-93 22.75176129299627 27.987291062301423 27.144633236634895 22.116314408067414 94-95 21.813186813186814 29.38186813186813 26.95054945054945 21.854395604395606 96-97 22.55524861878453 28.28729281767956 27.55524861878453 21.60220994475138 98-99 23.092727023695385 28.434461032735243 27.215449938364607 21.257362005204765 100-101 22.700135685210313 28.548168249660787 26.512890094979646 22.238805970149254 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 4.5 3 8.0 4 9.5 5 10.0 6 6.5 7 4.0 8 4.5 9 3.5 10 4.0 11 7.0 12 7.5 13 9.5 14 12.5 15 10.0 16 6.5 17 9.5 18 12.5 19 13.5 20 13.0 21 10.5 22 10.0 23 11.0 24 13.0 25 16.0 26 19.0 27 20.0 28 22.5 29 25.0 30 30.0 31 33.5 32 44.5 33 60.0 34 78.0 35 102.5 36 128.0 37 162.0 38 191.0 39 187.5 40 185.5 41 201.0 42 199.0 43 208.5 44 214.0 45 194.5 46 175.5 47 164.5 48 150.5 49 124.5 50 106.5 51 98.0 52 88.0 53 81.5 54 74.0 55 65.0 56 53.5 57 40.5 58 33.0 59 31.0 60 29.5 61 21.0 62 15.5 63 14.5 64 16.0 65 18.0 66 15.5 67 11.5 68 10.0 69 11.0 70 7.0 71 3.5 72 3.5 73 3.0 74 3.0 75 3.0 76 2.0 77 2.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.75 7 0.0 8 0.35000000000000003 9 2.225 10-11 3.025 12-13 3.5000000000000004 14-15 3.75 16-17 3.6624999999999996 18-19 2.9375 20-21 2.85 22-23 2.2125 24-25 1.3375 26-27 0.8125 28-29 0.9875 30-31 0.575 32-33 0.3 34-35 0.975 36-37 1.7500000000000002 38-39 1.8499999999999999 40-41 2.7375 42-43 3.0 44-45 3.6249999999999996 46-47 3.4625000000000004 48-49 3.7125 50-51 3.4125 52-53 2.075 54-55 1.6875 56-57 1.3625 58-59 1.4125 60-61 1.2125000000000001 62-63 1.775 64-65 3.05 66-67 3.1875 68-69 3.45 70-71 3.3875 72-73 4.0 74-75 4.1625000000000005 76-77 3.2750000000000004 78-79 4.3125 80-81 3.65 82-83 2.6875 84-85 14.9375 86-87 13.9875 88-89 11.675 90-91 10.4 92-93 9.5125 94-95 9.0 96-97 9.5 98-99 8.737499999999999 100-101 7.875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6266531027467 96.95 2 1.1953204476093593 2.35 3 0.0762970498474059 0.22499999999999998 4 0.050864699898270596 0.2 5 0.025432349949135298 0.125 6 0.025432349949135298 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTCTTGATTCTGCAGCAAGTCATGCCAGTATTATCCGTAGTGTTCCC 6 0.15 No Hit CTGGTTTCTGAAGATGAACTCTGATTGCCTTGATTGTAATCAGTCTGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 25 0.0056707063 54.255 1 TTTTTTT 375 1.7596367E-4 7.515844 10-11 >>END_MODULE Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006409 spots for SRR13844644.sra Written 1006409 spots for SRR13844644.sra Read 1006425 spots for SRR13844644.sra Written 1006425 spots for SRR13844644.sra SRR ids: ['SRR13844644.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m3i5ue6o SRR13844644.sra spots: 20128196 blocks: [[1, 1006409], [1006410, 2012818], [2012819, 3019227], [3019228, 4025636], [4025637, 5032045], [5032046, 6038454], [6038455, 7044863], [7044864, 8051272], [8051273, 9057681], [9057682, 10064090], [10064091, 11070499], [11070500, 12076908], [12076909, 13083317], [13083318, 14089726], [14089727, 15096135], [15096136, 16102544], [16102545, 17108953], [17108954, 18115362], [18115363, 19121771], [19121772, 20128196]] SRR13844644 file size 4853097 SRR13844644 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844644 SRR13844644_1.fastq SRR13844644_2.fastq Input file: SRR13844644_1.fastq Paired file: SRR13844644_2.fastq trimmed: SRR13844644-trimmed-pair1.fastq, SRR13844644-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:59:07 2024 >> started Fri Dec 6 12:59:27 2024 >> done (19.582s) 20128196 read pairs processed; of these: 182769 ( 0.91%) short read pairs filtered out after trimming by size control 141770 ( 0.70%) empty read pairs filtered out after trimming by size control 19803657 (98.39%) read pairs available; of these: 9974852 (50.37%) trimmed read pairs available after processing 9828805 (49.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 51 0.00% 20 148 0.00% 21 181 0.00% 22 279 0.00% 23 275 0.00% 24 345 0.00% 25 429 0.00% 26 473 0.00% 27 538 0.00% 28 643 0.00% 29 754 0.00% 30 808 0.00% 31 965 0.00% 32 1092 0.01% 33 1158 0.01% 34 1291 0.01% 35 1399 0.01% 36 1528 0.01% 37 1676 0.01% 38 1805 0.01% 39 1971 0.01% 40 2135 0.01% 41 2284 0.01% 42 2478 0.01% 43 2835 0.01% 44 3071 0.02% 45 3282 0.02% 46 3601 0.02% 47 3924 0.02% 48 4296 0.02% 49 4936 0.02% 50 6530 0.03% 51 10822 0.05% 52 18864 0.10% 53 26783 0.14% 54 28717 0.15% 55 26629 0.13% 56 23874 0.12% 57 22170 0.11% 58 22560 0.11% 59 117786 0.59% 60 152271 0.77% 61 156148 0.79% 62 181423 0.92% 63 158425 0.80% 64 113608 0.57% 65 78952 0.40% 66 57081 0.29% 67 45516 0.23% 68 39527 0.20% 69 35883 0.18% 70 35356 0.18% 71 33419 0.17% 72 32535 0.16% 73 32212 0.16% 74 32764 0.17% 75 32752 0.17% 76 29104 0.15% 77 31474 0.16% 78 32710 0.17% 79 33803 0.17% 80 36230 0.18% 81 42581 0.22% 82 45214 0.23% 83 48708 0.25% 84 55445 0.28% 85 60052 0.30% 86 68839 0.35% 87 78812 0.40% 88 96838 0.49% 89 124479 0.63% 90 184650 0.93% 91 422582 2.13% 92 2786891 14.07% 93 755354 3.81% 94 457785 2.31% 95 364924 1.84% 96 339539 1.71% 97 361051 1.82% 98 425073 2.15% 99 538982 2.72% 100 980455 4.95% 101 9828805 49.63% 19803657 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=32 prefix-density=0.42 prefix-fanout=2.1 sequence=TGCTCGTAGGAAGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=49.04 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=6.2 sequence=GAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGTTATTTTTTAGTATGCTGAAACTGCATCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=36 prefix-density=0.27 prefix-fanout=2.1 sequence=TTCTTCCTACGAGCA criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=48.70 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=6.6 sequence=GAAGGAAGAAGGGGTTTGATATCGCCGCGGACACGCTGCATTGGCGTCTAGTGAGTGGTATTTTGGTGTGGCAGACAGAGTTACGTGCTGAGTTTATACTAGTCGGGTCTTTTGTTATCTTTTGTGGTTTTCCTTCGTTTTCGAGTCTAAAACTGCAATAGCTGTGCAGTTTGCTCTATCAGTCGTCCTGT SRR13844644 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:00:16 Started mapping on | Dec 06 13:00:16 Finished on | Dec 06 13:01:14 Mapping speed, Million of reads per hour | 1229.19 Number of input reads | 19803657 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 19092404 Uniquely mapped reads % | 96.41% Average mapped length | 187.63 Number of splices: Total | 4772307 Number of splices: Annotated (sjdb) | 4468436 Number of splices: GT/AG | 4658099 Number of splices: GC/AG | 57923 Number of splices: AT/AC | 2528 Number of splices: Non-canonical | 53757 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.34% Deletion average length | 1.03 Insertion rate per base | 0.02% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294145 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 4347 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.99% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1373115 1373115 1373115 N_multimapping 294145 294145 294145 N_noFeature 782257 9864344 9604779 N_ambiguous 443316 19619 19404 UnstrandedReadsAssigned:17866831 PositiveStrandReadsAssigned:9208441 NegativeStrandReadsAssigned:9468221 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844644 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844644-trimmed-pair1.fastq SRR13844644-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,803,657 reads, 18,571,407 reads pseudoaligned [quant] estimated average fragment length: 164.892 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR13844644.ke.tsv 35125 SRR13844644.se.tsv 88098 total ==> SRR13844644.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 772.116 0 0 PNS24247 1044 880.108 0 0 PNS24249 1928 1764.11 11.5633 0.433378 PNS24246 1044 880.108 0 0 PNS24248 1044 880.108 0 0 PNS24244 1471 1307.11 1912.44 96.7357 PNS24243 293 132.869 0 0 KQK14069 1603 1439.11 118 5.42125 KQK14071 474 310.572 0 0 ==> SRR13844644.se.tsv <== BRADI_1g14170v3 118 BRADI_1g53295v3 16 BRADI_1g59795v3 167 BRADI_1g07683v3 1 BRADI_1g00485v3 10 BRADI_1g20270v3 1549 BRADI_1g74790v3 4 BRADI_1g09890v3 0 BRADI_1g77505v3 768 BRADI_1g48960v3 3 SRR13844644 completed mapping pipeline successfully