Starting /dee2/code/volunteer_pipeline.sh SRR13844645 current disk space = 1551103791104 free memory = 1324802508 SRR13844645 SRAfilesize d429eb05b6b81cb9643cdd38eb280a81 SRR13844645.sra SRR13844645.sra file validated SRR13844645 is paired end SRR13844645 is conventional basespace SRR13844645 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844645_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99325 34.0 31.0 34.0 31.0 34.0 2 33.11725 34.0 33.0 34.0 31.0 34.0 3 33.07825 34.0 33.0 34.0 31.0 34.0 4 36.4965 37.0 37.0 37.0 35.0 37.0 5 36.45275 37.0 37.0 37.0 35.0 37.0 6 36.46775 37.0 37.0 37.0 35.0 37.0 7 36.41075 37.0 37.0 37.0 35.0 37.0 8 36.4645 37.0 37.0 37.0 35.0 37.0 9 38.39225 39.0 39.0 39.0 37.0 39.0 10-11 38.190875000000005 39.0 39.0 39.0 37.0 39.0 12-13 38.257375 39.0 39.0 39.0 37.0 39.0 14-15 39.728125000000006 41.0 40.0 41.0 37.5 41.0 16-17 39.41025 41.0 39.0 41.0 36.0 41.0 18-19 39.438 41.0 39.0 41.0 36.0 41.0 20-21 39.485875 41.0 40.0 41.0 36.0 41.0 22-23 39.2605 41.0 39.0 41.0 36.0 41.0 24-25 39.15675 41.0 39.0 41.0 36.0 41.0 26-27 38.952124999999995 41.0 39.0 41.0 36.0 41.0 28-29 38.771375000000006 41.0 39.0 41.0 36.0 41.0 30-31 38.69925 41.0 39.0 41.0 36.0 41.0 32-33 38.523625 41.0 39.0 41.0 36.0 41.0 34-35 38.317375 40.5 38.5 41.0 35.0 41.0 36-37 38.286500000000004 40.5 39.0 41.0 35.0 41.0 38-39 38.159625 40.0 38.0 41.0 34.5 41.0 40-41 37.989374999999995 40.0 38.0 41.0 34.0 41.0 42-43 37.914500000000004 40.0 38.0 41.0 33.5 41.0 44-45 37.932 40.0 38.0 41.0 34.0 41.0 46-47 37.882374999999996 40.0 38.0 41.0 34.0 41.0 48-49 37.921125 40.0 38.0 41.0 34.0 41.0 50-51 37.982875 40.0 38.0 41.0 34.0 41.0 52-53 37.720124999999996 40.0 38.0 41.0 33.5 41.0 54-55 37.600750000000005 40.0 38.0 41.0 33.5 41.0 56-57 37.555 40.0 37.0 41.0 34.0 41.0 58-59 37.245000000000005 40.0 37.0 41.0 33.0 41.0 60-61 36.726 39.0 36.0 41.0 31.5 41.0 62-63 37.029375 39.0 36.0 41.0 33.5 41.0 64-65 36.767250000000004 39.0 35.5 41.0 33.0 41.0 66-67 36.442125000000004 38.5 35.0 41.0 33.0 41.0 68-69 36.017875000000004 37.0 35.0 40.0 32.5 41.0 70-71 35.429874999999996 37.0 35.0 39.0 31.0 41.0 72-73 35.222875 36.0 35.0 39.0 31.5 41.0 74-75 34.902 36.0 35.0 39.0 32.0 40.0 76-77 34.09775 35.0 34.0 37.0 30.5 39.0 78-79 33.967875 35.0 35.0 37.0 30.0 39.0 80-81 33.914125 35.0 35.0 36.5 31.0 38.5 82-83 33.650875 35.0 35.0 36.0 31.5 37.0 84-85 33.212500000000006 35.0 34.5 36.0 30.0 37.0 86-87 32.9125 35.0 34.0 35.0 29.5 36.0 88-89 32.984875 35.0 34.0 35.0 30.5 36.0 90-91 32.774249999999995 35.0 34.0 35.0 30.0 36.0 92-93 32.758875 35.0 34.0 35.0 30.0 36.0 94-95 32.67575 35.0 34.0 35.0 30.0 36.0 96-97 32.5115 35.0 34.0 35.0 29.5 35.0 98-99 32.310500000000005 35.0 34.0 35.0 29.0 35.0 100-101 31.241500000000002 34.5 32.5 35.0 24.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 14.0 9 26.0 10 26.0 11 24.0 12 10.0 13 5.0 14 2.0 15 2.0 16 2.0 17 1.0 18 5.0 19 6.0 20 5.0 21 2.0 22 9.0 23 2.0 24 17.0 25 10.0 26 8.0 27 23.0 28 23.0 29 24.0 30 34.0 31 49.0 32 52.0 33 86.0 34 110.0 35 179.0 36 375.0 37 953.0 38 1540.0 39 376.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.025000000000002 14.575 6.950000000000001 55.45 2 16.2 19.1 50.14999999999999 14.549999999999999 3 21.775 24.075 26.700000000000003 27.450000000000003 4 24.725 29.5 24.275 21.5 5 25.825 31.025000000000002 28.175 14.975 6 19.375 34.599999999999994 29.799999999999997 16.225 7 16.975 19.025 47.275 16.725 8 17.275 21.925 38.2 22.6 9 18.7 20.65 40.875 19.775000000000002 10-11 21.6625 31.162499999999998 27.8625 19.3125 12-13 20.05 25.662499999999998 33.775 20.5125 14-15 21.587500000000002 26.625 31.674999999999997 20.1125 16-17 22.0125 26.787499999999998 30.912499999999998 20.2875 18-19 22.2125 27.437499999999996 30.15 20.200000000000003 20-21 21.9625 27.825 29.525000000000002 20.6875 22-23 21.8125 27.6125 29.225 21.349999999999998 24-25 21.5625 28.549999999999997 28.7375 21.15 26-27 22.575 28.15 28.3875 20.8875 28-29 22.5 28.462500000000002 27.5125 21.525 30-31 22.275 28.375 27.625 21.725 32-33 22.412499999999998 29.475 27.825 20.2875 34-35 21.665208151018877 28.99112389048631 26.990873859232405 22.352794099262407 36-37 21.530382595648913 29.207301825456366 27.956989247311824 21.305326331582897 38-39 21.512500000000003 28.0875 28.000000000000004 22.400000000000002 40-41 22.652831603950492 28.60357544693087 27.57844730591324 21.165145643205403 42-43 22.225 28.487499999999997 27.437499999999996 21.85 44-45 21.987499999999997 27.787499999999998 28.487499999999997 21.7375 46-47 22.025 28.462500000000002 27.825 21.6875 48-49 21.9625 27.3875 27.537499999999998 23.1125 50-51 21.1875 28.4375 27.750000000000004 22.625 52-53 22.287499999999998 28.262500000000003 27.237499999999997 22.2125 54-55 22.1875 28.8375 26.437500000000004 22.537499999999998 56-57 23.2625 27.6 27.3875 21.75 58-59 22.75 28.6125 27.5125 21.125 60-61 22.537499999999998 28.925 27.450000000000003 21.087500000000002 62-63 22.2625 29.049999999999997 27.0625 21.625 64-65 21.9375 28.925 27.462500000000002 21.675 66-67 22.237499999999997 28.287499999999998 27.250000000000004 22.225 68-69 22.1875 28.875 27.875 21.0625 70-71 21.762500000000003 28.599999999999998 27.474999999999998 22.162499999999998 72-73 21.4875 28.9875 27.8375 21.6875 74-75 22.3 28.5625 27.237499999999997 21.9 76-77 21.8625 29.037499999999998 26.974999999999998 22.125 78-79 21.95 29.125 27.425 21.5 80-81 21.9 28.8875 27.237499999999997 21.975 82-83 22.5875 29.1625 26.487500000000004 21.762500000000003 84-85 21.8 29.175 27.800000000000004 21.224999999999998 86-87 21.925 29.3375 26.924999999999997 21.8125 88-89 22.9625 29.475 26.900000000000002 20.6625 90-91 22.375 28.5875 26.2625 22.775000000000002 92-93 22.325 28.6375 27.500000000000004 21.5375 94-95 22.3625 29.4375 26.075 22.125 96-97 21.65 29.512500000000003 27.0125 21.825 98-99 22.6 28.5625 27.0625 21.775 100-101 21.762500000000003 28.3625 27.625 22.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.5 9 1.0 10 1.0 11 2.5 12 2.0 13 1.5 14 2.5 15 3.0 16 2.5 17 1.5 18 3.0 19 4.0 20 4.5 21 7.0 22 5.0 23 2.5 24 8.0 25 9.0 26 8.5 27 9.0 28 7.0 29 12.5 30 26.0 31 32.5 32 41.0 33 55.0 34 67.0 35 85.5 36 118.0 37 146.0 38 173.0 39 210.5 40 220.5 41 225.0 42 240.5 43 242.0 44 213.5 45 201.0 46 210.0 47 193.0 48 171.5 49 154.5 50 130.5 51 113.0 52 107.5 53 95.5 54 79.0 55 63.5 56 47.0 57 35.5 58 30.5 59 28.5 60 28.0 61 21.0 62 14.5 63 14.0 64 12.0 65 12.5 66 10.0 67 4.0 68 3.0 69 3.5 70 5.0 71 5.0 72 3.5 73 3.0 74 2.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.025 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18181818181819 95.85000000000001 2 1.4852752880921896 2.9000000000000004 3 0.15364916773367476 0.44999999999999996 4 0.10243277848911651 0.4 5 0.05121638924455826 0.25 6 0.02560819462227913 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCATGTCTACGTAGTACTACCTCGTTGTTGTGTGTTGTTTTAGTTGTTG 6 0.15 No Hit CTGTGATCTGCCATGAGTGGCTTTATCTGGTGTTATCTGTCTGTCTAAAC 5 0.125 No Hit GTCCGGTTCAAGGTCGTCAAGGTATCTGGTGTGTCTCTGCTCGCTCTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.0625 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844645 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844645_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2565 34.0 31.0 34.0 28.0 34.0 2 32.38025 34.0 31.0 34.0 28.0 34.0 3 32.325 34.0 31.0 34.0 28.0 34.0 4 35.7085 37.0 35.0 37.0 32.0 37.0 5 35.75575 37.0 35.0 37.0 32.0 37.0 6 35.47675 37.0 35.0 37.0 32.0 37.0 7 35.59675 37.0 36.0 37.0 32.0 37.0 8 35.482 37.0 35.0 37.0 32.0 37.0 9 36.44975 39.0 38.0 39.0 32.0 39.0 10-11 36.1225 39.0 38.0 39.0 32.0 39.0 12-13 35.905875 39.0 37.5 39.0 31.5 39.0 14-15 37.297 41.0 39.0 41.0 32.0 41.0 16-17 37.257125 41.0 39.0 41.0 32.0 41.0 18-19 37.019875 41.0 38.5 41.0 31.0 41.0 20-21 36.710625 41.0 38.5 41.0 29.5 41.0 22-23 36.832875 41.0 38.0 41.0 30.0 41.0 24-25 37.062875 41.0 39.0 41.0 30.5 41.0 26-27 36.79425 41.0 38.0 41.0 30.0 41.0 28-29 36.66375 40.5 38.0 41.0 30.0 41.0 30-31 36.52075 40.5 38.0 41.0 30.0 41.0 32-33 36.249750000000006 40.0 38.0 41.0 29.5 41.0 34-35 36.275375 40.0 38.0 41.0 30.0 41.0 36-37 36.130875 40.0 38.0 41.0 28.0 41.0 38-39 35.8755 40.0 38.0 41.0 27.0 41.0 40-41 35.502 40.0 37.5 41.0 21.5 41.0 42-43 35.307249999999996 40.0 37.0 41.0 14.5 41.0 44-45 34.670625 40.0 36.5 41.0 2.0 41.0 46-47 34.733000000000004 40.0 36.5 41.0 2.0 41.0 48-49 34.77375 40.0 36.5 41.0 2.0 41.0 50-51 34.224000000000004 39.0 35.5 40.5 2.0 40.5 52-53 33.97775 39.0 34.5 40.0 9.5 41.0 54-55 34.571124999999995 39.0 35.0 41.0 12.5 41.0 56-57 34.8635 40.0 35.5 41.0 16.5 41.0 58-59 34.979749999999996 40.0 36.0 41.0 14.5 41.0 60-61 34.53225 39.0 35.0 41.0 8.5 41.0 62-63 34.045375 39.0 35.0 41.0 4.0 41.0 64-65 33.898250000000004 39.0 35.0 41.0 2.0 41.0 66-67 33.331375 37.0 35.0 40.0 2.0 41.0 68-69 32.936875 37.0 34.5 39.5 2.0 41.0 70-71 32.152875 36.0 34.0 39.0 2.0 41.0 72-73 31.9165 36.0 34.0 39.0 2.0 41.0 74-75 31.61775 35.0 34.0 38.0 2.0 40.0 76-77 31.243375 35.0 34.0 37.0 2.0 39.0 78-79 30.7925 35.0 33.0 37.0 2.0 39.0 80-81 30.275750000000002 35.0 33.0 36.0 2.0 37.5 82-83 29.677625 35.0 32.5 35.5 2.0 37.0 84-85 24.00825 33.0 2.0 35.0 2.0 36.0 86-87 23.9795 33.0 2.0 35.0 2.0 36.0 88-89 24.042749999999998 33.0 2.0 35.0 2.0 35.0 90-91 24.23425 32.5 2.0 35.0 2.0 35.0 92-93 24.517375 33.0 2.0 35.0 2.0 35.0 94-95 24.56675 33.0 2.0 35.0 2.0 35.0 96-97 24.175625 33.0 2.0 35.0 2.0 35.0 98-99 23.82025 33.0 2.0 35.0 2.0 35.0 100-101 21.945 30.0 2.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 53.0 4 34.0 5 3.0 6 32.0 7 82.0 8 24.0 9 48.0 10 37.0 11 19.0 12 23.0 13 12.0 14 25.0 15 20.0 16 7.0 17 14.0 18 10.0 19 15.0 20 8.0 21 13.0 22 11.0 23 9.0 24 24.0 25 17.0 26 31.0 27 38.0 28 47.0 29 55.0 30 76.0 31 130.0 32 214.0 33 135.0 34 160.0 35 273.0 36 381.0 37 767.0 38 965.0 39 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.099999999999998 14.299999999999999 7.324999999999999 54.275 2 16.150000000000002 18.825 48.949999999999996 16.075 3 22.225 23.400000000000002 27.85 26.525 4 25.25 30.25 24.275 20.225 5 23.724999999999998 31.4 29.225 15.65 6 19.67668603182622 34.352109118464256 30.00757767112907 15.96362717858045 7 16.7 18.0 48.199999999999996 17.1 8 18.220658456898718 21.311887408896705 38.07489318924353 22.392560944961044 9 18.67563372995344 20.046559751681325 41.46404552509053 19.813760993274705 10-11 22.37808075511274 30.846879916098587 27.844782380702675 18.930256948086 12-13 20.07400555041628 24.71256772829391 35.24514338575393 19.96828333553588 14-15 19.93633107839236 26.144050935137287 33.83737896272716 20.082239023743202 16-17 20.86979581012994 26.16016971625563 32.33890214797136 20.631132325643065 18-19 21.3593504452593 27.003666841278157 31.06338397066527 20.573598742797277 20-21 21.532226434828083 27.637599686233493 29.467904301215846 21.36226957772258 22-23 21.5650826446281 27.957128099173556 29.455061983471076 21.022727272727273 24-25 20.955414012738853 28.94267515923567 28.14012738853503 21.961783439490446 26-27 21.933038534428302 28.136449778900825 28.591282375236894 21.339229311433986 28-29 21.90982776089159 28.812056737588655 27.418946301925022 21.85916919959473 30-31 21.730914588057445 29.98236331569665 26.85815066767448 21.428571428571427 32-33 21.875 28.76506024096386 28.024598393574294 21.335341365461847 34-35 22.178594046865104 28.296390120329324 27.435085497150098 22.089930335655477 36-37 21.88181002435585 28.034867324701963 27.522112549673118 22.56121010126907 38-39 21.871390065460147 28.64844050827878 27.660120652034397 21.82004877422667 40-41 22.272904991528737 29.16720969633781 27.433858986055 21.126026326078456 42-43 21.75962293794187 28.89499869075674 27.7821419219691 21.563236449332283 44-45 22.323673415376472 28.00052931057298 28.026994839221913 21.648802434828635 46-47 22.04776355719752 29.027576197387518 27.37828209526323 21.546378150151735 48-49 21.87624221544985 29.23015767854777 26.951106399893998 21.942493706108387 50-51 21.44552888419942 29.068847269849645 26.98496438934318 22.500659456607757 52-53 21.686436307374933 27.978339350180505 28.184631253223312 22.15059308922125 54-55 22.21795855717575 29.03555896648759 25.850601176771555 22.895881299565108 56-57 22.334055293667983 28.02904828640591 27.493948273665435 22.14294814626067 58-59 22.183995922528034 28.427624872579 26.860346585117227 22.52803261977574 60-61 22.049847405900305 28.217192268565615 27.1617497456765 22.571210579857578 62-63 21.610169491525426 29.25012840267078 27.285567539804827 21.854134565998972 64-65 21.80007860605267 28.06236080178174 28.06236080178174 22.07519979038386 66-67 21.736275282374574 27.948515891778303 27.73837667454689 22.576832151300234 68-69 22.17087019675162 28.535586953651126 27.756503367225672 21.537039482371583 70-71 21.922873745377707 28.011093502377175 28.143159006867407 21.922873745377707 72-73 21.9017094017094 28.525641025641026 27.96474358974359 21.607905982905983 74-75 22.439678284182303 28.900804289544237 26.420911528150132 22.238605898123325 76-77 21.83877766069547 29.373024236037935 27.252370916754476 21.53582718651212 78-79 22.040268456375838 27.946308724832214 27.140939597315437 22.87248322147651 80-81 22.553304198119452 28.20818434644418 27.824129254403392 21.414382201032975 82-83 22.73733559057169 29.22255502018492 26.2664409428311 21.77366844641229 84-85 21.765279583875163 28.283485045513657 27.568270481144342 22.382964889466837 86-87 21.894904458598727 29.554140127388536 26.24203821656051 22.30891719745223 88-89 20.858708891595615 28.989037758830694 28.380024360535934 21.77222898903776 90-91 21.74817898022893 30.280957336108223 25.82131708042218 22.149546603240672 92-93 21.971132818195073 28.881761189677796 27.030179326432425 22.11692666569471 94-95 22.01185142361613 29.021534903887847 27.576239340945225 21.390374331550802 96-97 22.5 28.596491228070175 26.92982456140351 21.973684210526315 98-99 22.295837534207116 27.45211003888809 28.7051706755005 21.546881751404293 100-101 23.251175381108418 28.79327539535546 26.77019518449922 21.1853540390369 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 2.5 2 4.5 3 7.0 4 9.0 5 9.0 6 10.5 7 11.0 8 12.0 9 9.5 10 7.5 11 8.5 12 7.5 13 13.0 14 15.5 15 14.0 16 13.5 17 15.5 18 14.0 19 11.5 20 14.5 21 14.0 22 13.0 23 16.0 24 20.5 25 21.5 26 19.5 27 22.5 28 28.5 29 34.5 30 45.0 31 47.0 32 48.0 33 69.0 34 83.0 35 98.5 36 122.5 37 154.0 38 181.5 39 191.5 40 197.5 41 205.0 42 216.0 43 204.0 44 186.0 45 178.0 46 175.5 47 159.5 48 133.0 49 124.0 50 122.0 51 105.0 52 89.5 53 83.5 54 67.5 55 53.5 56 44.0 57 35.0 58 27.5 59 22.5 60 18.5 61 16.0 62 14.5 63 13.5 64 11.5 65 8.0 66 9.0 67 9.5 68 6.0 69 4.5 70 4.5 71 2.5 72 2.5 73 1.5 74 1.0 75 1.5 76 2.0 77 1.5 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0250000000000001 7 0.0 8 0.525 9 3.35 10-11 4.65 12-13 5.4125 14-15 5.7625 16-17 5.7250000000000005 18-19 4.55 20-21 4.387499999999999 22-23 3.2 24-25 1.875 26-27 1.0625 28-29 1.3 30-31 0.775 32-33 0.4 34-35 1.3125 36-37 2.4875000000000003 38-39 2.6125 40-41 4.0875 42-43 4.5249999999999995 44-45 5.5375 46-47 5.2625 48-49 5.6625000000000005 50-51 5.225 52-53 3.05 54-55 2.275 56-57 1.8875 58-59 1.9 60-61 1.7000000000000002 62-63 2.65 64-65 4.5875 66-67 4.825 68-69 5.3374999999999995 70-71 5.35 72-73 6.4 74-75 6.75 76-77 5.1 78-79 6.875000000000001 80-81 5.6125 82-83 4.0125 84-85 23.1 86-87 21.5 88-89 17.9 90-91 15.9125 92-93 14.2625 94-95 13.5125 96-97 14.499999999999998 98-99 13.212499999999999 100-101 12.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.25953416943946 95.975 2 1.3053493729203993 2.55 3 0.3071410289224469 0.8999999999999999 4 0.07678525723061172 0.3 5 0.02559508574353724 0.125 6 0.02559508574353724 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTCTTGATTCTGCAGCAAGTCATGCCAGTATTATCCGTAGTGTTCCC 6 0.15 No Hit CTCACAACAACGAGTGGTACAGCGAAAGTAAAAAATAAAACTCAAGCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.037500000000000006 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTTT 35 4.620233E-8 75.6 1 >>END_MODULE Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487471 spots for SRR13844645.sra Written 1487471 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra Read 1487458 spots for SRR13844645.sra Written 1487458 spots for SRR13844645.sra SRR ids: ['SRR13844645.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nnafy6rp SRR13844645.sra spots: 29749173 blocks: [[1, 1487458], [1487459, 2974916], [2974917, 4462374], [4462375, 5949832], [5949833, 7437290], [7437291, 8924748], [8924749, 10412206], [10412207, 11899664], [11899665, 13387122], [13387123, 14874580], [14874581, 16362038], [16362039, 17849496], [17849497, 19336954], [19336955, 20824412], [20824413, 22311870], [22311871, 23799328], [23799329, 25286786], [25286787, 26774244], [26774245, 28261702], [28261703, 29749173]] SRR13844645 file size 7183177 SRR13844645 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844645 SRR13844645_1.fastq SRR13844645_2.fastq Input file: SRR13844645_1.fastq Paired file: SRR13844645_2.fastq trimmed: SRR13844645-trimmed-pair1.fastq, SRR13844645-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:00:23 2024 >> started Fri Dec 6 13:00:50 2024 >> done (27.930s) 29749173 read pairs processed; of these: 350139 ( 1.18%) short read pairs filtered out after trimming by size control 205087 ( 0.69%) empty read pairs filtered out after trimming by size control 29193947 (98.13%) read pairs available; of these: 14927367 (51.13%) trimmed read pairs available after processing 14266580 (48.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 26 0.00% 19 105 0.00% 20 183 0.00% 21 301 0.00% 22 399 0.00% 23 496 0.00% 24 522 0.00% 25 641 0.00% 26 751 0.00% 27 832 0.00% 28 1000 0.00% 29 1191 0.00% 30 1441 0.00% 31 1615 0.01% 32 1882 0.01% 33 2121 0.01% 34 2452 0.01% 35 2880 0.01% 36 3268 0.01% 37 3741 0.01% 38 4240 0.01% 39 4796 0.02% 40 5516 0.02% 41 6118 0.02% 42 7156 0.02% 43 7957 0.03% 44 8818 0.03% 45 9620 0.03% 46 10796 0.04% 47 11879 0.04% 48 12913 0.04% 49 14494 0.05% 50 18063 0.06% 51 26125 0.09% 52 38109 0.13% 53 48005 0.16% 54 49975 0.17% 55 47464 0.16% 56 45945 0.16% 57 44882 0.15% 58 47463 0.16% 59 251522 0.86% 60 298422 1.02% 61 276335 0.95% 62 282024 0.97% 63 234876 0.80% 64 166954 0.57% 65 117628 0.40% 66 89051 0.31% 67 72423 0.25% 68 62177 0.21% 69 56632 0.19% 70 54764 0.19% 71 51741 0.18% 72 50857 0.17% 73 50059 0.17% 74 50721 0.17% 75 53036 0.18% 76 50542 0.17% 77 52820 0.18% 78 53138 0.18% 79 53819 0.18% 80 56414 0.19% 81 64896 0.22% 82 68834 0.24% 83 73772 0.25% 84 84750 0.29% 85 88203 0.30% 86 101471 0.35% 87 114995 0.39% 88 141595 0.49% 89 180178 0.62% 90 265976 0.91% 91 602666 2.06% 92 4047207 13.86% 93 1095902 3.75% 94 664179 2.28% 95 526178 1.80% 96 489601 1.68% 97 521912 1.79% 98 613607 2.10% 99 781027 2.68% 100 1418282 4.86% 101 14266580 48.87% 29193947 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=28 prefix-density=0.43 prefix-fanout=2.1 sequence=TGCTCGTAGGAAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=43.60 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.2 sequence=AAGAAAATATTCTTGGACATTATTAAGAGACCATGCATATTAATGGAATACAGCATGCATTACAGTACAAGGTCCCCTCACAACAACGAGTGGTACAGCGAAAGTAAAAAATAAAACTCAAGCTCTCATGGGCATGCAAGCAGCAGCAACACAAACCTGCAGCAGTAAAACTAATTATTACCAAGCAGCAACAACT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=25 prefix-density=0.42 prefix-fanout=2.4 sequence=GTAGTGTTCCCCGTCCTGCTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=41.97 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.5 sequence=AAGAAAATATTCTTGGACATTATTAAGAGACCATGCATATTAATGGAATACAGCATGCATTACAGTACAAGGTCCCCTCACAACAACGAGTGGTACAGCGAAAGTAAAAAATAAAACTCAAGCTCTCATGGGCATGCAAGCAGCAGCAACACAAACCTGCAGCAGTAAAAC SRR13844645 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:01:49 Started mapping on | Dec 06 13:01:49 Finished on | Dec 06 13:03:03 Mapping speed, Million of reads per hour | 1420.25 Number of input reads | 29193947 Average input read length | 188 UNIQUE READS: Uniquely mapped reads number | 27833814 Uniquely mapped reads % | 95.34% Average mapped length | 187.03 Number of splices: Total | 7630383 Number of splices: Annotated (sjdb) | 7116433 Number of splices: GT/AG | 7393753 Number of splices: GC/AG | 96307 Number of splices: AT/AC | 3732 Number of splices: Non-canonical | 136591 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.34% Deletion average length | 1.03 Insertion rate per base | 0.02% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 574162 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 9432 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2314759 2314759 2314759 N_multimapping 574162 574162 574162 N_noFeature 1051988 14147857 14174395 N_ambiguous 642598 41888 39156 UnstrandedReadsAssigned:26139228 PositiveStrandReadsAssigned:13644069 NegativeStrandReadsAssigned:13620263 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844645 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844645-trimmed-pair1.fastq SRR13844645-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,193,947 reads, 27,539,201 reads pseudoaligned [quant] estimated average fragment length: 165.663 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR13844645.ke.tsv 35125 SRR13844645.se.tsv 88098 total ==> SRR13844645.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 771.385 0 0 PNS24247 1044 879.337 2.65859 0.13763 PNS24249 1928 1763.34 30.868 0.79688 PNS24246 1044 879.337 2.65859 0.13763 PNS24248 1044 879.337 2.65859 0.13763 PNS24244 1471 1306.34 2262.16 78.8291 PNS24243 293 132.959 1 0.342373 KQK14069 1603 1438.34 206.631 6.53964 KQK14071 474 310.048 1.04345 0.153202 ==> SRR13844645.se.tsv <== BRADI_1g14170v3 214 BRADI_1g53295v3 19 BRADI_1g59795v3 212 BRADI_1g07683v3 1 BRADI_1g00485v3 10 BRADI_1g20270v3 2245 BRADI_1g74790v3 0 BRADI_1g09890v3 0 BRADI_1g77505v3 932 BRADI_1g48960v3 4 SRR13844645 completed mapping pipeline successfully