Starting /dee2/code/volunteer_pipeline.sh SRR13844646 current disk space = 1551144022016 free memory = 1607232604 SRR13844646 SRAfilesize ce70f019545f81dbaa34e400acf1f897 SRR13844646.sra SRR13844646.sra file validated SRR13844646 is paired end SRR13844646 is conventional basespace SRR13844646 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844646_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0645 34.0 33.0 34.0 31.0 34.0 2 33.18725 34.0 33.0 34.0 31.0 34.0 3 33.106 34.0 33.0 34.0 31.0 34.0 4 36.56125 37.0 37.0 37.0 35.0 37.0 5 36.51175 37.0 37.0 37.0 35.0 37.0 6 36.49275 37.0 37.0 37.0 35.0 37.0 7 36.42225 37.0 37.0 37.0 35.0 37.0 8 36.509 37.0 37.0 37.0 35.0 37.0 9 38.45825 39.0 39.0 39.0 37.0 39.0 10-11 38.250875 39.0 39.0 39.0 37.0 39.0 12-13 38.297875 39.0 39.0 39.0 37.0 39.0 14-15 39.823625 41.0 40.0 41.0 37.5 41.0 16-17 39.53175 41.0 39.5 41.0 36.5 41.0 18-19 39.601875 41.0 40.0 41.0 36.5 41.0 20-21 39.625625 41.0 40.0 41.0 37.0 41.0 22-23 39.355875 41.0 39.5 41.0 36.5 41.0 24-25 39.393249999999995 41.0 40.0 41.0 36.5 41.0 26-27 39.22025 41.0 39.5 41.0 36.0 41.0 28-29 39.062749999999994 41.0 40.0 41.0 36.5 41.0 30-31 39.065125 41.0 40.0 41.0 36.5 41.0 32-33 38.88275 41.0 39.0 41.0 36.0 41.0 34-35 38.651625 41.0 39.0 41.0 35.5 41.0 36-37 38.642250000000004 41.0 39.0 41.0 35.0 41.0 38-39 38.5415 41.0 39.0 41.0 35.0 41.0 40-41 38.37575 40.0 38.5 41.0 34.5 41.0 42-43 38.259 40.0 38.0 41.0 34.5 41.0 44-45 38.231624999999994 40.0 38.0 41.0 34.5 41.0 46-47 38.264125 40.0 38.0 41.0 35.0 41.0 48-49 38.183 40.0 38.0 41.0 34.5 41.0 50-51 38.28175 40.0 38.0 41.0 34.5 41.0 52-53 38.020875000000004 40.0 38.0 41.0 34.0 41.0 54-55 37.959125 40.0 38.0 41.0 34.0 41.0 56-57 37.826375 40.0 37.5 41.0 34.0 41.0 58-59 37.59375 40.0 37.0 41.0 33.5 41.0 60-61 37.08325 39.0 36.0 41.0 32.5 41.0 62-63 37.312749999999994 39.0 36.0 41.0 34.0 41.0 64-65 37.027 39.0 36.0 41.0 33.0 41.0 66-67 36.717124999999996 39.0 35.0 41.0 33.5 41.0 68-69 36.254374999999996 37.5 35.0 40.0 33.0 41.0 70-71 35.732625 37.0 35.0 39.0 32.0 41.0 72-73 35.46525 36.5 35.0 39.0 32.0 41.0 74-75 35.15375 36.0 35.0 39.0 32.5 40.5 76-77 34.39475 35.0 34.5 37.0 31.5 39.0 78-79 34.253875 35.0 35.0 37.0 31.0 39.0 80-81 34.100624999999994 35.0 35.0 36.5 32.0 38.5 82-83 33.870875 35.0 35.0 36.0 31.5 37.0 84-85 33.50475 35.0 34.5 36.0 31.0 37.0 86-87 33.260625000000005 35.0 34.5 35.0 30.5 36.5 88-89 33.300250000000005 35.0 34.5 35.0 31.0 36.0 90-91 33.086375000000004 35.0 34.5 35.0 30.5 36.0 92-93 33.033 35.0 34.0 35.0 31.0 36.0 94-95 32.90725 35.0 34.0 35.0 31.0 36.0 96-97 32.715375 35.0 34.0 35.0 30.5 35.0 98-99 32.578625 35.0 34.0 35.0 30.0 35.0 100-101 31.497 34.5 32.5 35.0 26.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 13.0 9 14.0 10 21.0 11 16.0 12 5.0 13 4.0 14 3.0 15 2.0 16 4.0 17 2.0 18 5.0 19 6.0 20 10.0 21 3.0 22 4.0 23 6.0 24 4.0 25 8.0 26 16.0 27 12.0 28 18.0 29 23.0 30 45.0 31 35.0 32 70.0 33 74.0 34 123.0 35 174.0 36 345.0 37 918.0 38 1600.0 39 414.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.005751437859466 14.57864466116529 7.25181295323831 55.163790947736935 2 15.675 19.3 46.85 18.175 3 20.0 23.45 26.450000000000003 30.099999999999998 4 25.674999999999997 28.625 22.8 22.900000000000002 5 25.374999999999996 31.15 27.325 16.150000000000002 6 20.175 35.199999999999996 28.625 16.0 7 16.8 19.650000000000002 47.099999999999994 16.45 8 17.474999999999998 23.025000000000002 38.25 21.25 9 18.075 19.85 41.675000000000004 20.4 10-11 22.912499999999998 30.7625 27.5875 18.7375 12-13 19.8375 26.700000000000003 32.0 21.462500000000002 14-15 21.1125 28.225 30.662499999999998 20.0 16-17 22.2 28.012500000000003 29.825000000000003 19.9625 18-19 21.9375 27.750000000000004 28.925 21.3875 20-21 22.1 28.1 28.7 21.099999999999998 22-23 21.8875 29.349999999999998 27.9375 20.825 24-25 22.925 27.6 27.425 22.05 26-27 21.327665958244783 28.403550443805475 28.766095761970245 21.502687835979497 28-29 21.7 28.675 26.337500000000002 23.2875 30-31 22.625 28.9 27.6625 20.8125 32-33 22.2 28.999999999999996 27.212500000000002 21.587500000000002 34-35 22.027753469183647 28.703587948493563 27.69096137017127 21.57769721215152 36-37 22.452806600825102 28.778597324665583 27.078384798099762 21.690211276409553 38-39 21.4375 29.45 26.8125 22.3 40-41 21.81522690336292 28.90361295161895 28.27853481685211 21.002625328166022 42-43 21.8875 29.2375 28.025 20.849999999999998 44-45 22.475 28.125 28.262500000000003 21.1375 46-47 21.675 28.3375 27.5625 22.425 48-49 21.8625 28.6125 27.6625 21.8625 50-51 21.837500000000002 29.4125 27.150000000000002 21.6 52-53 21.65 29.462500000000002 26.75 22.1375 54-55 21.825 28.925 27.0875 22.162499999999998 56-57 21.55 29.025000000000002 27.85 21.575 58-59 21.6125 28.3625 27.237499999999997 22.787499999999998 60-61 21.7875 27.6 28.012500000000003 22.6 62-63 22.475 28.999999999999996 27.1375 21.3875 64-65 22.3 28.712500000000002 26.9125 22.075 66-67 21.8875 27.275 28.025 22.8125 68-69 21.349999999999998 28.65 28.262500000000003 21.7375 70-71 21.525 28.975 27.5875 21.912499999999998 72-73 22.6 28.6625 26.8375 21.9 74-75 21.8125 29.099999999999998 27.275 21.8125 76-77 21.6 29.4125 27.6375 21.349999999999998 78-79 22.3 29.075 27.150000000000002 21.475 80-81 22.3875 28.6625 27.3375 21.6125 82-83 21.762500000000003 29.025000000000002 27.775 21.4375 84-85 21.275 28.525 28.212500000000002 21.987499999999997 86-87 22.0625 28.3375 28.175 21.425 88-89 21.6625 29.1125 27.125 22.1 90-91 21.675 29.1625 27.5625 21.6 92-93 21.45 29.549999999999997 27.175 21.825 94-95 22.3625 29.462500000000002 26.575 21.6 96-97 21.512500000000003 29.3875 26.650000000000002 22.45 98-99 22.2625 28.512500000000003 27.0 22.225 100-101 22.175 29.612500000000004 26.85 21.3625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 1.0 12 1.5 13 1.5 14 1.0 15 2.0 16 3.5 17 2.0 18 1.0 19 2.0 20 3.5 21 2.5 22 2.5 23 2.5 24 4.0 25 6.0 26 8.0 27 11.0 28 12.5 29 16.0 30 20.0 31 27.0 32 44.0 33 64.5 34 77.5 35 93.5 36 116.5 37 154.0 38 189.0 39 209.5 40 240.5 41 229.5 42 226.0 43 238.0 44 218.5 45 207.5 46 181.0 47 162.5 48 164.0 49 155.0 50 150.0 51 140.0 52 113.0 53 87.5 54 70.5 55 55.5 56 45.0 57 40.5 58 36.0 59 30.5 60 21.5 61 14.0 62 14.0 63 16.5 64 14.0 65 9.0 66 5.5 67 7.0 68 7.0 69 5.0 70 4.5 71 2.5 72 1.0 73 2.0 74 2.0 75 1.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.0125 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.21063394683026 96.05 2 1.5593047034764826 3.05 3 0.10224948875255625 0.3 4 0.07668711656441718 0.3 5 0.025562372188139063 0.125 6 0.0 0.0 7 0.025562372188139063 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit CCCGTTTATTACTTTTTAGTTGGTATCAAGTATTGCTGCACTAAGCTATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.7124999999999999 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGAGA 15 0.009957196 47.5 16-17 >>END_MODULE SRR13844646 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844646_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.22 34.0 31.0 34.0 27.0 34.0 2 32.37 34.0 31.0 34.0 27.0 34.0 3 32.264 34.0 31.0 34.0 27.0 34.0 4 35.71075 37.0 35.0 37.0 31.0 37.0 5 35.72175 37.0 35.0 37.0 32.0 37.0 6 35.3025 37.0 35.0 37.0 31.0 37.0 7 35.39575 37.0 35.0 37.0 32.0 37.0 8 35.38375 37.0 35.0 37.0 32.0 37.0 9 35.9915 39.0 37.0 39.0 31.0 39.0 10-11 35.707750000000004 39.0 38.0 39.0 31.5 39.0 12-13 35.469375 39.0 37.5 39.0 31.0 39.0 14-15 36.80775 41.0 39.0 41.0 30.5 41.0 16-17 36.813125 41.0 39.0 41.0 31.0 41.0 18-19 36.606875 41.0 39.0 41.0 28.5 41.0 20-21 36.321875 41.0 38.5 41.0 28.0 41.0 22-23 36.378375000000005 41.0 38.0 41.0 27.0 41.0 24-25 36.664625 41.0 39.0 41.0 30.0 41.0 26-27 36.57275 41.0 38.0 41.0 30.0 41.0 28-29 36.46925 41.0 38.0 41.0 30.0 41.0 30-31 36.417500000000004 41.0 38.0 41.0 30.0 41.0 32-33 36.180875 40.0 38.0 41.0 30.0 41.0 34-35 36.172875000000005 40.0 38.0 41.0 30.0 41.0 36-37 35.942 40.0 38.0 41.0 26.0 41.0 38-39 35.678625 40.0 38.0 41.0 24.0 41.0 40-41 35.32625 40.0 38.0 41.0 7.0 41.0 42-43 35.14125 40.0 37.5 41.0 2.0 41.0 44-45 34.582499999999996 40.0 36.5 41.0 2.0 41.0 46-47 34.637625 40.0 36.5 41.0 2.0 41.0 48-49 34.519999999999996 40.0 36.5 41.0 2.0 41.0 50-51 33.93025 39.0 35.5 40.5 2.0 41.0 52-53 33.7935 39.0 34.5 40.5 2.0 41.0 54-55 34.378625 39.5 35.0 41.0 2.0 41.0 56-57 34.656625000000005 40.0 35.0 41.0 2.0 41.0 58-59 34.76175 40.0 35.0 41.0 2.0 41.0 60-61 34.310375 39.5 35.0 41.0 2.0 41.0 62-63 33.905 39.0 35.0 41.0 2.0 41.0 64-65 33.613625 39.0 35.0 41.0 2.0 41.0 66-67 33.102125 37.5 35.0 40.0 2.0 41.0 68-69 32.75 37.0 34.5 40.0 2.0 41.0 70-71 31.8735 36.0 34.0 39.0 2.0 41.0 72-73 31.648125 36.0 34.0 39.0 2.0 41.0 74-75 31.4015 35.5 34.0 38.5 2.0 40.0 76-77 31.033 35.0 33.5 37.0 2.0 39.0 78-79 30.5235 35.0 33.0 37.0 2.0 39.0 80-81 30.113374999999998 35.0 33.0 36.0 2.0 37.5 82-83 29.5835 35.0 32.5 35.5 2.0 37.0 84-85 22.6125 32.0 2.0 35.0 2.0 36.0 86-87 22.630625000000002 32.5 2.0 35.0 2.0 36.0 88-89 22.901875 32.0 2.0 35.0 2.0 35.5 90-91 23.421625 32.0 2.0 35.0 2.0 35.0 92-93 23.98475 32.5 2.0 35.0 2.0 35.0 94-95 24.04825 33.0 2.0 35.0 2.0 35.0 96-97 23.792 33.0 2.0 35.0 2.0 35.0 98-99 23.5285 33.0 2.0 35.0 2.0 35.0 100-101 21.810125 29.5 2.0 34.5 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 63.0 4 57.0 5 3.0 6 37.0 7 98.0 8 27.0 9 36.0 10 25.0 11 19.0 12 16.0 13 13.0 14 26.0 15 13.0 16 9.0 17 9.0 18 8.0 19 17.0 20 8.0 21 8.0 22 15.0 23 14.0 24 20.0 25 23.0 26 31.0 27 39.0 28 44.0 29 50.0 30 78.0 31 138.0 32 229.0 33 158.0 34 148.0 35 257.0 36 390.0 37 733.0 38 938.0 39 182.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.7 13.600000000000001 6.925000000000001 54.775 2 16.5 17.275 50.425 15.8 3 21.075 21.55 27.150000000000002 30.225 4 25.2 27.450000000000003 23.799999999999997 23.549999999999997 5 25.1 29.925 29.099999999999998 15.875 6 20.70975918884664 33.18124207858048 30.519645120405574 15.5893536121673 7 18.075 19.5 45.375 17.05 8 17.421953675730112 23.36354481369587 37.865055387713994 21.34944612286002 9 18.782791185729273 20.383001049317944 41.26442812172088 19.5697796432319 10-11 21.845499268714267 30.235341045073795 29.73008908389842 18.189070602313524 12-13 21.025847060399087 24.25338154546672 34.485067630909334 20.235703763224855 14-15 21.19989238633306 27.037933817594833 32.674199623352166 19.087974172719935 16-17 21.69823995700658 26.911191723767296 31.183662501679432 20.206905817546687 18-19 22.167683735738922 28.38949323427965 29.29158928097639 20.15123374900504 20-21 22.547720042417815 27.75715800636267 28.791092258748673 20.90402969247084 22-23 22.284815930826674 28.913926372330668 28.6257041792218 20.175553517620855 24-25 22.17363344051447 28.707395498392284 27.768488745980708 21.35048231511254 26-27 21.411346617591065 29.24228963066379 27.579642086559208 21.766721665185937 28-29 22.52298263534219 29.098569969356486 27.74514811031665 20.633299284984677 30-31 21.954298699659134 29.188233808862517 27.509152884736775 21.34831460674157 32-33 21.825944995604672 28.406379505211603 27.590104232073337 22.177571267110384 34-35 21.543367346938773 28.533163265306122 28.50765306122449 21.415816326530614 36-37 22.19629197458836 29.353040321535072 27.693504472967717 20.757163230908855 38-39 21.24561175399818 28.24080093615915 28.825900403068523 21.68768690677415 40-41 21.639127561136814 28.010575016523465 28.85657633840053 21.493721083939192 42-43 22.179453145739313 28.48420493761614 27.993097955933106 21.34324396071144 44-45 21.8318358589245 28.362612310580666 27.651870725492827 22.15368110500201 46-47 22.373879298809047 29.18506623845845 27.164458718051655 21.27659574468085 48-49 21.814516129032256 28.413978494623652 27.56720430107527 22.204301075268816 50-51 22.088514507287073 28.680304853590048 28.118732450862417 21.112448188260462 52-53 21.511552016708002 28.390549536614017 27.581255710742724 22.516642735935257 54-55 22.262537255410134 28.495529350783983 27.17377219126604 22.068161202539844 56-57 22.020825298881604 27.90847152590307 28.06273299910014 22.007970176115183 58-59 22.715572715572716 27.99227799227799 27.464607464607464 21.827541827541825 60-61 22.444529947415674 28.254456842375276 27.356675644478646 21.94433756573041 62-63 21.351666882864183 29.082890128421322 26.968478401867944 22.596964586846543 64-65 21.44754316069057 29.721115537848608 26.82602921646746 22.00531208499336 66-67 22.53727369542066 28.66080937167199 26.77050053248136 22.031416400425986 68-69 22.63721552878179 29.2235609103079 27.630522088353416 20.508701472556893 70-71 21.09772423025435 28.55421686746988 27.48326639892905 22.86479250334672 72-73 22.48713085884584 29.08425900839881 27.363858033053372 21.064752099701977 74-75 22.273592602665214 29.480554800108784 26.55697579548545 21.68887680174055 76-77 21.873329770176376 28.995189738107964 27.231427044361308 21.900053447354356 78-79 21.24062713019768 29.093387866394 27.225630538513972 22.44035446489434 80-81 22.05507051712559 28.945601074546673 27.266621893888516 21.732706514439222 82-83 22.343935594562492 28.2961594298535 27.662663323214993 21.697241652369012 84-85 20.6651654252555 28.286852589641438 28.875801143253078 22.172180841849993 86-87 22.319474835886215 28.059249284632216 26.94832519777815 22.672950681703416 88-89 22.76397023903752 28.58952034193446 27.180623713788187 21.465885705239828 90-91 22.78675904541955 28.098537336412626 27.590454195535024 21.524249422632792 92-93 22.456034871486548 28.438298511949494 27.807004358935817 21.298662257628138 94-95 23.268285416356324 28.645910919112172 26.903023983315954 21.182779681215553 96-97 23.635815495930057 27.93186614410612 27.283690081398852 21.148628278564967 98-99 21.910695742471443 29.253819908025513 27.28081886960392 21.554665479899125 100-101 23.714493809176986 28.201019664967227 26.511289147851418 21.57319737800437 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 2.5 2 5.0 3 12.0 4 18.0 5 14.5 6 12.5 7 10.0 8 10.0 9 15.0 10 17.0 11 14.0 12 11.0 13 12.0 14 12.5 15 15.0 16 13.0 17 10.0 18 14.5 19 16.5 20 16.5 21 15.0 22 12.0 23 14.0 24 21.0 25 20.5 26 15.5 27 18.5 28 26.5 29 32.5 30 39.5 31 48.5 32 53.0 33 72.0 34 86.5 35 106.0 36 133.5 37 154.5 38 186.0 39 209.5 40 202.0 41 196.5 42 198.0 43 199.5 44 202.5 45 192.5 46 178.0 47 150.5 48 125.5 49 120.5 50 109.5 51 95.0 52 83.5 53 68.5 54 66.5 55 51.0 56 47.0 57 44.0 58 22.0 59 18.0 60 20.5 61 15.0 62 11.5 63 11.0 64 10.0 65 8.5 66 4.5 67 4.5 68 4.0 69 3.5 70 4.5 71 4.0 72 3.0 73 3.0 74 2.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.375 7 0.0 8 0.7000000000000001 9 4.7 10-11 5.9875 12-13 6.6625000000000005 14-15 7.074999999999999 16-17 6.9625 18-19 5.775 20-21 5.7 22-23 4.5875 24-25 2.8125 26-27 1.5125 28-29 2.1 30-31 0.9875 32-33 0.46249999999999997 34-35 2.0 36-37 3.5875 38-39 3.8625 40-41 5.4375 42-43 5.825 44-45 6.7875000000000005 46-47 6.5875 48-49 7.000000000000001 50-51 6.5125 52-53 4.237500000000001 54-55 3.5374999999999996 56-57 2.7625 58-59 2.875 60-61 2.5375 62-63 3.6374999999999997 64-65 5.875 66-67 6.1 68-69 6.625 70-71 6.625 72-73 7.725 74-75 8.075000000000001 76-77 6.45 78-79 8.3125 80-81 6.937500000000001 82-83 5.2875 84-85 27.8375 86-87 25.7375 88-89 21.0375 90-91 18.8125 92-93 16.8375 94-95 16.0875 96-97 17.075000000000003 98-99 15.737499999999999 100-101 14.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41796376626691 96.42500000000001 2 1.3013523858127074 2.55 3 0.17861699413115592 0.525 4 0.05103342689461597 0.2 5 0.025516713447307986 0.125 6 0.0 0.0 7 0.025516713447307986 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGTGGCCAGTTATCCTTGTTACCTTTTATCTGTGATGTTATCGCTCCC 7 0.17500000000000002 No Hit GCCGGTAATACGACTCACTATAGGGAGACGCGTGTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 485 0.0040049218 5.710783 9 >>END_MODULE Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786004 spots for SRR13844646.sra Written 1786004 spots for SRR13844646.sra Read 1786013 spots for SRR13844646.sra Written 1786013 spots for SRR13844646.sra SRR ids: ['SRR13844646.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_he6jshf0 SRR13844646.sra spots: 35720089 blocks: [[1, 1786004], [1786005, 3572008], [3572009, 5358012], [5358013, 7144016], [7144017, 8930020], [8930021, 10716024], [10716025, 12502028], [12502029, 14288032], [14288033, 16074036], [16074037, 17860040], [17860041, 19646044], [19646045, 21432048], [21432049, 23218052], [23218053, 25004056], [25004057, 26790060], [26790061, 28576064], [28576065, 30362068], [30362069, 32148072], [32148073, 33934076], [33934077, 35720089]] SRR13844646 file size 8629258 SRR13844646 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844646 SRR13844646_1.fastq SRR13844646_2.fastq Input file: SRR13844646_1.fastq Paired file: SRR13844646_2.fastq trimmed: SRR13844646-trimmed-pair1.fastq, SRR13844646-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:06:22 2024 >> started Fri Dec 6 13:06:55 2024 >> done (33.287s) 35720089 read pairs processed; of these: 488178 ( 1.37%) short read pairs filtered out after trimming by size control 267280 ( 0.75%) empty read pairs filtered out after trimming by size control 34964631 (97.89%) read pairs available; of these: 17506647 (50.07%) trimmed read pairs available after processing 17457984 (49.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 47 0.00% 19 65 0.00% 20 145 0.00% 21 234 0.00% 22 304 0.00% 23 417 0.00% 24 476 0.00% 25 550 0.00% 26 632 0.00% 27 736 0.00% 28 935 0.00% 29 1040 0.00% 30 1276 0.00% 31 1579 0.00% 32 1987 0.01% 33 2426 0.01% 34 3119 0.01% 35 3841 0.01% 36 4824 0.01% 37 5896 0.02% 38 6880 0.02% 39 8012 0.02% 40 9202 0.03% 41 10276 0.03% 42 11094 0.03% 43 12730 0.04% 44 13776 0.04% 45 15229 0.04% 46 16549 0.05% 47 18050 0.05% 48 19391 0.06% 49 21134 0.06% 50 24460 0.07% 51 31409 0.09% 52 38572 0.11% 53 44811 0.13% 54 47711 0.14% 55 47785 0.14% 56 48270 0.14% 57 47550 0.14% 58 49605 0.14% 59 235841 0.67% 60 261221 0.75% 61 212235 0.61% 62 202207 0.58% 63 184412 0.53% 64 145107 0.42% 65 116118 0.33% 66 94412 0.27% 67 83657 0.24% 68 76301 0.22% 69 72636 0.21% 70 72927 0.21% 71 69791 0.20% 72 68771 0.20% 73 70482 0.20% 74 71268 0.20% 75 82989 0.24% 76 97389 0.28% 77 99054 0.28% 78 92839 0.27% 79 85495 0.24% 80 82862 0.24% 81 88979 0.25% 82 90231 0.26% 83 92468 0.26% 84 105239 0.30% 85 105784 0.30% 86 119441 0.34% 87 135710 0.39% 88 162672 0.47% 89 207595 0.59% 90 307816 0.88% 91 706639 2.02% 92 4887166 13.98% 93 1324788 3.79% 94 806012 2.31% 95 633110 1.81% 96 585651 1.67% 97 623708 1.78% 98 730757 2.09% 99 938355 2.68% 100 1703487 4.87% 101 17457984 49.93% 34964631 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=26 prefix-density=0.37 prefix-fanout=2.1 sequence=AGGATCCATCCACAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=82.64 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.3 sequence=AACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGAACGGAACAGAACAGGAACACACGACAGGTAGCATCACGGACAAACACCTAATGGTAACCCTTAAACATCTCAAACCCTACGCGATGGAGCGAGATCTAGGATACTCGGGAGCGATAACATCACAGATAAAAGGTAACAAGGATAACTGGCCACGAGGGGCCCCACCATTCACTCCCTCCAGTTGCCGCCGCCGGAGCCT criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=21 prefix-density=0.42 prefix-fanout=2.3 sequence=GTAGTGTTCCCCGTCCTGCTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=94.13 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.2 sequence=AACAAAACTTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGAACGGAACAGAACAGGAACACACGACAGGTAGCATCACGGACAAACACCTAATGGTAACCCTTAAACATCTCAAACCCTACGCGATGGAGCGAGATCTAGGATACTCGGGAGCGATAACATCAC SRR13844646 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:07:31 Started mapping on | Dec 06 13:07:31 Finished on | Dec 06 13:09:09 Mapping speed, Million of reads per hour | 1284.42 Number of input reads | 34964631 Average input read length | 189 UNIQUE READS: Uniquely mapped reads number | 33064403 Uniquely mapped reads % | 94.57% Average mapped length | 188.71 Number of splices: Total | 9970248 Number of splices: Annotated (sjdb) | 9268582 Number of splices: GT/AG | 9637492 Number of splices: GC/AG | 133163 Number of splices: AT/AC | 4786 Number of splices: Non-canonical | 194807 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.34% Deletion average length | 1.03 Insertion rate per base | 0.02% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 721027 % of reads mapped to multiple loci | 2.06% Number of reads mapped to too many loci | 12861 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.26% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2404151 2404151 2404151 N_multimapping 721027 721027 721027 N_noFeature 1404479 17096773 16684241 N_ambiguous 795969 56478 54682 UnstrandedReadsAssigned:30863955 PositiveStrandReadsAssigned:15911152 NegativeStrandReadsAssigned:16325480 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844646 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844646-trimmed-pair1.fastq SRR13844646-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,964,631 reads, 32,796,662 reads pseudoaligned [quant] estimated average fragment length: 168.089 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR13844646.ke.tsv 35125 SRR13844646.se.tsv 88098 total ==> SRR13844646.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 768.934 0 0 PNS24247 1044 876.911 1.63113 0.0721803 PNS24249 1928 1760.91 22.9823 0.506457 PNS24246 1044 876.911 1.63113 0.0721803 PNS24248 1044 876.911 1.63113 0.0721803 PNS24244 1471 1303.91 2875.12 85.5646 PNS24243 293 130.752 1 0.296781 KQK14069 1603 1435.91 203.054 5.48744 KQK14071 474 307.61 0 0 ==> SRR13844646.se.tsv <== BRADI_1g14170v3 202 BRADI_1g53295v3 51 BRADI_1g59795v3 528 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 3414 BRADI_1g74790v3 4 BRADI_1g09890v3 1 BRADI_1g77505v3 1299 BRADI_1g48960v3 2 SRR13844646 completed mapping pipeline successfully