Starting /dee2/code/volunteer_pipeline.sh SRR13844647 current disk space = 1551158214656 free memory = 1607223580 SRR13844647 SRAfilesize b89cb9ce0e3b5a1279155616a4f9a251 SRR13844647.sra SRR13844647.sra file validated SRR13844647 is paired end SRR13844647 is conventional basespace SRR13844647 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844647_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.304 34.0 34.0 34.0 31.0 34.0 2 33.38125 34.0 34.0 34.0 31.0 34.0 3 33.441 34.0 34.0 34.0 31.0 34.0 4 36.66925 37.0 37.0 37.0 35.0 37.0 5 36.629 37.0 37.0 37.0 35.0 37.0 6 36.593 37.0 37.0 37.0 35.0 37.0 7 36.596 37.0 37.0 37.0 35.0 37.0 8 36.54625 37.0 37.0 37.0 35.0 37.0 9 38.52825 39.0 39.0 39.0 37.0 39.0 10-11 38.429625 39.0 39.0 39.0 37.0 39.0 12-13 38.510625000000005 39.0 39.0 39.0 37.0 39.0 14-15 40.1275 41.0 40.0 41.0 38.0 41.0 16-17 40.133250000000004 41.0 40.0 41.0 38.0 41.0 18-19 40.02225 41.0 40.0 41.0 38.0 41.0 20-21 39.886625 41.0 40.0 41.0 38.0 41.0 22-23 39.8505 41.0 40.0 41.0 38.0 41.0 24-25 39.610375 41.0 40.0 41.0 37.5 41.0 26-27 39.440375 41.0 40.0 41.0 37.5 41.0 28-29 39.483999999999995 41.0 40.0 41.0 38.0 41.0 30-31 39.414249999999996 41.0 40.0 41.0 38.0 41.0 32-33 39.284875 41.0 40.0 41.0 37.5 41.0 34-35 39.27525 41.0 40.0 41.0 37.0 41.0 36-37 39.210125 41.0 40.0 41.0 37.0 41.0 38-39 39.170249999999996 41.0 40.0 41.0 37.0 41.0 40-41 39.099375 41.0 40.0 41.0 37.0 41.0 42-43 38.885999999999996 41.0 39.5 41.0 36.0 41.0 44-45 38.909000000000006 41.0 39.0 41.0 35.5 41.0 46-47 38.825375 41.0 39.0 41.0 35.0 41.0 48-49 38.73925 40.5 39.0 41.0 35.0 41.0 50-51 38.784625 41.0 39.0 41.0 35.0 41.0 52-53 38.6445 41.0 39.0 41.0 35.0 41.0 54-55 38.49925 41.0 38.5 41.0 35.0 41.0 56-57 38.339 40.0 38.0 41.0 35.0 41.0 58-59 37.94475 40.0 37.0 41.0 34.0 41.0 60-61 37.8925 40.0 37.0 41.0 34.5 41.0 62-63 37.808375 39.5 37.0 41.0 35.0 41.0 64-65 37.5565 39.0 36.0 41.0 34.5 41.0 66-67 37.298375 39.0 36.0 41.0 35.0 41.0 68-69 36.946124999999995 38.5 35.0 40.5 34.0 41.0 70-71 36.5265 37.0 35.0 39.5 34.0 41.0 72-73 36.124 37.0 35.0 39.0 34.0 41.0 74-75 35.581625 36.0 35.0 39.0 33.0 40.5 76-77 34.81675 35.0 34.5 37.0 32.0 39.0 78-79 34.7255 35.0 35.0 37.0 32.5 39.0 80-81 34.5625 35.0 35.0 36.5 33.0 39.0 82-83 34.3485 35.0 35.0 36.0 33.0 37.0 84-85 33.968500000000006 35.0 35.0 36.0 32.0 37.0 86-87 33.941 35.0 35.0 35.5 33.0 36.5 88-89 33.777125 35.0 35.0 35.0 32.5 36.0 90-91 33.715500000000006 35.0 35.0 35.0 32.5 36.0 92-93 33.586625 35.0 35.0 35.0 32.0 36.0 94-95 33.5805 35.0 35.0 35.0 32.5 36.0 96-97 33.506249999999994 35.0 35.0 35.0 33.0 36.0 98-99 33.382625000000004 35.0 35.0 35.0 32.0 35.0 100-101 32.208999999999996 34.5 33.0 35.0 28.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 8.0 9 12.0 10 13.0 11 16.0 12 8.0 13 1.0 14 1.0 15 2.0 16 3.0 17 1.0 18 3.0 19 2.0 20 4.0 21 2.0 22 3.0 23 7.0 24 6.0 25 6.0 26 9.0 27 13.0 28 16.0 29 21.0 30 19.0 31 27.0 32 27.0 33 42.0 34 87.0 35 142.0 36 312.0 37 868.0 38 1824.0 39 493.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.91718789091819 15.211408556417313 7.9809857393044785 53.890417813360024 2 16.45 21.725 48.075 13.750000000000002 3 20.925 24.45 29.375 25.25 4 25.8 31.1 23.05 20.05 5 25.275 31.275 27.325 16.125 6 19.400000000000002 35.925000000000004 28.725 15.950000000000001 7 16.875 16.950000000000003 47.349999999999994 18.825 8 17.45 22.1 36.65 23.799999999999997 9 20.0 20.525 38.35 21.125 10-11 23.4625 31.0 26.625 18.912499999999998 12-13 20.5625 25.15 32.5125 21.775 14-15 22.3375 26.724999999999998 30.475 20.4625 16-17 22.912499999999998 26.787499999999998 29.212500000000002 21.087500000000002 18-19 22.425 27.250000000000004 28.849999999999998 21.475 20-21 22.1875 27.6125 28.4375 21.762500000000003 22-23 22.4875 27.6875 28.3875 21.4375 24-25 22.0625 27.962500000000002 27.700000000000003 22.275 26-27 23.125 28.375 27.762500000000003 20.7375 28-29 22.925 28.025 27.487499999999997 21.5625 30-31 22.35 29.125 26.325 22.2 32-33 21.75 28.525 28.0625 21.6625 34-35 22.0875 28.050000000000004 26.987499999999997 22.875 36-37 22.5 28.0625 27.3125 22.125 38-39 22.1375 27.8875 27.237499999999997 22.7375 40-41 22.177772221527693 29.391173896737094 26.24078009751219 22.190273784223027 42-43 22.075 28.050000000000004 27.175 22.7 44-45 22.875 27.8875 27.025 22.2125 46-47 23.225 27.712500000000002 27.025 22.037499999999998 48-49 22.45 27.5875 28.349999999999998 21.6125 50-51 22.6875 27.762500000000003 27.025 22.525000000000002 52-53 23.4125 27.250000000000004 27.125 22.2125 54-55 23.125 27.400000000000002 27.725 21.75 56-57 22.9375 27.6 27.037499999999998 22.425 58-59 22.900000000000002 28.1625 26.724999999999998 22.2125 60-61 22.875 27.1625 27.3875 22.575 62-63 23.3875 27.950000000000003 27.212500000000002 21.45 64-65 22.1375 27.400000000000002 27.375 23.0875 66-67 22.85 28.075 27.375 21.7 68-69 22.8625 27.500000000000004 27.737499999999997 21.9 70-71 22.4625 27.762500000000003 27.150000000000002 22.625 72-73 22.537499999999998 27.0125 27.4125 23.0375 74-75 22.825 27.875 27.6125 21.6875 76-77 22.375 27.750000000000004 26.9125 22.9625 78-79 22.75 27.474999999999998 28.037499999999998 21.7375 80-81 21.875 28.299999999999997 26.8375 22.9875 82-83 23.3 27.8375 27.200000000000003 21.6625 84-85 22.5625 28.749999999999996 27.3375 21.349999999999998 86-87 22.3 28.000000000000004 26.937499999999996 22.7625 88-89 22.45 27.224999999999998 27.875 22.45 90-91 21.8875 29.375 25.95 22.787499999999998 92-93 22.7375 27.6375 28.0625 21.5625 94-95 22.625 28.475 26.887499999999996 22.0125 96-97 22.5875 28.299999999999997 26.6125 22.5 98-99 22.975 28.1375 27.025 21.8625 100-101 22.375 28.6375 26.7125 22.275 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.5 15 1.5 16 2.0 17 3.5 18 2.5 19 0.5 20 1.0 21 2.5 22 2.5 23 3.5 24 3.5 25 2.5 26 4.5 27 9.0 28 10.5 29 17.5 30 24.0 31 25.5 32 31.0 33 38.5 34 56.5 35 76.5 36 93.5 37 131.5 38 174.0 39 187.0 40 184.5 41 196.5 42 232.5 43 246.5 44 228.5 45 216.5 46 203.0 47 206.5 48 209.5 49 190.5 50 157.0 51 144.5 52 122.0 53 83.0 54 80.0 55 73.5 56 57.5 57 43.0 58 39.0 59 32.5 60 22.0 61 19.0 62 13.5 63 12.0 64 12.0 65 6.5 66 5.5 67 7.5 68 8.5 69 4.0 70 4.0 71 8.5 72 6.5 73 5.5 74 6.5 75 3.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0125 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11616161616162 98.125 2 0.8333333333333334 1.6500000000000001 3 0.025252525252525252 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025252525252525252 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGC 6 0.15 TruSeq Adapter, Index 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.975 0.0 0.0 0.0 0.0 88-89 1.1749999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844647 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844647_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96725 34.0 33.0 34.0 31.0 34.0 2 33.0455 34.0 33.0 34.0 31.0 34.0 3 32.945 34.0 33.0 34.0 31.0 34.0 4 36.31325 37.0 37.0 37.0 35.0 37.0 5 36.2635 37.0 37.0 37.0 35.0 37.0 6 36.32025 37.0 37.0 37.0 35.0 37.0 7 36.33575 37.0 37.0 37.0 35.0 37.0 8 36.31375 37.0 37.0 37.0 35.0 37.0 9 38.1795 39.0 39.0 39.0 37.0 39.0 10-11 37.896249999999995 39.0 39.0 39.0 37.0 39.0 12-13 37.706625 39.0 39.0 39.0 36.0 39.0 14-15 39.263625000000005 41.0 40.0 41.0 37.0 41.0 16-17 39.261250000000004 41.0 40.0 41.0 37.0 41.0 18-19 38.91475 41.0 40.0 41.0 36.5 41.0 20-21 38.69625 41.0 40.0 41.0 37.0 41.0 22-23 38.516625000000005 41.0 40.0 41.0 35.5 41.0 24-25 38.734875 41.0 40.0 41.0 36.0 41.0 26-27 38.70875 41.0 40.0 41.0 36.0 41.0 28-29 38.681875 41.0 40.0 41.0 36.0 41.0 30-31 38.610125 41.0 40.0 41.0 35.5 41.0 32-33 38.54375 41.0 40.0 41.0 35.0 41.0 34-35 38.257125 41.0 39.5 41.0 34.5 41.0 36-37 38.288624999999996 41.0 39.0 41.0 34.5 41.0 38-39 38.06275 41.0 39.0 41.0 33.5 41.0 40-41 37.844875 40.0 38.5 41.0 33.0 41.0 42-43 37.69475 40.0 38.0 41.0 33.0 41.0 44-45 37.498000000000005 40.0 38.0 41.0 32.5 41.0 46-47 37.233625 40.0 38.0 41.0 32.0 41.0 48-49 36.934749999999994 40.0 38.0 41.0 32.0 41.0 50-51 36.278499999999994 39.5 37.5 40.5 31.5 41.0 52-53 36.421875 39.5 37.5 40.5 31.0 41.0 54-55 36.80775 40.0 37.0 41.0 31.5 41.0 56-57 37.022375 40.0 37.0 41.0 32.5 41.0 58-59 37.053375 40.0 37.0 41.0 32.5 41.0 60-61 36.99025 40.0 37.0 41.0 33.0 41.0 62-63 36.42575 39.0 36.0 41.0 31.5 41.0 64-65 36.358000000000004 39.0 35.0 41.0 32.0 41.0 66-67 35.759249999999994 38.5 35.0 41.0 31.5 41.0 68-69 35.262625 37.5 35.0 40.5 31.0 41.0 70-71 34.718875 37.0 35.0 39.5 29.5 41.0 72-73 34.230000000000004 36.5 35.0 39.0 29.0 41.0 74-75 33.49325 36.0 35.0 38.5 26.0 40.0 76-77 33.4015 35.0 35.0 37.0 28.0 39.0 78-79 33.211375000000004 35.0 35.0 37.0 29.0 39.0 80-81 32.836375000000004 35.0 34.5 36.5 28.0 38.0 82-83 32.343125 35.0 34.0 36.0 26.0 37.0 84-85 28.620125 35.0 31.5 35.5 2.0 37.0 86-87 28.746875 35.0 32.0 35.0 2.0 36.0 88-89 28.99125 35.0 32.0 35.0 2.0 36.0 90-91 29.228875000000002 35.0 32.0 35.0 2.0 36.0 92-93 29.509 35.0 33.0 35.0 2.0 36.0 94-95 29.326124999999998 35.0 32.5 35.0 2.0 35.0 96-97 29.17825 35.0 32.5 35.0 2.0 35.0 98-99 29.13525 35.0 33.0 35.0 2.0 35.0 100-101 28.0745 34.0 29.5 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 2.0 5 3.0 6 23.0 7 22.0 8 25.0 9 36.0 10 21.0 11 10.0 12 12.0 13 11.0 14 3.0 15 9.0 16 16.0 17 5.0 18 2.0 19 5.0 20 6.0 21 2.0 22 8.0 23 18.0 24 27.0 25 25.0 26 15.0 27 19.0 28 32.0 29 32.0 30 53.0 31 82.0 32 166.0 33 97.0 34 84.0 35 181.0 36 343.0 37 783.0 38 1420.0 39 393.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.549999999999997 15.299999999999999 6.950000000000001 54.2 2 16.475 22.0 47.9 13.625000000000002 3 20.45 24.825 29.575000000000003 25.15 4 24.325 30.5 23.549999999999997 21.625 5 24.325 33.175 27.200000000000003 15.299999999999999 6 19.25 33.875 29.075 17.8 7 17.125 17.275 45.775 19.825 8 18.0 21.075 37.025000000000006 23.9 9 20.150000000000002 18.95 40.075 20.825 10-11 22.509457755359392 29.987389659520808 27.326607818411098 20.1765447667087 12-13 21.195652173913043 24.039433771486348 33.05106167846309 21.713852376137513 14-15 21.170374115267947 26.870576339737106 31.04145601617796 20.917593528816987 16-17 21.893565920869676 27.607129313613953 28.934395145999243 21.564909619517127 18-19 22.614661415322068 26.464235802312285 29.1830771185364 21.738025663829248 20-21 23.32654619496055 26.724357342835326 29.38406719266989 20.565029269534232 22-23 21.675313172213084 28.014677970390988 28.824497026445655 21.485511830950273 24-25 21.85546386596649 28.044511127781945 27.656914228557138 22.443110777694425 26-27 22.4875 28.7 27.450000000000003 21.3625 28-29 22.075 28.287499999999998 27.875 21.762500000000003 30-31 22.162499999999998 28.475 26.787499999999998 22.575 32-33 22.025 28.475 27.3125 22.1875 34-35 22.45 28.3375 27.187499999999996 22.025 36-37 23.3 27.537499999999998 26.825 22.3375 38-39 22.6125 27.987499999999997 26.775 22.625 40-41 22.618600575791714 27.73813994242083 26.711728626861937 22.931530854925523 42-43 22.737556561085974 27.99145299145299 27.476118652589243 21.794871794871796 44-45 22.83802550183058 27.67327357656861 27.231410175482896 22.257290746117913 46-47 22.794117647058822 27.434077079107507 27.26926977687627 22.502535496957403 48-49 22.426187419768933 28.626444159178433 26.93196405648267 22.015404364569964 50-51 21.841155234657037 28.700361010830328 26.882413615265598 22.576070139247033 52-53 22.220804084237397 29.036375239310786 27.27504786215699 21.46777281429483 54-55 22.91377351344527 28.127761646256786 26.3603080419139 22.598156798384043 56-57 21.852970795568982 27.467270896273916 27.84491440080564 22.83484390735146 58-59 22.428139183055976 28.643469490670704 26.638930912758447 22.289460413514878 60-61 23.499811297018493 28.30544722606617 25.890049062775194 22.304692414140142 62-63 22.62874326525498 27.690765568224535 26.876331286806167 22.804159879714323 64-65 22.855701311806257 27.699293642785065 26.488395560040363 22.956609485368315 66-67 21.962736089841755 28.828483920367535 27.067381316998468 22.14139867279224 68-69 22.656049319291036 28.435653737477523 26.881582327254044 22.026714615977394 70-71 22.726101520226745 27.724813192476166 27.00334965215151 22.54573563514558 72-73 22.415346980816274 27.822840221449724 27.78421526973091 21.97759752800309 74-75 22.807469414037346 27.99742433998712 26.735350933676756 22.459755312298775 76-77 22.937314969751576 28.356287810529025 26.348307375466597 22.3580898442528 78-79 22.580229411006574 28.23817502255445 26.253383167934015 22.928212398504964 80-81 23.013733795404953 28.006674367860352 26.479270953664486 22.50032088307021 82-83 22.04525344457085 27.77145746429023 26.949816710908863 23.23347238023006 84-85 22.05667543090856 28.001752848378615 26.920829681565877 23.020742039146946 86-87 23.13013402507566 28.14526588845655 26.25738579045972 22.46721429600807 88-89 22.54335260115607 28.577470745805723 26.801071478922882 22.078105174115326 90-91 22.90340437309715 27.73318571823969 26.9720453916413 22.391364517021866 92-93 22.622498274672186 28.019323671497588 27.425810904071774 21.932367149758456 94-95 22.744881018262316 27.58716104039845 27.268954067515217 22.399003873824018 96-97 23.21867321867322 26.65847665847666 27.27272727272727 22.85012285012285 98-99 22.47084350420396 27.488473013289937 27.52915649579604 22.511526986710063 100-101 23.795503211991434 28.03800856531049 26.43201284796574 21.734475374732334 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 2.0 9 2.5 10 2.5 11 3.5 12 3.5 13 3.0 14 8.5 15 11.5 16 7.5 17 4.5 18 2.5 19 4.5 20 6.0 21 6.0 22 9.5 23 16.0 24 17.0 25 14.0 26 13.0 27 13.0 28 21.0 29 24.5 30 28.5 31 41.5 32 50.5 33 51.5 34 63.0 35 81.5 36 104.0 37 135.0 38 148.5 39 175.5 40 200.0 41 207.0 42 212.5 43 222.5 44 232.0 45 215.0 46 194.0 47 196.0 48 178.0 49 158.5 50 139.0 51 109.5 52 108.5 53 89.0 54 70.5 55 62.0 56 52.5 57 44.5 58 33.0 59 30.0 60 30.0 61 25.5 62 17.0 63 12.0 64 12.0 65 9.0 66 9.0 67 12.5 68 10.0 69 5.5 70 4.0 71 5.5 72 6.0 73 5.0 74 2.0 75 1.0 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.8750000000000001 12-13 1.0999999999999999 14-15 1.0999999999999999 16-17 1.1125 18-19 1.6125 20-21 1.775 22-23 1.2125000000000001 24-25 0.025 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.13749999999999998 42-43 0.5499999999999999 44-45 0.9875 46-47 1.4000000000000001 48-49 2.625 50-51 3.05 52-53 2.0625 54-55 0.9875 56-57 0.7000000000000001 58-59 0.8500000000000001 60-61 0.6375 62-63 0.2375 64-65 0.8999999999999999 66-67 2.0500000000000003 68-69 2.675 70-71 2.9749999999999996 72-73 2.9125 74-75 2.9375 76-77 2.8875 78-79 3.0124999999999997 80-81 2.6125 82-83 1.1125 84-85 14.424999999999999 86-87 13.2625 88-89 11.3375 90-91 9.675 92-93 9.4375 94-95 9.65 96-97 8.425 98-99 7.825 100-101 6.6000000000000005 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0125 0.0 0.0 88-89 0.975 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029492 spots for SRR13844647.sra Written 1029492 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra Read 1029490 spots for SRR13844647.sra Written 1029490 spots for SRR13844647.sra SRR ids: ['SRR13844647.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7yj76ib8 SRR13844647.sra spots: 20589802 blocks: [[1, 1029490], [1029491, 2058980], [2058981, 3088470], [3088471, 4117960], [4117961, 5147450], [5147451, 6176940], [6176941, 7206430], [7206431, 8235920], [8235921, 9265410], [9265411, 10294900], [10294901, 11324390], [11324391, 12353880], [12353881, 13383370], [13383371, 14412860], [14412861, 15442350], [15442351, 16471840], [16471841, 17501330], [17501331, 18530820], [18530821, 19560310], [19560311, 20589802]] SRR13844647 file size 4964892 SRR13844647 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844647 SRR13844647_1.fastq SRR13844647_2.fastq Input file: SRR13844647_1.fastq Paired file: SRR13844647_2.fastq trimmed: SRR13844647-trimmed-pair1.fastq, SRR13844647-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:04:02 2024 >> started Fri Dec 6 13:04:19 2024 >> done (16.953s) 20589802 read pairs processed; of these: 157561 ( 0.77%) short read pairs filtered out after trimming by size control 119511 ( 0.58%) empty read pairs filtered out after trimming by size control 20312730 (98.65%) read pairs available; of these: 3273851 (16.12%) trimmed read pairs available after processing 17038879 (83.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 21 0.00% 20 57 0.00% 21 97 0.00% 22 117 0.00% 23 150 0.00% 24 186 0.00% 25 228 0.00% 26 241 0.00% 27 304 0.00% 28 350 0.00% 29 418 0.00% 30 498 0.00% 31 573 0.00% 32 642 0.00% 33 715 0.00% 34 848 0.00% 35 899 0.00% 36 1001 0.00% 37 1096 0.01% 38 1236 0.01% 39 1293 0.01% 40 1504 0.01% 41 1586 0.01% 42 1712 0.01% 43 1857 0.01% 44 2019 0.01% 45 2280 0.01% 46 2308 0.01% 47 2535 0.01% 48 2855 0.01% 49 2888 0.01% 50 3326 0.02% 51 3596 0.02% 52 4075 0.02% 53 4450 0.02% 54 5068 0.02% 55 5485 0.03% 56 6507 0.03% 57 7185 0.04% 58 8675 0.04% 59 92116 0.45% 60 114493 0.56% 61 114440 0.56% 62 131545 0.65% 63 112051 0.55% 64 78348 0.39% 65 53178 0.26% 66 40096 0.20% 67 33761 0.17% 68 31492 0.16% 69 28452 0.14% 70 27468 0.14% 71 26521 0.13% 72 26259 0.13% 73 27396 0.13% 74 26446 0.13% 75 28164 0.14% 76 26302 0.13% 77 27453 0.14% 78 27818 0.14% 79 28111 0.14% 80 29656 0.15% 81 30792 0.15% 82 33801 0.17% 83 37743 0.19% 84 38114 0.19% 85 39130 0.19% 86 41337 0.20% 87 43403 0.21% 88 46901 0.23% 89 49900 0.25% 90 54658 0.27% 91 67105 0.33% 92 131022 0.65% 93 73841 0.36% 94 81826 0.40% 95 90933 0.45% 96 108691 0.54% 97 132301 0.65% 98 170646 0.84% 99 229951 1.13% 100 559299 2.75% 101 17038879 83.88% 20312730 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=5.38 fanout-score-rank=10 prefix-density=0.59 prefix-fanout=2.9 sequence=GCATGCATGCATGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=43.97 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.8 sequence=TGATGATGCCAGCGTGGTGTTTGCATACTACAAGGAAGGAGCCACTGACCCGACATTCCTGTATTTCGCGCATGGGCTTAAGGAGGTCAAGTGCTAAGCGCACTGTATGCTAAAACTATCAGTTGTCCGTATTTTTGATCTGGTCTGTGGTTGTCAGTAGACTCACCAATGTTGGTGGCGTAACTGTTATCAGATGTTGAGTGTCTTGGAAACTTTTCGATAATTGTGGTGTTTGCTTTGTGTAATGGATCCGTGAAATTGGTGTGACGTTAGTATTTCTGTGTTCTGCATGAACAGTACCTTTCTTTTGCTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=5.26 fanout-score-rank=7 prefix-density=0.58 prefix-fanout=2.8 sequence=GCATGCATGCATGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=45.30 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.1 sequence=TGATGATGCCAGCGTGGTGTTTGCATACTACAAGGAAGGAGCCACTGACCCGACATTCCTGTATTTCGCGCATGGGCTTAAGGAGGTCAAGTGCTAAGCGCACTGTATGCTAAAACTATCAGTTGTCCGTATTTTTGATCTGGTCTGTGGTTGTCAGTAGACTCACCAATGTTGGTGGCGTAACTGTTATCAGATGTTGAGTGTCTTGGAAACTTTTCGATAATTGTGGTGTTTGCTTTGTGTAATGGATCCGTGAAATTGGTGTGACGTTAGTATTTCTGTGT SRR13844647 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:04:54 Started mapping on | Dec 06 13:04:54 Finished on | Dec 06 13:05:42 Mapping speed, Million of reads per hour | 1523.45 Number of input reads | 20312730 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 19621360 Uniquely mapped reads % | 96.60% Average mapped length | 195.46 Number of splices: Total | 9277333 Number of splices: Annotated (sjdb) | 8823873 Number of splices: GT/AG | 9108008 Number of splices: GC/AG | 113872 Number of splices: AT/AC | 4001 Number of splices: Non-canonical | 51452 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 1.69 Insertion rate per base | 0.02% Insertion average length | 1.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416163 % of reads mapped to multiple loci | 2.05% Number of reads mapped to too many loci | 4295 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.27% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 924108 924108 924108 N_multimapping 416163 416163 416163 N_noFeature 760494 10064525 9923813 N_ambiguous 449756 29032 28986 UnstrandedReadsAssigned:18411110 PositiveStrandReadsAssigned:9527803 NegativeStrandReadsAssigned:9668561 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844647 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844647-trimmed-pair1.fastq SRR13844647-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,312,730 reads, 19,174,179 reads pseudoaligned [quant] estimated average fragment length: 166.239 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR13844647.ke.tsv 35125 SRR13844647.se.tsv 88098 total ==> SRR13844647.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.778 0 0 PNS24247 1044 878.761 3.75797 0.340336 PNS24249 1928 1762.76 18.93 0.854639 PNS24246 1044 878.761 3.75797 0.340336 PNS24248 1044 878.761 3.75797 0.340336 PNS24244 1471 1305.76 1062.8 64.7757 PNS24243 293 134.157 1 0.593216 KQK14069 1603 1437.76 6 0.332116 KQK14071 474 309.732 0 0 ==> SRR13844647.se.tsv <== BRADI_1g14170v3 4 BRADI_1g53295v3 226 BRADI_1g59795v3 594 BRADI_1g07683v3 1 BRADI_1g00485v3 19 BRADI_1g20270v3 2384 BRADI_1g74790v3 5 BRADI_1g09890v3 0 BRADI_1g77505v3 882 BRADI_1g48960v3 1 SRR13844647 completed mapping pipeline successfully