Starting /dee2/code/volunteer_pipeline.sh SRR13844648 current disk space = 1551188742144 free memory = 1601156720 SRR13844648 SRAfilesize 8e98e651688690300f018e8a81e137da SRR13844648.sra SRR13844648.sra file validated SRR13844648 is paired end SRR13844648 is conventional basespace SRR13844648 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844648_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.356 34.0 34.0 34.0 31.0 34.0 2 33.41975 34.0 34.0 34.0 31.0 34.0 3 33.4665 34.0 34.0 34.0 31.0 34.0 4 36.7005 37.0 37.0 37.0 35.0 37.0 5 36.64225 37.0 37.0 37.0 35.0 37.0 6 36.637 37.0 37.0 37.0 35.0 37.0 7 36.608 37.0 37.0 37.0 35.0 37.0 8 36.62425 37.0 37.0 37.0 35.0 37.0 9 38.5285 39.0 39.0 39.0 37.0 39.0 10-11 38.43237499999999 39.0 39.0 39.0 37.0 39.0 12-13 38.5405 39.0 39.0 39.0 37.0 39.0 14-15 40.190749999999994 41.0 40.0 41.0 38.5 41.0 16-17 40.161125 41.0 40.0 41.0 38.0 41.0 18-19 40.039 41.0 40.0 41.0 38.0 41.0 20-21 39.926125 41.0 40.0 41.0 38.0 41.0 22-23 39.812875000000005 41.0 40.0 41.0 38.0 41.0 24-25 39.549499999999995 41.0 40.0 41.0 37.5 41.0 26-27 39.339875 41.0 40.0 41.0 37.5 41.0 28-29 39.291124999999994 41.0 40.0 41.0 37.0 41.0 30-31 39.248000000000005 41.0 40.0 41.0 37.0 41.0 32-33 39.170125 41.0 40.0 41.0 37.0 41.0 34-35 39.107875 41.0 40.0 41.0 37.0 41.0 36-37 39.054375 41.0 40.0 41.0 37.0 41.0 38-39 39.067375 41.0 40.0 41.0 36.5 41.0 40-41 38.98125 41.0 40.0 41.0 36.0 41.0 42-43 38.780249999999995 41.0 39.0 41.0 35.5 41.0 44-45 38.725750000000005 41.0 39.0 41.0 35.0 41.0 46-47 38.606125 40.5 39.0 41.0 35.0 41.0 48-49 38.546125 40.5 38.5 41.0 35.0 41.0 50-51 38.554375 41.0 39.0 41.0 35.0 41.0 52-53 38.414875 41.0 38.5 41.0 35.0 41.0 54-55 38.24225 40.5 38.0 41.0 35.0 41.0 56-57 38.04575 40.0 37.5 41.0 34.0 41.0 58-59 37.654625 40.0 37.0 41.0 34.0 41.0 60-61 37.6245 40.0 36.0 41.0 34.0 41.0 62-63 37.579875 39.0 36.0 41.0 34.5 41.0 64-65 37.32525 39.0 35.5 41.0 34.0 41.0 66-67 37.105625 39.0 35.0 41.0 34.5 41.0 68-69 36.697 37.5 35.0 40.5 34.0 41.0 70-71 36.314499999999995 37.0 35.0 39.5 34.0 41.0 72-73 35.923375 36.5 35.0 39.0 34.0 41.0 74-75 35.440625 36.0 35.0 38.5 33.0 40.5 76-77 34.723 35.0 34.5 37.0 31.5 39.0 78-79 34.598625 35.0 35.0 37.0 32.5 39.0 80-81 34.43925 35.0 35.0 36.5 32.5 38.5 82-83 34.189 35.0 35.0 36.0 32.5 37.0 84-85 33.924375 35.0 35.0 36.0 32.0 37.0 86-87 33.88425 35.0 35.0 35.0 32.5 36.5 88-89 33.696250000000006 35.0 35.0 35.0 33.0 36.0 90-91 33.657624999999996 35.0 35.0 35.0 32.0 36.0 92-93 33.496875 35.0 35.0 35.0 32.0 36.0 94-95 33.4785 35.0 35.0 35.0 32.0 36.0 96-97 33.373875 35.0 35.0 35.0 32.0 35.0 98-99 33.318875000000006 35.0 35.0 35.0 32.0 35.0 100-101 32.15225 34.5 33.0 35.0 28.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 7.0 9 21.0 10 23.0 11 12.0 12 3.0 13 3.0 14 2.0 15 0.0 16 1.0 17 1.0 18 2.0 19 6.0 20 1.0 21 7.0 22 4.0 23 7.0 24 3.0 25 7.0 26 9.0 27 15.0 28 12.0 29 15.0 30 18.0 31 22.0 32 39.0 33 55.0 34 83.0 35 163.0 36 329.0 37 952.0 38 1682.0 39 495.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.3 15.0 6.875000000000001 54.825 2 15.15 20.775 51.075 13.0 3 21.7 24.825 28.299999999999997 25.174999999999997 4 24.875 30.599999999999998 25.275 19.25 5 24.8 31.225 26.400000000000002 17.575 6 19.45 34.575 29.375 16.6 7 17.575 18.0 46.375 18.05 8 17.75 21.025 35.825 25.4 9 18.75 21.25 38.65 21.349999999999998 10-11 23.7 29.562500000000004 25.6 21.1375 12-13 21.8 24.7375 32.0 21.462500000000002 14-15 22.225 25.7875 31.4875 20.5 16-17 22.3375 26.424999999999997 29.45 21.7875 18-19 22.6 26.1125 28.125 23.1625 20-21 22.975 26.125 28.15 22.75 22-23 22.725 27.487499999999997 27.5875 22.2 24-25 23.4625 27.450000000000003 26.974999999999998 22.112499999999997 26-27 22.9625 27.575 26.987499999999997 22.475 28-29 21.575 27.675 27.250000000000004 23.5 30-31 23.225 27.237499999999997 26.75 22.787499999999998 32-33 23.35 27.3875 27.0125 22.25 34-35 23.3375 27.3625 26.900000000000002 22.400000000000002 36-37 22.8625 28.025 26.4125 22.7 38-39 23.175 27.187499999999996 26.987499999999997 22.650000000000002 40-41 23.69342335583896 28.00700175043761 26.669167291822955 21.630407601900476 42-43 23.1875 28.199999999999996 25.6125 23.0 44-45 22.675 27.962500000000002 27.1 22.2625 46-47 23.0 27.5625 26.125 23.3125 48-49 22.7125 27.5625 27.55 22.175 50-51 23.3375 26.674999999999997 27.175 22.8125 52-53 23.2875 26.875 26.575 23.2625 54-55 23.375 27.200000000000003 26.474999999999998 22.95 56-57 23.1375 27.025 27.1125 22.725 58-59 22.5875 27.675 27.075 22.662499999999998 60-61 23.4875 27.537499999999998 25.8625 23.1125 62-63 22.8625 27.9125 26.900000000000002 22.325 64-65 23.0875 26.737499999999997 26.5125 23.6625 66-67 22.875 27.650000000000002 26.2875 23.1875 68-69 22.912499999999998 27.125 26.575 23.3875 70-71 23.025000000000002 27.5875 26.3625 23.025000000000002 72-73 23.5 26.887499999999996 26.825 22.787499999999998 74-75 22.075 27.537499999999998 27.625 22.7625 76-77 22.9875 27.075 27.0625 22.875 78-79 22.537499999999998 27.325 26.900000000000002 23.2375 80-81 23.95 26.5 26.5875 22.9625 82-83 22.5125 27.462500000000002 26.424999999999997 23.599999999999998 84-85 23.200000000000003 27.037499999999998 26.55 23.2125 86-87 22.5 27.775 26.5375 23.1875 88-89 24.125 27.3625 25.5125 23.0 90-91 22.162499999999998 27.5625 26.9625 23.3125 92-93 22.35 28.1375 25.575 23.9375 94-95 23.0625 27.425 26.3625 23.150000000000002 96-97 22.475 27.725 26.974999999999998 22.825 98-99 22.287499999999998 28.1 26.35 23.2625 100-101 22.83070767691923 27.969492373093274 26.04401100275069 23.15578894723681 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 1.5 11 1.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.5 17 1.5 18 1.0 19 0.0 20 0.0 21 2.0 22 4.0 23 2.0 24 2.5 25 5.0 26 6.0 27 7.5 28 9.0 29 12.5 30 17.5 31 22.0 32 31.0 33 47.5 34 57.5 35 70.0 36 92.0 37 111.5 38 136.5 39 167.5 40 187.0 41 200.0 42 216.5 43 225.5 44 216.5 45 219.0 46 217.0 47 195.5 48 181.0 49 171.0 50 168.5 51 147.0 52 113.0 53 100.5 54 92.0 55 75.5 56 69.0 57 55.0 58 36.5 59 32.5 60 26.5 61 22.0 62 24.0 63 23.5 64 20.0 65 15.5 66 12.5 67 13.5 68 10.5 69 11.0 70 16.0 71 17.5 72 16.5 73 11.0 74 8.0 75 7.0 76 4.5 77 3.0 78 2.5 79 1.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.025 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.22849807445444 95.65 2 1.3350449293966624 2.6 3 0.23106546854942236 0.675 4 0.07702182284980745 0.3 5 0.07702182284980745 0.375 6 0.025673940949935817 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025673940949935817 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGGAAGCTCGTGTTCGGGGAACGGGCCCAGGAGGCGGAGAAGCTCGTCC 10 0.25 No Hit CTCGCACGCAGCTTCAGACCACGGGAACTTGCTATACTTAAAAAGGAACA 6 0.15 No Hit CCCGTGTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAAT 5 0.125 No Hit CTGAAACATGCAACAGGAGACAGGAACGACGACACTGGGACACATGAACA 5 0.125 No Hit GTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAATGCTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.36250000000000004 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844648 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844648_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0035 34.0 33.0 34.0 31.0 34.0 2 33.07575 34.0 34.0 34.0 31.0 34.0 3 32.97875 34.0 34.0 34.0 31.0 34.0 4 36.32075 37.0 37.0 37.0 35.0 37.0 5 36.2135 37.0 37.0 37.0 35.0 37.0 6 36.26025 37.0 37.0 37.0 35.0 37.0 7 36.30725 37.0 37.0 37.0 35.0 37.0 8 36.31325 37.0 37.0 37.0 35.0 37.0 9 38.166 39.0 39.0 39.0 37.0 39.0 10-11 37.991625 39.0 39.0 39.0 37.0 39.0 12-13 37.78875 39.0 39.0 39.0 36.0 39.0 14-15 39.3365 41.0 40.0 41.0 37.0 41.0 16-17 39.3315 41.0 40.0 41.0 37.0 41.0 18-19 38.933875 41.0 40.0 41.0 37.0 41.0 20-21 38.796375 41.0 40.0 41.0 37.0 41.0 22-23 38.6815 41.0 40.0 41.0 36.5 41.0 24-25 38.948375 41.0 40.0 41.0 37.0 41.0 26-27 38.977625 41.0 40.0 41.0 37.0 41.0 28-29 38.92675 41.0 40.0 41.0 36.5 41.0 30-31 38.8135 41.0 40.0 41.0 36.0 41.0 32-33 38.705875 41.0 40.0 41.0 36.0 41.0 34-35 38.55825 41.0 39.5 41.0 35.0 41.0 36-37 38.46725 41.0 39.0 41.0 35.0 41.0 38-39 38.347875 41.0 39.0 41.0 34.5 41.0 40-41 38.043625000000006 41.0 38.0 41.0 33.5 41.0 42-43 37.92225 40.0 38.0 41.0 33.5 41.0 44-45 37.688125 40.0 38.0 41.0 33.0 41.0 46-47 37.31337499999999 40.0 38.0 41.0 32.5 41.0 48-49 37.03675 40.0 38.0 41.0 32.5 41.0 50-51 36.26375 39.5 37.0 40.5 31.0 41.0 52-53 36.537625 39.5 37.0 40.5 31.5 41.0 54-55 36.941 40.0 37.0 41.0 32.0 41.0 56-57 37.156125 40.0 37.0 41.0 32.5 41.0 58-59 37.225125000000006 40.0 37.0 41.0 33.0 41.0 60-61 37.041 40.0 36.0 41.0 33.0 41.0 62-63 36.566625 39.0 35.0 41.0 32.0 41.0 64-65 36.407624999999996 39.0 35.0 41.0 33.0 41.0 66-67 35.800125 38.5 35.0 41.0 32.0 41.0 68-69 35.30075 37.0 35.0 40.5 31.0 41.0 70-71 34.817375 37.0 35.0 39.0 30.5 41.0 72-73 34.231375 36.0 35.0 39.0 29.5 41.0 74-75 33.597125000000005 35.5 35.0 38.0 27.0 40.5 76-77 33.538 35.0 35.0 37.0 29.0 39.0 78-79 33.335375 35.0 35.0 37.0 29.5 39.0 80-81 32.920375 35.0 35.0 36.0 28.5 38.0 82-83 32.537125 35.0 34.5 36.0 27.5 37.0 84-85 28.706875 35.0 31.5 35.0 2.0 37.0 86-87 28.932375 35.0 32.0 35.0 2.0 36.0 88-89 29.154375 35.0 32.0 35.0 2.0 36.0 90-91 29.480625 35.0 33.0 35.0 2.0 36.0 92-93 29.663125 35.0 33.0 35.0 2.0 36.0 94-95 29.58425 35.0 33.0 35.0 2.0 35.0 96-97 29.460625 35.0 33.0 35.0 2.0 35.0 98-99 29.376625 35.0 33.0 35.0 2.0 35.0 100-101 28.271250000000002 34.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 4.0 5 1.0 6 21.0 7 23.0 8 20.0 9 22.0 10 17.0 11 9.0 12 9.0 13 13.0 14 5.0 15 8.0 16 18.0 17 5.0 18 6.0 19 4.0 20 1.0 21 9.0 22 15.0 23 14.0 24 26.0 25 16.0 26 17.0 27 20.0 28 27.0 29 25.0 30 32.0 31 100.0 32 164.0 33 96.0 34 101.0 35 184.0 36 397.0 37 818.0 38 1352.0 39 390.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.975 13.775 7.75 55.50000000000001 2 17.05 19.325 49.875 13.750000000000002 3 21.975 23.925 27.6 26.5 4 24.525 31.125000000000004 23.599999999999998 20.75 5 25.15 31.374999999999996 27.3 16.175 6 19.625 36.325 27.950000000000003 16.1 7 17.349999999999998 17.9 45.725 19.025 8 17.75 21.9 35.6 24.75 9 19.35967983991996 19.759879939969984 38.519259629814904 22.36118059029515 10-11 23.955186304128905 29.7079556898288 26.007049345417926 20.329808660624373 12-13 20.588235294117645 24.829588487755615 32.51704115122444 22.065135066902297 14-15 22.63317344105024 25.56172683665741 30.24488765463267 21.56021206765968 16-17 23.487814117944183 26.341709811844932 29.05669907816644 21.11377699204445 18-19 23.61234599263305 26.31779499555443 27.90549980947542 22.164359202337103 20-21 23.093570973901972 27.651177593889244 27.192870782940805 22.062380649267983 22-23 22.54393728663548 27.032494626375016 27.740548741939563 22.683019345049942 24-25 22.842131598699027 27.23292469352014 26.36977733299975 23.555166374781088 26-27 23.0625 28.487499999999997 27.0625 21.3875 28-29 22.400000000000002 27.025 26.174999999999997 24.4 30-31 22.9375 28.1375 26.700000000000003 22.225 32-33 23.0875 27.0875 27.8375 21.987499999999997 34-35 23.025000000000002 26.924999999999997 26.687499999999996 23.3625 36-37 22.8875 27.400000000000002 26.737499999999997 22.975 38-39 23.375 27.700000000000003 27.025 21.9 40-41 22.961292747087562 27.107603657772767 26.468746085431544 23.462357509708127 42-43 22.762084118016322 27.093534212178277 26.942875078468298 23.2015065913371 44-45 23.14674735249622 27.155824508320727 27.634896621280884 22.06253151790217 46-47 23.013559751615766 27.19553922189836 27.258902547205675 22.531998479280194 48-49 22.227926078028748 27.849075975359344 26.642710472279262 23.28028747433265 50-51 23.13153478765974 27.726862011101073 26.164967084032533 22.97663611720666 52-53 22.61768082663605 26.865671641791046 27.324913892078072 23.19173363949483 54-55 23.883984867591426 27.011349306431278 26.418663303909206 22.686002522068097 56-57 21.782302664655607 28.14228255404726 26.633986928104576 23.441427853192558 58-59 23.085642317380355 27.846347607052895 25.642317380352647 23.425692695214106 60-61 23.187130828201582 27.14590926228478 27.40982782455699 22.25713208495664 62-63 23.13863123589872 27.06192028077212 26.78616194534971 23.013286537979443 64-65 23.964236242286866 26.64651807077194 26.4072534945221 22.98199219241909 66-67 22.842185903983655 27.41317671092952 26.3023493360572 23.44228804902962 68-69 22.360647315694838 27.639352684305162 26.971487284870282 23.02851271512972 70-71 23.738414006179195 26.055612770339852 26.454685890834188 23.751287332646758 72-73 22.880700850296314 27.23524864725586 26.926049987116723 22.9580005153311 74-75 22.899484536082472 27.216494845360824 27.306701030927833 22.577319587628867 76-77 23.421221864951768 27.717041800643088 26.083601286173636 22.778135048231512 78-79 23.344498840505025 27.45426436485442 26.526668384437002 22.674568410203555 80-81 23.010780287474333 26.617043121149898 27.168891170431213 23.203285420944557 82-83 23.27020202020202 26.300505050505052 26.931818181818183 23.497474747474747 84-85 23.15988922897537 27.124325900014572 26.789097799154643 22.926687071855415 86-87 22.524327418431596 28.305666857469948 26.488265598168287 22.681740125930165 88-89 23.39230553215389 26.43920247121595 27.15529345689413 23.01319853973603 90-91 22.81767955801105 27.25138121546961 26.602209944751383 23.328729281767956 92-93 24.08658486143665 26.926788914931755 26.15469460912726 22.831931614504345 94-95 23.518850987432675 27.095705013119737 26.391382405745063 22.99406159370253 96-97 23.295144571740316 28.409710856519364 25.72285870158211 22.57228587015821 98-99 24.570190875863002 28.30648436442399 25.558413428996886 21.56491133071612 100-101 23.014392324093816 27.025586353944565 27.185501066098084 22.77452025586354 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 2.5 10 3.0 11 3.5 12 4.0 13 3.5 14 4.0 15 4.0 16 8.0 17 8.5 18 6.0 19 4.0 20 3.0 21 4.0 22 5.0 23 5.5 24 8.0 25 14.5 26 17.5 27 16.0 28 18.5 29 22.0 30 26.0 31 32.0 32 38.0 33 49.0 34 57.5 35 79.5 36 105.5 37 121.5 38 147.0 39 180.0 40 191.0 41 193.0 42 203.0 43 221.0 44 222.0 45 209.0 46 203.5 47 194.5 48 173.0 49 145.5 50 135.0 51 109.5 52 89.5 53 85.5 54 79.0 55 77.0 56 67.0 57 51.5 58 43.5 59 35.0 60 26.5 61 27.5 62 24.0 63 19.5 64 17.5 65 16.5 66 16.5 67 15.5 68 14.5 69 13.0 70 13.0 71 14.0 72 16.0 73 11.5 74 6.0 75 4.0 76 3.0 77 4.0 78 3.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-11 0.7000000000000001 12-13 0.975 14-15 0.975 16-17 1.0125 18-19 1.5875 20-21 1.8124999999999998 22-23 1.1375 24-25 0.075 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.21250000000000002 42-43 0.43750000000000006 44-45 0.8500000000000001 46-47 1.3625 48-49 2.6 50-51 3.1625 52-53 2.0125 54-55 0.8750000000000001 56-57 0.5499999999999999 58-59 0.75 60-61 0.5375 62-63 0.27499999999999997 64-65 0.7374999999999999 66-67 2.1 68-69 2.675 70-71 2.9000000000000004 72-73 2.9749999999999996 74-75 3.0 76-77 2.8125 78-79 2.9749999999999996 80-81 2.6 82-83 1.0 84-85 14.2375 86-87 12.65 88-89 10.975 90-91 9.5 92-93 9.3375 94-95 9.4875 96-97 8.35 98-99 7.6625 100-101 6.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.57069933639612 96.55 2 1.1485451761102603 2.25 3 0.10209290454313426 0.3 4 0.10209290454313426 0.4 5 0.05104645227156713 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025523226135783564 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTGTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAAT 10 0.25 No Hit CAGGAAGCTCGTGTTCGGGGAACGGGCCCAGGAGGCGGAGAAGCTCGTCC 5 0.125 No Hit GTCGTGTTTTCCGATCGATCGAGTGCGTGTGTTTAGGCTTTGGGTTTGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096528 spots for SRR13844648.sra Written 1096528 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra Read 1096522 spots for SRR13844648.sra Written 1096522 spots for SRR13844648.sra SRR ids: ['SRR13844648.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h9nwm2dg SRR13844648.sra spots: 21930446 blocks: [[1, 1096522], [1096523, 2193044], [2193045, 3289566], [3289567, 4386088], [4386089, 5482610], [5482611, 6579132], [6579133, 7675654], [7675655, 8772176], [8772177, 9868698], [9868699, 10965220], [10965221, 12061742], [12061743, 13158264], [13158265, 14254786], [14254787, 15351308], [15351309, 16447830], [16447831, 17544352], [17544353, 18640874], [18640875, 19737396], [19737397, 20833918], [20833919, 21930446]] SRR13844648 file size 5289579 SRR13844648 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844648 SRR13844648_1.fastq SRR13844648_2.fastq Input file: SRR13844648_1.fastq Paired file: SRR13844648_2.fastq trimmed: SRR13844648-trimmed-pair1.fastq, SRR13844648-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:09:03 2024 >> started Fri Dec 6 13:09:24 2024 >> done (20.402s) 21930446 read pairs processed; of these: 171018 ( 0.78%) short read pairs filtered out after trimming by size control 114930 ( 0.52%) empty read pairs filtered out after trimming by size control 21644498 (98.70%) read pairs available; of these: 3509667 (16.22%) trimmed read pairs available after processing 18134831 (83.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 32 0.00% 20 59 0.00% 21 105 0.00% 22 141 0.00% 23 160 0.00% 24 190 0.00% 25 224 0.00% 26 279 0.00% 27 286 0.00% 28 429 0.00% 29 483 0.00% 30 501 0.00% 31 602 0.00% 32 708 0.00% 33 797 0.00% 34 946 0.00% 35 1065 0.00% 36 1111 0.01% 37 1189 0.01% 38 1280 0.01% 39 1456 0.01% 40 1541 0.01% 41 1760 0.01% 42 1888 0.01% 43 1969 0.01% 44 2201 0.01% 45 2386 0.01% 46 2483 0.01% 47 2756 0.01% 48 2885 0.01% 49 3059 0.01% 50 3427 0.02% 51 3839 0.02% 52 4325 0.02% 53 4799 0.02% 54 5259 0.02% 55 5921 0.03% 56 6720 0.03% 57 7534 0.03% 58 9050 0.04% 59 96205 0.44% 60 120262 0.56% 61 120262 0.56% 62 137034 0.63% 63 116056 0.54% 64 80769 0.37% 65 55446 0.26% 66 41561 0.19% 67 35650 0.16% 68 33820 0.16% 69 30254 0.14% 70 29159 0.13% 71 28506 0.13% 72 28460 0.13% 73 30978 0.14% 74 28298 0.13% 75 29468 0.14% 76 25879 0.12% 77 27348 0.13% 78 28067 0.13% 79 27970 0.13% 80 30180 0.14% 81 31570 0.15% 82 36183 0.17% 83 40908 0.19% 84 39562 0.18% 85 40289 0.19% 86 42334 0.20% 87 44690 0.21% 88 49108 0.23% 89 52965 0.24% 90 56525 0.26% 91 71169 0.33% 92 139431 0.64% 93 77524 0.36% 94 85590 0.40% 95 96496 0.45% 96 116010 0.54% 97 142154 0.66% 98 187795 0.87% 99 252051 1.16% 100 639823 2.96% 101 18134831 83.78% 21644498 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=33 prefix-density=0.53 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=55.48 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.2 sequence=TTTGTTGGTGAGAGCATGGGTGATGATGCCAGCGTGGTGTTTGCATACTACAAGGAAGGAGCCACTGACCCGACATTCCTGTATTTCGCGCATGGGCTTAAGGAGGTCAAGTGCTAAGCGCACTGTATGCTAAAACTATCAGTTGTCCGTATTTTTGATCTGGTCTGTGGTTGTCAGTAGACTCACCAATGTTGGTGGCGTAACTGTTATCAGATGTTGAGTGTCTTGGAAACTTTTCGATAATTGTGGTGTTTGCTTTGTGTAATGGATCCGTGAAATTGGTGTGACGTTAGTATTTCTGTGTTCTGCATGAACAGTACCTTTCTTTTGCTT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.50 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=58.58 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.6 sequence=GCAAAACCATGTGGAATCAAGGTATAAGTTCGCTCTGCTTTCCCGTCTCAGTTTAGTAAGCATCGCTCTGACTGAGAGTAGGATTTATTCTCAGTTGGTTTCCATGGATCGCTAACTAAAAACCTCACGATGTCCTCTTCCAGAAGTTGCAAGTAGTAGTAAACTAGCTAGATATGCAACTCATTATTCATAGGCGACAGCACCGGCCGCGGACCAAGTGCATTACACGGGCCGAGAACACAACTCTACTGCGTGCGTGCCTGGTCGAGGCGGTTCTGCGCCCAGTTCTTGACGTCGTGCGCCTTGGAGTCGAGCCTGGCCCTGGCATAATCCACCTTATCTGCCCCAGGCGGCGAGGAGG SRR13844648 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:10:54 Started mapping on | Dec 06 13:10:54 Finished on | Dec 06 13:11:40 Mapping speed, Million of reads per hour | 1693.92 Number of input reads | 21644498 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 20937849 Uniquely mapped reads % | 96.74% Average mapped length | 195.50 Number of splices: Total | 9164051 Number of splices: Annotated (sjdb) | 8672098 Number of splices: GT/AG | 8989001 Number of splices: GC/AG | 114464 Number of splices: AT/AC | 4617 Number of splices: Non-canonical | 55969 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 1.68 Insertion rate per base | 0.02% Insertion average length | 1.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403273 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 5328 % of reads mapped to too many loci | 0.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.28% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 968047 968047 968047 N_multimapping 403273 403273 403273 N_noFeature 856027 10736885 10655155 N_ambiguous 458853 29682 29626 UnstrandedReadsAssigned:19622969 PositiveStrandReadsAssigned:10171282 NegativeStrandReadsAssigned:10253068 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844648 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844648-trimmed-pair1.fastq SRR13844648-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,644,498 reads, 20,376,683 reads pseudoaligned [quant] estimated average fragment length: 167.688 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,432 rounds 52973 SRR13844648.ke.tsv 35125 SRR13844648.se.tsv 88098 total ==> SRR13844648.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.351 0 0 PNS24247 1044 877.312 6.85284 0.544532 PNS24249 1928 1761.31 11.5251 0.45616 PNS24246 1044 877.312 6.85284 0.544532 PNS24248 1044 877.312 6.85284 0.544532 PNS24244 1471 1304.31 886.916 47.4033 PNS24243 293 132.674 0 0 KQK14069 1603 1436.31 13 0.63096 KQK14071 474 308.46 0 0 ==> SRR13844648.se.tsv <== BRADI_1g14170v3 11 BRADI_1g53295v3 636 BRADI_1g59795v3 859 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 1654 BRADI_1g74790v3 6 BRADI_1g09890v3 0 BRADI_1g77505v3 792 BRADI_1g48960v3 0 SRR13844648 completed mapping pipeline successfully