Starting /dee2/code/volunteer_pipeline.sh SRR13844649 current disk space = 1551188742144 free memory = 1601159620 SRR13844649 SRAfilesize 486974b5f1cc668f9e1b52d8b4d79c21 SRR13844649.sra SRR13844649.sra file validated SRR13844649 is paired end SRR13844649 is conventional basespace SRR13844649 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844649_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2815 34.0 33.0 34.0 31.0 34.0 2 33.37925 34.0 34.0 34.0 31.0 34.0 3 33.415 34.0 34.0 34.0 31.0 34.0 4 36.64225 37.0 37.0 37.0 35.0 37.0 5 36.6185 37.0 37.0 37.0 35.0 37.0 6 36.61275 37.0 37.0 37.0 35.0 37.0 7 36.604 37.0 37.0 37.0 35.0 37.0 8 36.6095 37.0 37.0 37.0 35.0 37.0 9 38.477 39.0 39.0 39.0 37.0 39.0 10-11 38.46025 39.0 39.0 39.0 37.0 39.0 12-13 38.543499999999995 39.0 39.0 39.0 37.0 39.0 14-15 40.205875 41.0 40.0 41.0 38.5 41.0 16-17 40.140875 41.0 40.0 41.0 38.0 41.0 18-19 40.000375000000005 41.0 40.0 41.0 38.0 41.0 20-21 39.89575 41.0 40.0 41.0 38.0 41.0 22-23 39.85025 41.0 40.0 41.0 38.0 41.0 24-25 39.539 41.0 40.0 41.0 37.5 41.0 26-27 39.423 41.0 40.0 41.0 37.5 41.0 28-29 39.4285 41.0 40.0 41.0 38.0 41.0 30-31 39.444125 41.0 40.0 41.0 38.0 41.0 32-33 39.30775 41.0 40.0 41.0 37.0 41.0 34-35 39.312 41.0 40.0 41.0 37.0 41.0 36-37 39.203625 41.0 40.0 41.0 37.0 41.0 38-39 39.132375 41.0 40.0 41.0 36.5 41.0 40-41 39.045375 41.0 40.0 41.0 36.5 41.0 42-43 38.894 41.0 39.0 41.0 35.5 41.0 44-45 38.869375 41.0 39.0 41.0 35.0 41.0 46-47 38.7775 41.0 39.0 41.0 35.0 41.0 48-49 38.69475 40.5 39.0 41.0 35.0 41.0 50-51 38.677625 41.0 39.0 41.0 35.0 41.0 52-53 38.557249999999996 41.0 39.0 41.0 35.0 41.0 54-55 38.430625000000006 40.0 38.0 41.0 35.0 41.0 56-57 38.310375 40.0 38.0 41.0 35.0 41.0 58-59 37.88825 40.0 37.0 41.0 34.0 41.0 60-61 37.79825 40.0 36.5 41.0 34.0 41.0 62-63 37.7465 39.5 36.5 41.0 35.0 41.0 64-65 37.48075 39.0 36.0 41.0 35.0 41.0 66-67 37.218875 39.0 35.0 41.0 34.5 41.0 68-69 36.8845 37.5 35.0 40.5 34.0 41.0 70-71 36.4845 37.0 35.0 39.5 34.0 41.0 72-73 36.074375 36.5 35.0 39.0 34.0 41.0 74-75 35.556250000000006 36.0 35.0 38.5 33.5 40.5 76-77 34.791375 35.0 34.5 37.0 32.0 39.0 78-79 34.72125 35.0 35.0 37.0 33.0 39.0 80-81 34.54725 35.0 35.0 36.5 33.0 38.0 82-83 34.33325 35.0 35.0 36.0 33.0 37.0 84-85 34.009 35.0 35.0 36.0 32.0 37.0 86-87 33.99025 35.0 35.0 35.5 33.0 36.5 88-89 33.819125 35.0 35.0 35.0 32.5 36.0 90-91 33.7705 35.0 35.0 35.0 32.5 36.0 92-93 33.649874999999994 35.0 35.0 35.0 32.5 36.0 94-95 33.615875 35.0 35.0 35.0 32.5 36.0 96-97 33.532624999999996 35.0 35.0 35.0 33.0 35.5 98-99 33.3825 35.0 35.0 35.0 32.0 35.0 100-101 32.274875 34.5 33.0 35.0 28.5 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 11.0 9 20.0 10 15.0 11 4.0 12 5.0 13 3.0 14 3.0 15 2.0 16 1.0 17 2.0 18 3.0 19 2.0 20 4.0 21 1.0 22 4.0 23 3.0 24 4.0 25 8.0 26 5.0 27 8.0 28 13.0 29 15.0 30 31.0 31 20.0 32 39.0 33 52.0 34 67.0 35 175.0 36 322.0 37 927.0 38 1769.0 39 460.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.147147147147148 15.315315315315313 7.932932932932933 54.6046046046046 2 16.925 21.375 48.775 12.925 3 21.224999999999998 24.2 29.025000000000002 25.55 4 23.9 31.35 24.925 19.825 5 27.025 30.4 27.025 15.55 6 20.7 33.95 29.425 15.925 7 18.275 17.575 45.85 18.3 8 17.724999999999998 22.275 35.8 24.2 9 19.725 20.599999999999998 37.625 22.05 10-11 23.599999999999998 29.362500000000004 26.787499999999998 20.25 12-13 21.8125 25.687500000000004 31.0125 21.4875 14-15 22.3375 27.037499999999998 29.775000000000002 20.849999999999998 16-17 23.052881610201275 27.315914489311165 28.028503562945367 21.602700337542196 18-19 22.725 26.8625 28.075 22.3375 20-21 22.85 27.1625 28.499999999999996 21.4875 22-23 23.05 27.950000000000003 27.3 21.7 24-25 22.725 28.15 26.85 22.275 26-27 23.6375 27.037499999999998 27.325 22.0 28-29 22.875 27.962500000000002 26.737499999999997 22.425 30-31 23.3875 27.450000000000003 26.8125 22.35 32-33 23.125 27.712500000000002 27.375 21.7875 34-35 22.2125 27.1375 27.487499999999997 23.1625 36-37 22.875 27.925 26.400000000000002 22.8 38-39 23.1875 27.287499999999998 27.0 22.525000000000002 40-41 22.5834688008003 27.060147555333252 27.91046642490934 22.44591721895711 42-43 22.375 27.2625 27.224999999999998 23.1375 44-45 22.4875 27.224999999999998 27.3 22.9875 46-47 22.4875 27.1125 26.887499999999996 23.5125 48-49 22.650000000000002 27.287499999999998 27.3625 22.7 50-51 22.900000000000002 28.849999999999998 25.8 22.45 52-53 22.9375 28.499999999999996 26.187500000000004 22.375 54-55 22.45 28.5625 26.75 22.237499999999997 56-57 23.0125 27.125 26.187500000000004 23.674999999999997 58-59 23.25 27.224999999999998 27.0875 22.4375 60-61 22.525000000000002 27.875 26.125 23.474999999999998 62-63 22.95 27.1 26.487500000000004 23.4625 64-65 22.5875 26.900000000000002 27.487499999999997 23.025000000000002 66-67 22.7 27.712500000000002 26.650000000000002 22.9375 68-69 23.6625 27.487499999999997 27.0 21.85 70-71 23.799999999999997 27.237499999999997 26.224999999999998 22.7375 72-73 23.325000000000003 26.3625 27.287499999999998 23.025000000000002 74-75 23.1625 27.537499999999998 26.437500000000004 22.8625 76-77 22.6 27.625 26.8125 22.9625 78-79 23.0125 27.0875 27.187499999999996 22.7125 80-81 23.1125 27.4125 26.7125 22.7625 82-83 22.6125 28.249999999999996 26.0375 23.1 84-85 23.0875 27.425 26.737499999999997 22.75 86-87 22.725 27.5125 26.5375 23.225 88-89 22.900000000000002 27.8875 26.525 22.6875 90-91 22.9875 27.3375 27.425 22.25 92-93 23.275000000000002 27.450000000000003 27.150000000000002 22.125 94-95 22.725 27.375 26.187500000000004 23.7125 96-97 22.900000000000002 28.9375 26.075 22.0875 98-99 23.1 27.35 26.775 22.775000000000002 100-101 22.30980980980981 27.94044044044044 26.63913913913914 23.11061061061061 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.5 20 3.0 21 3.5 22 1.5 23 3.0 24 4.0 25 3.5 26 4.0 27 6.0 28 13.5 29 14.0 30 12.5 31 19.5 32 30.0 33 38.0 34 47.0 35 81.0 36 102.5 37 105.5 38 137.5 39 173.5 40 202.0 41 211.0 42 209.5 43 222.0 44 221.0 45 229.5 46 233.0 47 198.5 48 187.5 49 181.0 50 143.5 51 124.5 52 111.0 53 98.0 54 97.0 55 84.5 56 71.0 57 52.5 58 37.5 59 39.0 60 33.0 61 24.0 62 20.5 63 19.0 64 18.0 65 17.0 66 13.5 67 11.5 68 11.0 69 9.5 70 10.5 71 11.5 72 12.5 73 7.5 74 2.0 75 5.0 76 6.0 77 2.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0375 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.3903934593766 96.275 2 1.2263668880940215 2.4 3 0.3065917220235054 0.8999999999999999 4 0.0 0.0 5 0.0510986203372509 0.25 6 0.0 0.0 7 0.02554931016862545 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTGTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAAT 7 0.17500000000000002 No Hit CTGAAACATGCAACAGGAGACAGGAACGACGACACTGGGACACATGAACA 5 0.125 No Hit CTCACATTTATTTTGCCGGAAAACTGTCACGTACAAAACGTACACGGTAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR13844649 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR13844649_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00275 34.0 33.0 34.0 31.0 34.0 2 33.0395 34.0 34.0 34.0 31.0 34.0 3 32.90925 34.0 34.0 34.0 31.0 34.0 4 36.3275 37.0 37.0 37.0 35.0 37.0 5 36.20775 37.0 37.0 37.0 35.0 37.0 6 36.25125 37.0 37.0 37.0 35.0 37.0 7 36.32075 37.0 37.0 37.0 35.0 37.0 8 36.29325 37.0 37.0 37.0 35.0 37.0 9 38.14325 39.0 39.0 39.0 37.0 39.0 10-11 37.917875 39.0 39.0 39.0 37.0 39.0 12-13 37.706125 39.0 39.0 39.0 36.0 39.0 14-15 39.296375 41.0 40.0 41.0 37.5 41.0 16-17 39.2735 41.0 40.0 41.0 37.0 41.0 18-19 38.92125 41.0 40.0 41.0 36.5 41.0 20-21 38.7675 41.0 40.0 41.0 37.0 41.0 22-23 38.57575 41.0 40.0 41.0 36.0 41.0 24-25 38.713 41.0 40.0 41.0 36.5 41.0 26-27 38.6965 41.0 40.0 41.0 36.0 41.0 28-29 38.6665 41.0 40.0 41.0 36.0 41.0 30-31 38.56325 41.0 40.0 41.0 35.5 41.0 32-33 38.463375 41.0 40.0 41.0 35.0 41.0 34-35 38.272125 41.0 39.5 41.0 34.5 41.0 36-37 38.218625 41.0 39.0 41.0 34.5 41.0 38-39 38.123125 41.0 39.0 41.0 34.5 41.0 40-41 37.8545 40.5 39.0 41.0 33.0 41.0 42-43 37.731125 40.0 38.5 41.0 33.0 41.0 44-45 37.558125000000004 40.0 38.0 41.0 33.0 41.0 46-47 37.242374999999996 40.0 38.0 41.0 33.0 41.0 48-49 36.870625000000004 40.0 38.0 41.0 31.5 41.0 50-51 36.147125 39.5 37.5 40.5 31.0 41.0 52-53 36.347875 39.5 37.0 40.5 31.0 41.0 54-55 36.855374999999995 40.0 37.0 41.0 31.5 41.0 56-57 37.033500000000004 40.0 37.0 41.0 32.5 41.0 58-59 37.070499999999996 40.0 37.0 41.0 33.0 41.0 60-61 36.976124999999996 40.0 36.0 41.0 33.0 41.0 62-63 36.41175 39.0 35.0 41.0 31.5 41.0 64-65 36.257125 39.0 35.0 41.0 32.5 41.0 66-67 35.67875 38.5 35.0 41.0 31.5 41.0 68-69 35.17225 37.0 35.0 40.5 31.5 41.0 70-71 34.668875 37.0 35.0 39.0 30.0 41.0 72-73 34.046499999999995 36.0 35.0 39.0 29.0 41.0 74-75 33.338125000000005 35.5 34.5 38.0 26.0 40.0 76-77 33.342375 35.0 35.0 37.0 28.5 39.0 78-79 33.20275 35.0 35.0 37.0 29.0 39.0 80-81 32.740875 35.0 35.0 36.0 28.0 38.0 82-83 32.297875000000005 35.0 34.5 36.0 26.0 37.0 84-85 28.39225 35.0 31.0 35.0 2.0 37.0 86-87 28.577375 35.0 31.5 35.0 2.0 36.0 88-89 28.852375000000002 35.0 31.5 35.0 2.0 36.0 90-91 29.169125 35.0 32.5 35.0 2.0 36.0 92-93 29.404125 35.0 32.5 35.0 2.0 36.0 94-95 29.272375 35.0 33.0 35.0 2.0 35.5 96-97 29.15025 35.0 32.5 35.0 2.0 35.0 98-99 29.043375 35.0 32.5 35.0 2.0 35.0 100-101 27.959875 34.0 29.0 35.0 2.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 1.0 4 7.0 5 7.0 6 27.0 7 18.0 8 22.0 9 23.0 10 34.0 11 10.0 12 8.0 13 12.0 14 5.0 15 6.0 16 7.0 17 4.0 18 7.0 19 3.0 20 7.0 21 7.0 22 15.0 23 22.0 24 21.0 25 18.0 26 18.0 27 20.0 28 29.0 29 19.0 30 50.0 31 79.0 32 161.0 33 105.0 34 98.0 35 186.0 36 349.0 37 817.0 38 1405.0 39 363.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.45 14.149999999999999 7.875 55.525000000000006 2 18.475 20.375 48.949999999999996 12.2 3 22.725 22.775000000000002 28.050000000000004 26.450000000000003 4 25.174999999999997 30.875000000000004 23.825 20.125 5 25.474999999999998 31.05 26.8 16.675 6 19.225 33.650000000000006 29.775000000000002 17.349999999999998 7 17.7 18.099999999999998 46.675 17.525 8 17.05 21.175 38.025 23.75 9 19.91991991991992 19.91991991991992 39.314314314314316 20.845845845845844 10-11 23.500504032258064 30.16633064516129 26.953125 19.380040322580644 12-13 20.983440778662622 24.851472633042597 33.14372392870686 21.021362659587915 14-15 21.79519595448799 26.422250316055624 30.796460176991154 20.986093552465235 16-17 23.081784856528884 26.45683225888004 28.378207559094932 22.083175325496143 18-19 22.873825844122877 26.643818227976645 28.30667682152831 22.175679106372176 20-21 22.41861648016277 26.653102746693797 27.810274669379453 23.11800610376399 22-23 22.448206164729662 27.235977766548764 28.67609903991915 21.639717028802423 24-25 22.913277437116754 27.993993242397696 26.229508196721312 22.863221123764234 26-27 23.225 28.000000000000004 26.85 21.925 28-29 22.6125 27.750000000000004 26.387500000000003 23.25 30-31 22.8125 27.625 26.875 22.6875 32-33 22.900000000000002 27.474999999999998 26.700000000000003 22.925 34-35 22.537499999999998 27.5625 26.825 23.075000000000003 36-37 22.675 27.650000000000002 26.525 23.150000000000002 38-39 22.85 26.625 27.6375 22.8875 40-41 22.752914629559985 27.316033596590195 27.153065062053404 22.777986711796412 42-43 21.492274839844242 28.5265670141942 27.3206883557342 22.66046979022736 44-45 21.55650857719475 28.582240161453075 27.573158425832496 22.288092835519677 46-47 22.454672245467226 27.348801825789277 27.538988208444277 22.657537720299224 48-49 23.20832263036219 27.35679424608271 26.136655535576676 23.298227587978424 50-51 22.73314389046758 26.905192456729527 27.408938258847844 22.95272539395505 52-53 22.95918367346939 27.487244897959183 26.683673469387752 22.869897959183675 54-55 22.401614530776992 28.393037336024218 25.756811301715437 23.44853683148335 56-57 22.884446120960643 27.976864076449136 27.008675971331574 22.130013831258644 58-59 23.958202190608084 27.84841999244618 26.236938184565027 21.95643963238071 60-61 23.161071293851375 27.411039859172636 27.008675971331574 22.419212875644412 62-63 22.958223560406473 27.22368586124702 26.03186551248275 23.786225065863757 64-65 22.943177522993572 27.252110369157112 27.063122086430642 22.741590021418673 66-67 24.106687085247575 25.52322613578356 26.59520163348647 23.77488514548239 68-69 23.049235120195398 27.175729528216998 27.16287440545057 22.612160946137035 70-71 23.960345049568687 27.063216170979786 26.973091283635895 22.003347495815632 72-73 22.700889978073004 26.97020508190378 27.13788211015091 23.191022829872306 74-75 24.061895551257255 26.125080593165702 27.68536428110896 22.127659574468083 76-77 21.992021618839274 27.396731437395445 27.525415004503923 23.085831939261357 78-79 23.06303983498775 27.523527136779684 26.89183962872244 22.52159339951012 80-81 22.744192016429214 27.570273392375817 26.748812732640225 22.936721858554744 82-83 22.724403484408533 27.925766948617596 26.764297437192276 22.585532129781594 84-85 23.342642951638982 27.767161546376602 25.76804351021608 23.122151991768337 86-87 22.695752672637965 28.08436867957238 26.119618607338918 23.10026004045074 88-89 22.440333286259005 27.58085016240644 26.67702301934755 23.30179353198701 90-91 22.527396310167845 28.506034124011652 26.16174226661118 22.80482729920932 92-93 23.551376019914258 28.184206887014245 26.45553865302171 21.808878440049785 94-95 23.548163548163547 26.985446985446988 26.70824670824671 22.758142758142757 96-97 22.052192922530402 28.555813635742588 26.328733433529173 23.06326000819784 98-99 22.83582089552239 28.331071913161466 27.096336499321573 21.736770691994572 100-101 22.286173203051803 28.69763083924508 26.556016597510375 22.460179360192743 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 1.5 10 3.5 11 5.5 12 4.5 13 3.5 14 2.5 15 4.5 16 6.5 17 5.0 18 6.5 19 6.0 20 5.5 21 6.5 22 7.0 23 9.0 24 12.0 25 12.0 26 11.0 27 12.5 28 17.0 29 22.0 30 29.0 31 35.5 32 43.5 33 63.0 34 73.5 35 77.0 36 100.0 37 115.0 38 141.5 39 174.5 40 187.0 41 197.0 42 205.5 43 214.0 44 213.5 45 217.5 46 212.0 47 205.5 48 196.0 49 166.0 50 136.5 51 111.5 52 93.0 53 78.5 54 65.5 55 67.5 56 64.5 57 47.0 58 41.0 59 39.0 60 29.5 61 22.5 62 23.0 63 21.0 64 16.5 65 12.0 66 13.0 67 16.0 68 13.0 69 11.5 70 8.0 71 6.5 72 11.0 73 7.5 74 2.5 75 2.5 76 1.5 77 1.5 78 1.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.1 10-11 0.8 12-13 1.1125 14-15 1.125 16-17 1.1125 18-19 1.525 20-21 1.7000000000000002 22-23 1.05 24-25 0.11249999999999999 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.2875 42-43 0.4875 44-45 0.8999999999999999 46-47 1.4125 48-49 2.675 50-51 3.225 52-53 2.0 54-55 0.8999999999999999 56-57 0.5875 58-59 0.7125 60-61 0.5875 62-63 0.36250000000000004 64-65 0.7875 66-67 2.0500000000000003 68-69 2.7625 70-71 2.9125 72-73 3.0875 74-75 3.0625 76-77 2.8625000000000003 78-79 3.0375 80-81 2.6125 82-83 0.9875 84-85 14.9625 86-87 13.475000000000001 88-89 11.4875 90-91 9.887500000000001 92-93 9.6125 94-95 9.8125 96-97 8.512500000000001 98-99 7.875 100-101 6.612500000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.33929483903935 96.22500000000001 2 1.3796627491057742 2.7 3 0.12774655084312722 0.375 4 0.1021972406745018 0.4 5 0.0 0.0 6 0.0510986203372509 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGTGTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAAT 6 0.15 No Hit GTAAAAAGTAGTGCACGTCCCTCCCTAGCCAGCCGCTGTAGCAATGCTGT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147249 spots for SRR13844649.sra Written 1147249 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra Read 1147242 spots for SRR13844649.sra Written 1147242 spots for SRR13844649.sra SRR ids: ['SRR13844649.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u_9cola5 SRR13844649.sra spots: 22944847 blocks: [[1, 1147242], [1147243, 2294484], [2294485, 3441726], [3441727, 4588968], [4588969, 5736210], [5736211, 6883452], [6883453, 8030694], [8030695, 9177936], [9177937, 10325178], [10325179, 11472420], [11472421, 12619662], [12619663, 13766904], [13766905, 14914146], [14914147, 16061388], [16061389, 17208630], [17208631, 18355872], [18355873, 19503114], [19503115, 20650356], [20650357, 21797598], [21797599, 22944847]] SRR13844649 file size 5535254 SRR13844649 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR13844649 SRR13844649_1.fastq SRR13844649_2.fastq Input file: SRR13844649_1.fastq Paired file: SRR13844649_2.fastq trimmed: SRR13844649-trimmed-pair1.fastq, SRR13844649-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:07:38 2024 >> started Fri Dec 6 13:08:00 2024 >> done (22.193s) 22944847 read pairs processed; of these: 177972 ( 0.78%) short read pairs filtered out after trimming by size control 121433 ( 0.53%) empty read pairs filtered out after trimming by size control 22645442 (98.70%) read pairs available; of these: 3643891 (16.09%) trimmed read pairs available after processing 19001551 (83.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 41 0.00% 20 74 0.00% 21 122 0.00% 22 148 0.00% 23 199 0.00% 24 229 0.00% 25 307 0.00% 26 334 0.00% 27 352 0.00% 28 392 0.00% 29 514 0.00% 30 599 0.00% 31 665 0.00% 32 763 0.00% 33 915 0.00% 34 994 0.00% 35 1104 0.00% 36 1187 0.01% 37 1272 0.01% 38 1459 0.01% 39 1585 0.01% 40 1606 0.01% 41 1824 0.01% 42 2041 0.01% 43 2206 0.01% 44 2384 0.01% 45 2605 0.01% 46 2646 0.01% 47 2970 0.01% 48 3102 0.01% 49 3382 0.01% 50 3613 0.02% 51 4098 0.02% 52 4427 0.02% 53 5141 0.02% 54 5472 0.02% 55 6052 0.03% 56 6999 0.03% 57 7666 0.03% 58 9238 0.04% 59 101592 0.45% 60 127357 0.56% 61 127636 0.56% 62 146165 0.65% 63 125014 0.55% 64 87560 0.39% 65 59597 0.26% 66 44586 0.20% 67 38442 0.17% 68 35627 0.16% 69 31971 0.14% 70 30833 0.14% 71 29536 0.13% 72 29868 0.13% 73 31996 0.14% 74 30145 0.13% 75 31132 0.14% 76 28755 0.13% 77 29710 0.13% 78 30307 0.13% 79 30332 0.13% 80 32174 0.14% 81 34140 0.15% 82 37504 0.17% 83 42949 0.19% 84 42371 0.19% 85 42849 0.19% 86 44404 0.20% 87 46836 0.21% 88 50261 0.22% 89 54188 0.24% 90 57922 0.26% 91 72093 0.32% 92 143455 0.63% 93 79110 0.35% 94 86879 0.38% 95 97821 0.43% 96 117073 0.52% 97 144446 0.64% 98 190704 0.84% 99 256290 1.13% 100 651518 2.88% 101 19001551 83.91% 22645442 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=35 prefix-density=0.36 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=46.65 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.6 sequence=GAGAAGGTGGTCGGAGGAGCGAAGGAAGGCAGGGAGTACAAGCCTGAGTGAGCGGGCTGGTCTGACACGTTGCAAGTCTCCGAGCGTTGGGGAGTTTTGGGTCCTCCTGCATTTCGATCCTTTGCTTTAGCTAGACACGTTATAAAGGTGTCCTACTTAAGTACCCATGGAGTGTTTTCAGATCGCTAGAATAATAATGTCCGTGTATGATGTTTCTCTATGTACCTAAAGACTAGGTTGTGGTGCCTGATGATGAAGGTACGTGCTAGGAATGAGATGGTGGTGTACATACTAAAGTTGTGCTATGTGTTTGTGTTTAGCTCTGTCGAATAATGTTTGTACATGATCTTTCTGCTAGTGATGAAACTGTGCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=36 prefix-density=0.35 prefix-fanout=2.0 sequence=CGGTACACGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=55.75 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.1 sequence=GAGAAGGTGGTCGGAGGAGCGAAGGAAGGCAGGGAGTACAAGCCTGAGTGAGCGGGCTGGTCTGACACGTTGCAAGTCTCCGAGCGTTGGGGAGTTTTGGGTCCTCCTGCATTTCGATCCTTTGCTTTAGCTAGACACGTTATAAAGGTGTCCTACTTAAGTACCCATGGAGTGTTTTCAGATCGCTAGAATAATAATGTCCGTGTATGATGTTTCTCTATGTACCTAAAGACTAGGTTGTGGTGCCTGATGATGAAGGTACGTGCTAGGAATGAGATGGTGGTGTACATACTAAAGTTGTGCTATGTGTTTGTGTTTAGCTCTGTCGAATAATGTTTGTACATGATCTTTCTGCTAGTGATGA SRR13844649 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:08:36 Started mapping on | Dec 06 13:08:36 Finished on | Dec 06 13:09:28 Mapping speed, Million of reads per hour | 1567.76 Number of input reads | 22645442 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 21858809 Uniquely mapped reads % | 96.53% Average mapped length | 195.42 Number of splices: Total | 10252550 Number of splices: Annotated (sjdb) | 9693041 Number of splices: GT/AG | 10061468 Number of splices: GC/AG | 131380 Number of splices: AT/AC | 5163 Number of splices: Non-canonical | 54539 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 1.62 Insertion rate per base | 0.02% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410187 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 12758 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1096703 1096703 1096703 N_multimapping 410187 410187 410187 N_noFeature 896303 11223874 11119729 N_ambiguous 467303 29339 28947 UnstrandedReadsAssigned:20495203 PositiveStrandReadsAssigned:10605596 NegativeStrandReadsAssigned:10710133 Dataset is classified unstranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 SRR13844649 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR13844649-trimmed-pair1.fastq SRR13844649-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,645,442 reads, 21,270,162 reads pseudoaligned [quant] estimated average fragment length: 169.617 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52973 SRR13844649.ke.tsv 35125 SRR13844649.se.tsv 88098 total ==> SRR13844649.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 767.463 0 0 PNS24247 1044 875.383 11.0715 0.864821 PNS24249 1928 1759.38 3.72483 0.144766 PNS24246 1044 875.383 11.0715 0.864821 PNS24248 1044 875.383 11.0715 0.864821 PNS24244 1471 1302.38 849.061 44.5779 PNS24243 293 131.969 1 0.518143 KQK14069 1603 1434.38 97.3788 4.64215 KQK14071 474 306.706 5.86954 1.30858 ==> SRR13844649.se.tsv <== BRADI_1g14170v3 234 BRADI_1g53295v3 1430 BRADI_1g59795v3 788 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 796 BRADI_1g74790v3 0 BRADI_1g09890v3 0 BRADI_1g77505v3 731 BRADI_1g48960v3 0 SRR13844649 completed mapping pipeline successfully